ID: 947749183

View in Genome Browser
Species Human (GRCh38)
Location 2:232523924-232523946
Sequence CTGCAGCGCCGGCGGCGATG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947749174_947749183 15 Left 947749174 2:232523886-232523908 CCCAGGGCGCCTGTGCGCGCCTG 0: 1
1: 0
2: 1
3: 7
4: 110
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156
947749171_947749183 29 Left 947749171 2:232523872-232523894 CCTGTGCCCGGGGTCCCAGGGCG 0: 1
1: 2
2: 1
3: 15
4: 209
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156
947749173_947749183 22 Left 947749173 2:232523879-232523901 CCGGGGTCCCAGGGCGCCTGTGC 0: 1
1: 0
2: 0
3: 32
4: 359
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156
947749175_947749183 14 Left 947749175 2:232523887-232523909 CCAGGGCGCCTGTGCGCGCCTGG 0: 1
1: 0
2: 2
3: 12
4: 175
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156
947749172_947749183 23 Left 947749172 2:232523878-232523900 CCCGGGGTCCCAGGGCGCCTGTG 0: 1
1: 0
2: 0
3: 33
4: 344
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156
947749178_947749183 -4 Left 947749178 2:232523905-232523927 CCTGGCGCACCAGCAGTGCCTGC 0: 1
1: 0
2: 0
3: 25
4: 424
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156
947749177_947749183 6 Left 947749177 2:232523895-232523917 CCTGTGCGCGCCTGGCGCACCAG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG 0: 1
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947749183 Original CRISPR CTGCAGCGCCGGCGGCGATG CGG Exonic
900249293 1:1658913-1658935 CGGCAGCGGCGGCGGCGTAGGGG - Exonic
900630055 1:3630158-3630180 GTGCAGAGCCGGCAGAGATGGGG - Intergenic
903034439 1:20485316-20485338 CTACGGCGACGGCGGCGACGTGG - Exonic
905448519 1:38043025-38043047 CTGCAGTGGTGGCGGTGATGAGG + Intergenic
906478259 1:46184310-46184332 CCACAACGCCGGCTGCGATGAGG - Exonic
907091410 1:51729489-51729511 CTGCGGCGCCGGCGCTGCTGGGG - Intronic
913100896 1:115564388-115564410 CAGCGGCGGCGGCGGCGATCAGG - Intergenic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
917222618 1:172748260-172748282 CTTCAGCACCGGAGGAGATGAGG - Intergenic
917869594 1:179229627-179229649 CGGCGGCGGCGGCGGCGTTGGGG - Intronic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919980944 1:202642773-202642795 CTGCAGCGCCTGCCTCGCTGAGG - Intronic
919981102 1:202643378-202643400 CGGCAGGGCCGGCGGGGAAGTGG - Exonic
921166941 1:212514491-212514513 CTGCGGCGCCCGCGGTGGTGGGG - Intergenic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1072731494 10:97849962-97849984 CGGCGGCGGCGGCGGGGATGGGG - Intergenic
1076371518 10:129959061-129959083 CTGCAGCGCCCGGGGCGATTTGG - Intronic
1077459239 11:2700475-2700497 CTGCAGCGGCGCCGGCGGAGGGG - Intronic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078498274 11:11842070-11842092 CTGGAGCGCAGGCGGCGGAGAGG + Exonic
1081832056 11:46121979-46122001 CGGCGGCGGCGGCGGTGATGGGG + Intergenic
1082003739 11:47408636-47408658 CGGCGGCGGCGGCGGCGATCCGG - Exonic
1083329819 11:61892104-61892126 CTGCAGCGCCGAGGGCGGAGGGG - Intergenic
1083571477 11:63764101-63764123 CGGCAGTGCCGGGGGGGATGGGG + Exonic
1084967364 11:72751714-72751736 GTGCAGGGCCGGCGGGGAGGGGG - Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1094229993 12:28092075-28092097 CTGCAGCACAGGTGGCTATGTGG + Intergenic
1094539024 12:31347629-31347651 CAGCAGCCCCGGAGGAGATGAGG + Intergenic
1095465185 12:42482856-42482878 CTGCTGCGGCGGCGGGGATGGGG - Intronic
1103377716 12:120469643-120469665 CTGAGGCGGCGGCGGCGACGTGG - Exonic
1104692759 12:130839094-130839116 CTGCCCGGCCGGCGGGGATGCGG - Exonic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1116895515 14:50311972-50311994 CAGCAGCGCAGGCGGCGGGGAGG + Intronic
1121841724 14:97140015-97140037 CTGCAGTGCCGGTGGTCATGAGG - Intergenic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122960883 14:105093230-105093252 CTGCACCGCGGGCGGGGCTGGGG + Intergenic
1123630663 15:22257945-22257967 CTGCGGCGCGGGGGGAGATGGGG + Intergenic
1124496795 15:30192108-30192130 CGGCAGGGCCGGCGGGGAAGTGG - Intergenic
1124746781 15:32346539-32346561 CGGCAGGGCCGGCGGGGAAGTGG + Intergenic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1127144088 15:56007201-56007223 CGGCGGCGGCGGTGGCGATGGGG + Intergenic
1129740456 15:77987242-77987264 CTGCGGGGCCGGCGGCCACGCGG - Intronic
1129845128 15:78764641-78764663 CTGTAGCTCCGGCCGGGATGAGG - Exonic
1132055675 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG + Exonic
1132666086 16:1081962-1081984 CTGCAGGGCCGGCAGCCACGAGG + Intergenic
1133247556 16:4459240-4459262 CTGCAGAGCCGGCTCTGATGTGG + Intergenic
1139402925 16:66696598-66696620 CGGCGGCGGCGGCGGCGATGCGG - Exonic
1140229883 16:73108865-73108887 CTGCAGGCCTGGTGGCGATGGGG + Intergenic
1141972403 16:87492636-87492658 CTGCGGCGCGGGGGGAGATGGGG - Intergenic
1142224916 16:88872652-88872674 CGGGAGAGCCGGCGGGGATGGGG - Intergenic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1147369368 17:39981047-39981069 CTGGGGGGCCGGCGGCGGTGGGG - Exonic
1148021784 17:44558185-44558207 CTGCAGTCCCGGCGGCGGCGCGG - Exonic
1148214285 17:45825916-45825938 CTGCAGCGCCTGGGACGAGGTGG + Intronic
1148467236 17:47872503-47872525 CGGCGGCGGCGGCGGCGATGGGG + Intergenic
1149599649 17:57885264-57885286 CAGCAGCGGCGGCGTCTATGAGG - Exonic
1151780134 17:76240235-76240257 CTGCAGCCGCAGCGGCCATGGGG - Exonic
1152110073 17:78353043-78353065 CGGCTGCGGCCGCGGCGATGCGG + Intergenic
1152345335 17:79747679-79747701 CTGCAGCCCCCGCGCCGCTGCGG - Intergenic
1152468017 17:80476598-80476620 CCGCAGCGCAGGCGGCAGTGGGG - Exonic
1152521938 17:80861728-80861750 CTGCAGCACTGGCGGTGCTGGGG - Intronic
1152631745 17:81413640-81413662 CTGCAGCCCCCGCGGCCTTGTGG - Intronic
1155507616 18:26548365-26548387 CTGCAGCGCGGGCGAGGAGGAGG - Intronic
1155902754 18:31411322-31411344 CTGCGGCCCCTGCGGCCATGAGG - Exonic
1157794216 18:50559973-50559995 CTGCTGCGGCGGTGGCGCTGGGG - Intergenic
1158259089 18:55588064-55588086 GTGCACCGCCGGCGCCGAGGCGG + Intronic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1160455387 18:78995479-78995501 CTCCAGCCCCGGCTGCGGTGCGG + Intronic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1162095008 19:8305040-8305062 CTGCAGCGATGGCAGCGATGAGG - Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1163036470 19:14571995-14572017 CTGCAGCGACTGCAGCCATGGGG - Exonic
1165014310 19:32869700-32869722 CTGCAGAGCCGGAGGAGCTGCGG + Exonic
1165772097 19:38385912-38385934 CTGCAGTGTGGGCGGCGGTGTGG + Exonic
1167037941 19:47005309-47005331 CTGCAGCTCCTGCGGCCATGGGG - Intergenic
1167149868 19:47702327-47702349 GTGCAGGGGCGGCGGGGATGCGG - Exonic
1168564454 19:57411596-57411618 CTGCAGAGCGGGCGGCACTGGGG + Intronic
925208526 2:2027113-2027135 CTGTGGCGGCAGCGGCGATGGGG - Intronic
925515217 2:4674365-4674387 CTTCAGAGCCTGCGGTGATGGGG - Intergenic
926202635 2:10812721-10812743 CTGAAGCGGCGGCGGCGGTGGGG - Intronic
927181099 2:20447287-20447309 CTGCCGCGGCGGGGGCGGTGGGG - Exonic
927558025 2:24049722-24049744 CTGCAGAGCCGGAGGAGGTGCGG - Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
934567134 2:95347141-95347163 CTGCGGCGGAGGCGGCGAAGGGG - Intronic
940300982 2:152176036-152176058 CTGCAGTGCCAGCGGCGGCGCGG + Intergenic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
944127231 2:196307976-196307998 CTGCAGCACCTGCGGGGCTGGGG + Exonic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
1168802628 20:653180-653202 CCGCGGCGGCGGCGACGATGGGG - Exonic
1169278487 20:4248870-4248892 CTCCAGCGCGGGCGGCGGCGGGG - Exonic
1171491130 20:25518159-25518181 CTGCAGTGCTGGTGGCGTTGGGG - Intronic
1172083220 20:32358681-32358703 CTGGGGCGGCGGCGGCGGTGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1174081477 20:47973409-47973431 ATGCAGCGCCGACGGTGATGTGG - Intergenic
1174135021 20:48373477-48373499 ATGCAGCGCCGACGGTGATGTGG + Intergenic
1174357826 20:50010107-50010129 CGGCGGCGGCGGCGGCGAGGGGG + Intergenic
1175733693 20:61371203-61371225 GTGCAGTGCTGGCGGTGATGGGG + Intronic
1176301921 21:5102572-5102594 CTGCAGCGCCGACTGAGGTGAGG - Intergenic
1176625257 21:9087133-9087155 CTGCAGCTGCGGCTCCGATGTGG - Intergenic
1176882714 21:14216465-14216487 CTGCAGCGCGGATGGGGATGGGG - Intronic
1178103895 21:29298491-29298513 CTGCAGCTCCCGAGGCGAGGAGG + Intronic
1179054089 21:37915773-37915795 CTGCGGCGACGGCGGAGCTGGGG + Intronic
1179797049 21:43791157-43791179 CTGCCGCGCCTGTGGCTATGCGG - Intronic
1179855109 21:44159328-44159350 CTGCAGCGCCGACTGAGGTGAGG + Intergenic
1181286539 22:21756556-21756578 TTGCAGAGCCGGGGGCGGTGGGG + Exonic
1181652959 22:24271036-24271058 CGGCAGCGCGGGCGGCGCTGAGG - Intronic
1184620330 22:45671916-45671938 CTGCAGCGGCGGCGGCGGTTAGG + Exonic
950316346 3:12004742-12004764 CTGCGGCGCGGGCGCCGAGGCGG - Exonic
952382992 3:32818634-32818656 CAGCAGCGCCGACGGGGAAGCGG - Exonic
952451780 3:33440123-33440145 CTGCAGCGCTAGCGGCGCGGGGG - Exonic
953033753 3:39193869-39193891 CTGCAGCGTCAGCTGGGATGGGG + Intergenic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
956678145 3:71754073-71754095 TGGCAGCGGCGGCGGCGAGGCGG + Exonic
957925494 3:86805405-86805427 CTGCAGTGCAGGTGGCTATGGGG + Intergenic
958959129 3:100492421-100492443 GTGCAGCGCCGTCGCTGATGTGG - Intergenic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
968780396 4:2576126-2576148 CTGCAGCCCGGGCGACAATGTGG - Intronic
968832823 4:2941934-2941956 CCGCAGCGCCAGCTGGGATGGGG + Intronic
968980978 4:3849197-3849219 CTGCAGGGCTGGAGGCCATGGGG - Intergenic
969394212 4:6910024-6910046 CTGCAGCGCCGGCCGAGGCGGGG + Intronic
969492051 4:7505049-7505071 CTGGAGCGCCGGGAGGGATGGGG + Intronic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
972418759 4:38867757-38867779 CTGCAGGGCCGGCGGGGACGCGG - Intronic
973954606 4:56049722-56049744 ATGCAGCTCCGGGGGCGGTGGGG - Intergenic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
976390028 4:84497758-84497780 CAGCAGCCCCGCCGGGGATGAGG + Exonic
982224407 4:153152963-153152985 CTTCAGCGGCGGCGTCGCTGGGG + Intronic
982484779 4:155953778-155953800 GTGCCGGGGCGGCGGCGATGCGG - Exonic
994525432 5:100900858-100900880 CCAGAGCGCCGGCGGCGAGGGGG - Intronic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
999424527 5:151475745-151475767 CTGCAGCACCTGCAGCCATGAGG - Intronic
1001563228 5:172683647-172683669 CAGTAGCGCCGGCGACGACGCGG - Exonic
1002621944 5:180494343-180494365 TTGGAGCGCCGGCGGCGGTCCGG + Intergenic
1011194007 6:84763998-84764020 CTGCAGCCGCGGCGGCGGCGCGG - Exonic
1013230569 6:108158027-108158049 CTGCAGGGCCGGGGGCGCGGGGG - Intronic
1013366394 6:109441062-109441084 CTCCAGCGACGGCCGCGGTGGGG - Exonic
1015843049 6:137493493-137493515 CTGCAGCGCGGGCGGCGTGGAGG + Exonic
1017672322 6:156778985-156779007 CGGCGGCGGCGGCGGCTATGGGG + Exonic
1017842352 6:158232220-158232242 AGGCGGCGGCGGCGGCGATGCGG + Intronic
1019319376 7:408707-408729 CTGCAGCACCGGCAGCTGTGGGG + Intergenic
1019332081 7:465167-465189 CAGCAGCCCCGGCGGCCCTGGGG - Intergenic
1019726364 7:2605086-2605108 CTGCTGGGCGGGCGGGGATGTGG - Intronic
1020000461 7:4752798-4752820 CTGCAGCCCCTCCGGCCATGAGG + Intronic
1025638951 7:63349701-63349723 CGGCAGCGCTGGCTGCGGTGCGG - Intergenic
1025643748 7:63398391-63398413 CGGCAGCGCTGGCTGCGGTGCGG + Intergenic
1029073333 7:97917527-97917549 CTGCAGCCCCGGCTGAGCTGGGG - Intergenic
1035404459 7:158588370-158588392 CTGCAGCGCGGGCGGCGCCCAGG + Intergenic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1037336839 8:17800887-17800909 CGGCAGCGCCGGCGGAGCGGAGG - Intronic
1037769189 8:21789074-21789096 CTGCAGCGGCGGCGGCGACAAGG + Intronic
1039921461 8:41896788-41896810 CGGCGGCGGCGGCGGCGAAGCGG + Intergenic
1041233181 8:55773377-55773399 CTGCAGCCCGGGCCGCGATGGGG + Exonic
1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG + Intronic
1049460795 8:142726846-142726868 CTGCAGCGCCGCTGGCGATCGGG + Intergenic
1049796515 8:144499616-144499638 CTGCGGGGCAGGCGGGGATGTGG + Intronic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1052804598 9:33001610-33001632 CCGCAGCGCCGGAAGCGGTGAGG - Intronic
1054731299 9:68705125-68705147 CTGCAGGGCTTGCGGGGATGGGG + Intergenic
1054775731 9:69122011-69122033 CTGCCGCCCCGGGGGCGATGAGG - Intronic
1057466421 9:95317907-95317929 CAGCAGCGCCCGCGGAGAAGGGG + Intergenic
1060550963 9:124485299-124485321 CTGCAGGGCTGGGGGTGATGGGG - Intronic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1061144058 9:128787046-128787068 CCGCAGGGTCGGCGGCGCTGGGG + Intergenic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062507673 9:136886472-136886494 CGGCGGCGGCGGCGGCGTTGGGG + Intronic
1203361296 Un_KI270442v1:220754-220776 CTGCGATGGCGGCGGCGATGTGG - Intergenic
1185736636 X:2500890-2500912 CTGCGGCGCGGGCGGCCCTGCGG - Exonic
1187067465 X:15854726-15854748 CGGCGGCGGCGGCGGCGAAGGGG + Exonic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1192034376 X:67546550-67546572 CGGCGGCGGCGGCGGCGAGGCGG + Exonic
1192211158 X:69128871-69128893 GTGCAGCGCCGGAGGAGCTGCGG - Intergenic