ID: 947749881

View in Genome Browser
Species Human (GRCh38)
Location 2:232526436-232526458
Sequence GTCCTGCTGGACCATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947749881_947749889 14 Left 947749881 2:232526436-232526458 CCAACCTCATGGTCCAGCAGGAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 947749889 2:232526473-232526495 CTTCCTGAGTCCCCTGCCCAGGG 0: 1
1: 0
2: 2
3: 48
4: 424
947749881_947749888 13 Left 947749881 2:232526436-232526458 CCAACCTCATGGTCCAGCAGGAC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 947749888 2:232526472-232526494 CCTTCCTGAGTCCCCTGCCCAGG 0: 1
1: 0
2: 4
3: 54
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947749881 Original CRISPR GTCCTGCTGGACCATGAGGT TGG (reversed) Intronic
901252447 1:7790905-7790927 GTCATGCTGGTGCAAGAGGTGGG + Intronic
902220377 1:14960810-14960832 GGCCAGCTGGACCCTGAGCTCGG - Exonic
903770166 1:25758792-25758814 CTCCTGCTGATCCATGAGGGAGG - Intronic
904652272 1:32014309-32014331 GTCCTTCTCGGCCATGAGTTCGG - Exonic
905807470 1:40887262-40887284 TTACTGCTGGAGAATGAGGTGGG + Intergenic
906266146 1:44431723-44431745 GGCCTGCTGGTGCATGAGGAGGG - Intronic
908428189 1:64029547-64029569 TTCCTGCTGGACCTTGATCTTGG - Intronic
911686201 1:100780382-100780404 GTCATGCTGATGCATGAGGTGGG + Intergenic
913081787 1:115395147-115395169 GTCATGCTGATCCAAGAGGTGGG + Intergenic
915553128 1:156646619-156646641 GTCCTGGAGGACCTAGAGGTAGG + Intronic
915899042 1:159833376-159833398 GTCCTGCAGGTGCAGGAGGTAGG + Intronic
920033292 1:203049805-203049827 GTCCTGATGGACCGTGAGGAAGG + Intronic
920199461 1:204250612-204250634 GACCTGCAGGAACATGAGGCCGG + Exonic
923778234 1:236998772-236998794 GGACTGCAGGACCAGGAGGTGGG - Intergenic
1063109982 10:3027047-3027069 AAACTGCTGGACCATGTGGTTGG + Intergenic
1064616016 10:17157282-17157304 GTTCTACTGGAACATGAAGTAGG + Intronic
1067236874 10:44458650-44458672 GTCCTGGTGGAGGATGAGGTGGG + Intergenic
1070279443 10:75037998-75038020 GTCCTTGTGGATCATCAGGTAGG + Exonic
1072728413 10:97828856-97828878 TTCCTGCTGCACCAGGATGTGGG + Intergenic
1072801122 10:98393057-98393079 GTGCTGCTGCACCATGTGATGGG - Exonic
1074872641 10:117589025-117589047 GACTTGCTGGACCCTGAGTTGGG - Intergenic
1075556090 10:123433786-123433808 GTCCTACTGGACCCTGTGGATGG - Intergenic
1075672254 10:124270620-124270642 TCCCTGCTGCACCATGAGGCAGG + Intergenic
1076861440 10:133140034-133140056 TTCCCGCTGGACCCTGAGGCTGG + Intergenic
1077512002 11:2971318-2971340 GTGCTGCTGCATCATTAGGTTGG - Intronic
1080802359 11:35619639-35619661 GTCTTTCTGGACAATGAGGCGGG + Exonic
1081316487 11:41637235-41637257 GTCATGCTGATGCATGAGGTGGG + Intergenic
1081866691 11:46364119-46364141 TTCCTCCTGGAACATGAGGCTGG - Intronic
1083683607 11:64362581-64362603 GTCCTGCTGGGCGATGACGCTGG - Intronic
1084564976 11:69923579-69923601 ATCCTGCTGGAGCATGAGCCTGG - Intergenic
1084861454 11:72021245-72021267 TTTGTGCTGGACCATGAGGACGG - Exonic
1084898811 11:72294576-72294598 TTCCTGCTGGAGCCTAAGGTTGG - Intronic
1087282845 11:96231766-96231788 GTCCTTCTGTACGATGAGCTTGG - Intronic
1088816877 11:113427377-113427399 GTGCTGCAGGACCCTGAGGAGGG - Intronic
1089393201 11:118116019-118116041 GTCCTGATGGCCAATGAGGCCGG - Intronic
1089865157 11:121625250-121625272 ATCCTGCTGTACGATGAGCTGGG + Exonic
1090506450 11:127320532-127320554 GTCATGCTGGTGCAAGAGGTGGG + Intergenic
1091573797 12:1714011-1714033 GTCCTGTTGGATCATCTGGTTGG + Intronic
1095308249 12:40663032-40663054 GTCATGCTGAAGCAAGAGGTGGG - Intergenic
1095489489 12:42718239-42718261 GTACTGCTGGACCTGGAGGTGGG + Intergenic
1097693654 12:62756998-62757020 GTCCAGCTGGAAAATGAGGTTGG + Intronic
1098296322 12:69007763-69007785 GTCCTGCTGGACCTAGAGATTGG + Intergenic
1099830171 12:87832312-87832334 TGCCTTCTGGACCATGATGTAGG + Intergenic
1100427632 12:94501929-94501951 GTCATGCTGATCCAAGAGGTAGG + Intergenic
1100833765 12:98545373-98545395 GTGCTGCTGGGCTATGAGGGAGG + Intronic
1102317393 12:111900348-111900370 GCCCTGATGGCCCATGAGCTCGG + Intergenic
1102845983 12:116182825-116182847 GTCCTGCAGGAACTTCAGGTGGG - Intronic
1104399188 12:128461652-128461674 GACCTGGTGAACAATGAGGTGGG - Intronic
1108828858 13:54452353-54452375 GTCATGCTGAAGCAAGAGGTGGG + Intergenic
1109810790 13:67509770-67509792 GTCCTGCTGATGCAAGAGGTGGG - Intergenic
1112563314 13:100532526-100532548 GTCCCGCAGGACCCTGTGGTTGG + Exonic
1113808029 13:113121296-113121318 CTCCGGCAGCACCATGAGGTGGG - Intergenic
1113856401 13:113448696-113448718 ATCCTGCTGGGCCCTGAAGTTGG + Intronic
1114555108 14:23557362-23557384 CACCTGCTGGACCATGCAGTGGG + Intronic
1117522757 14:56567144-56567166 ATTCTGTTGAACCATGAGGTTGG - Intronic
1118640691 14:67789516-67789538 GTCCTCCTGGAGCATGGGGATGG + Exonic
1118736008 14:68702460-68702482 GTCCTGCTTGCTCTTGAGGTTGG + Intronic
1119031885 14:71199311-71199333 TGCCTTCTAGACCATGAGGTAGG + Intergenic
1121015154 14:90544556-90544578 GTTCTGCTGGCCTTTGAGGTTGG - Intronic
1121125803 14:91406047-91406069 GTCCTTCTGGACCCTGAGGGTGG + Intronic
1121558020 14:94852882-94852904 GTCCAGCTGGGCACTGAGGTGGG - Intergenic
1121604287 14:95229203-95229225 GCCCTCCTGGTGCATGAGGTTGG - Intronic
1123206204 14:106715601-106715623 GTCCTGCTGGACACTCATGTAGG - Intergenic
1123211287 14:106763011-106763033 GTCCTGCTGGACACTCATGTAGG - Intergenic
1124244150 15:28055806-28055828 GTCCTGCTGCACCGTGAGGATGG - Intronic
1127849656 15:62901647-62901669 GTTCCGCTGCAGCATGAGGTGGG + Intergenic
1128551974 15:68603755-68603777 ACCCTGCTGGACCTTGATGTTGG + Intronic
1129929375 15:79397434-79397456 GTGCTGCTGCTCCATGAGGAGGG - Intronic
1132864055 16:2085009-2085031 ATCCTGCTGCCCAATGAGGTAGG + Exonic
1133083880 16:3346398-3346420 GTCCAGCTGGACTCTGAGGTTGG + Intergenic
1133130906 16:3675694-3675716 GTCCTGCTGGACACTCAGGGAGG - Intronic
1133835782 16:9366190-9366212 GTGGTGCTGGCACATGAGGTGGG + Intergenic
1133874472 16:9720772-9720794 ATCCTGCTGGACCTTGATCTTGG + Intergenic
1136394843 16:29987234-29987256 GCGCTGCTGGCCCTTGAGGTGGG + Exonic
1136567772 16:31080331-31080353 GTCCTTCAGGGCCATGCGGTTGG - Exonic
1139392162 16:66611941-66611963 GTCCTGCTGAACCTGGGGGTGGG + Intronic
1141666734 16:85469674-85469696 GTCCTGCTGCTCCCTGAGGCTGG + Intergenic
1142524227 17:527467-527489 GAACTGCTGGATCATGGGGTAGG + Intronic
1144729787 17:17519715-17519737 GTGCTGCTGGACCAGCAGGGAGG + Intronic
1149366856 17:55953478-55953500 GTCATGCTGATCCAAGAGGTGGG - Intergenic
1150069191 17:62137897-62137919 GTCCTGATGGACGGGGAGGTGGG + Intergenic
1152491806 17:80639969-80639991 GCCCTTCTGTCCCATGAGGTGGG + Intronic
1153434971 18:5059283-5059305 GCCCTGCTGGACCTTGATTTTGG + Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1158390441 18:57040618-57040640 GCCATTCTGGCCCATGAGGTGGG + Intergenic
1160318396 18:77868582-77868604 GTTGTCCTGGACCATCAGGTGGG + Intergenic
1163105853 19:15122743-15122765 CTCCTTCTGGACCATGAAGTAGG + Exonic
1163207604 19:15815016-15815038 CTCCTGCTGCCTCATGAGGTAGG - Intergenic
1165424717 19:35739533-35739555 GTACTGCTGGACCCTGAGCCTGG - Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1168113781 19:54209531-54209553 GTGCTTCTGGCCCAAGAGGTCGG + Intronic
925406151 2:3606489-3606511 GGCCTCCTGGTCCGTGAGGTTGG + Intronic
932304475 2:70692117-70692139 GTCCTGTTGGACCAAGGCGTGGG - Intronic
932467410 2:71932673-71932695 GACTTGCTGGACCCTGAGGAGGG - Intergenic
934040158 2:88121746-88121768 TACGTGCTGGACAATGAGGTAGG + Intergenic
934157864 2:89219912-89219934 ACCCTGCTGGACCTTGATGTTGG - Intergenic
934209398 2:89962510-89962532 ACCCTGCTGGACCTTGATGTTGG + Intergenic
938341344 2:130538612-130538634 GGACTGCTGGGCCCTGAGGTGGG - Intergenic
938348487 2:130582097-130582119 GGACTGCTGGGCCCTGAGGTGGG + Intronic
938590058 2:132727760-132727782 GTCCTGCTGGACCATGTTCAGGG - Intronic
941525033 2:166596845-166596867 GTCATGCTGATGCATGAGGTAGG + Intergenic
941570209 2:167161090-167161112 GTCATGCTGGAGCAAGAGGTGGG + Intronic
943847607 2:192672435-192672457 GTCCTGCTGGAGGCTGAGGATGG - Intergenic
946734958 2:222744797-222744819 GTCATGCAGGACTATGGGGTAGG + Intergenic
947453052 2:230225837-230225859 GCCCTGCTGGGCCATGAGCTTGG - Exonic
947749881 2:232526436-232526458 GTCCTGCTGGACCATGAGGTTGG - Intronic
1169527023 20:6440183-6440205 GTCTTGCTGGACCGTGGGGAAGG + Intergenic
1170368010 20:15618441-15618463 GTCCTTCTTAACCATGAGGCTGG - Intronic
1170627857 20:18043124-18043146 GTCACCTTGGACCATGAGGTGGG + Intronic
1172766061 20:37351500-37351522 GACCTGCTGGGCTATGAGGCTGG + Intronic
1172950140 20:38718067-38718089 ATCCTGCTGGACCATGATCTGGG - Intergenic
1173991743 20:47309015-47309037 ATCCCCCTGGACTATGAGGTCGG - Intronic
1175183404 20:57164275-57164297 GCCATCTTGGACCATGAGGTAGG + Intergenic
1175481698 20:59315811-59315833 GCCATGCTGGAATATGAGGTTGG + Intronic
1175628043 20:60505570-60505592 CTCCTGCTACACCATGAAGTGGG - Intergenic
1176023172 20:62972946-62972968 GGCGTGCTGGACCATGGGGAGGG - Intergenic
1176984248 21:15418169-15418191 ATCTTGCTGCACCATGAGGAAGG + Intergenic
1178173560 21:30071410-30071432 GTACTGTTGAAGCATGAGGTAGG + Intergenic
1178738662 21:35176229-35176251 TTCCTGCTGAACAAAGAGGTGGG - Intronic
1179681980 21:43028898-43028920 GACATGGTGGACCATGGGGTGGG + Intronic
1180393155 22:12303479-12303501 GTCATGCTGAAGCAAGAGGTGGG - Intergenic
1180406594 22:12561289-12561311 GTCATGCTGAAGCAAGAGGTGGG + Intergenic
1180575980 22:16774916-16774938 GTGCAGCAGTACCATGAGGTAGG - Intergenic
1180854440 22:19037210-19037232 GGCCTGCTGGAGCATGATGCTGG - Exonic
1183591858 22:38783638-38783660 GTCCTGCTGGCCCAGCAGCTGGG + Intronic
1184255609 22:43285204-43285226 GGGCTGGTGGACCATGTGGTTGG - Intronic
1185345402 22:50308434-50308456 GTCCTTCAGGGCCAGGAGGTGGG + Intergenic
949334794 3:2962630-2962652 GTCCTGCTGTTCCAGGAGGAAGG + Intronic
953229752 3:41054292-41054314 GTCCTGCTGCCCCATGAAGAAGG - Intergenic
954023656 3:47764566-47764588 GGCATGCTGGACCAGGTGGTGGG - Intronic
954440603 3:50519811-50519833 ATCCTGCTGGACCAGGGGGCTGG - Intergenic
954898776 3:54000900-54000922 GTCCTGCAGGAGAGTGAGGTTGG + Intergenic
958841155 3:99207170-99207192 GCCCTGTTGAACCAGGAGGTTGG + Intergenic
964697305 3:159524169-159524191 GTCCAGCTGCCACATGAGGTGGG + Intronic
966886268 3:184379728-184379750 GGGCGGCTGGACCAGGAGGTCGG - Intronic
968314678 3:197713656-197713678 AACCTGCTGAACCCTGAGGTGGG + Intronic
968405396 4:336446-336468 GCCCTGCAGCGCCATGAGGTCGG + Intergenic
970321180 4:14877132-14877154 GTCCCCCTGGTCCATGAGGGAGG + Intergenic
970559481 4:17268781-17268803 TTTCTACTGGACCATGTGGTTGG + Intergenic
974171419 4:58271101-58271123 GTCATGCTGAGCCAAGAGGTGGG - Intergenic
975257615 4:72256036-72256058 GTCATGCTGAAACAAGAGGTGGG - Intergenic
975784936 4:77877643-77877665 GTGCAGCTGGACCTTGGGGTTGG + Intronic
982137408 4:152284829-152284851 CTCCTGCTTGACCGTGAGCTGGG - Intergenic
983564909 4:169139665-169139687 GAACTGCTGGACCATAGGGTTGG + Intronic
983940064 4:173528822-173528844 GGCCAGCAGGTCCATGAGGTAGG + Exonic
984011617 4:174378513-174378535 GTCCTGCAGCAATATGAGGTAGG - Intergenic
984073082 4:175140660-175140682 GTCCTGCTGGACCATTTGTGAGG - Intergenic
985535391 5:462290-462312 GTCTTCCTGGACCTGGAGGTGGG + Exonic
985535855 5:465404-465426 GTCCTGCCTGACCTTGTGGTTGG + Intronic
986674193 5:10168997-10169019 GCCATGCTGGAGCATGAGGGGGG - Intergenic
988099200 5:26656564-26656586 GTCATGCTGAAGCAAGAGGTGGG + Intergenic
992774212 5:80075887-80075909 GTCCCCCTGTACCATGTGGTAGG + Intronic
992831341 5:80596384-80596406 GTGCTGCTGGACAATAGGGTCGG + Intergenic
993943746 5:94094229-94094251 ACCCTGCTGGACCTTGATGTAGG - Intronic
996897709 5:128504483-128504505 GTCATGCTGAAGCAAGAGGTGGG - Intronic
999051758 5:148530846-148530868 GTCATGCTGGTGCAAGAGGTAGG - Intronic
999509347 5:152232036-152232058 TTCCTGCTGAGTCATGAGGTAGG + Intergenic
1002685444 5:181005696-181005718 GTCTTCCTGGACTATGAGGGTGG + Exonic
1003012036 6:2435385-2435407 GTCCCCCGGGACCGTGAGGTGGG - Intergenic
1003338169 6:5194537-5194559 CTCCTACTAGCCCATGAGGTAGG - Intronic
1003909056 6:10727021-10727043 GTCATTCTGGAGCATGAGGGAGG - Intronic
1003912082 6:10752123-10752145 GTCATTCTGGAGCATGAGGGAGG - Intronic
1004870792 6:19901843-19901865 GGCCTCCTGGGCCATCAGGTTGG + Intergenic
1005816508 6:29556983-29557005 GTCATGATGGAACAGGAGGTTGG + Intronic
1007152518 6:39708160-39708182 GTCCTGCTGGGCAATGACCTTGG + Intronic
1007771284 6:44194424-44194446 GTCCTTCTGGGCCATGATGCAGG + Intergenic
1012227629 6:96723127-96723149 GTCATGCTGGACCATGGGGAGGG + Intergenic
1013471793 6:110472737-110472759 GTCCTGGTGGACCCCTAGGTTGG - Intronic
1013927672 6:115493037-115493059 GTCATGCTGATCCAAGAGGTAGG + Intergenic
1016529308 6:145040226-145040248 GCCCTGCTGGACCTTGATTTTGG - Intergenic
1019369462 7:653379-653401 TTCCTTCTGAACGATGAGGTGGG - Intronic
1019833137 7:3353883-3353905 GTCCTCCTCATCCATGAGGTTGG + Intronic
1020687826 7:11317498-11317520 GTGCTGCTGAACAATGATGTTGG + Intergenic
1022327579 7:29345887-29345909 TTACTGCTGGACCCTGAGGCTGG - Intronic
1024943887 7:54789907-54789929 CTCCTGCTGTAGCATGTGGTAGG - Intergenic
1026096703 7:67352164-67352186 GTCATGCTGGTGCAAGAGGTGGG + Intergenic
1029571328 7:101371537-101371559 GTCCTGGTGGAAGCTGAGGTAGG + Intronic
1030841542 7:114359612-114359634 GTCATGCTGATCCAAGAGGTGGG - Intronic
1032093192 7:128922295-128922317 GTCCTACTGGACTGTGAGGGGGG - Intergenic
1032804239 7:135339473-135339495 CTCCCCCTGCACCATGAGGTTGG - Intergenic
1033166634 7:139044078-139044100 GTCCTGCTGGACATTTAGGTAGG + Exonic
1033706049 7:143885515-143885537 GTCCTGCTGCACTCTGAGGGCGG - Intronic
1034089633 7:148351918-148351940 GCCTTCTTGGACCATGAGGTAGG - Intronic
1034966286 7:155393219-155393241 GTCCTGCTGGTCCCTGGGGCAGG - Intronic
1035059226 7:156056778-156056800 GTCCTGGTGGATGAGGAGGTCGG - Intergenic
1037979047 8:23237670-23237692 GTCATGCTGGTGCAAGAGGTGGG + Intergenic
1038740858 8:30215462-30215484 TTCATGCTGGACCAAGAGCTAGG + Intergenic
1041187316 8:55314431-55314453 CTCCTGCTGTTCCTTGAGGTCGG - Intronic
1042023342 8:64395442-64395464 GTCTGTCTGTACCATGAGGTTGG + Intergenic
1042359870 8:67870242-67870264 GTTCTGCTGCCCCATGAGTTTGG + Intergenic
1048389464 8:133947851-133947873 CTCCTACTGGCTCATGAGGTGGG - Intergenic
1048665630 8:136657803-136657825 GCCCTGATGGACAATGAGATGGG + Intergenic
1049745310 8:144260755-144260777 GTCTTCCTGGACCAGGTGGTGGG + Exonic
1050249645 9:3731281-3731303 GTCCTTCTGGATGAGGAGGTTGG - Intergenic
1051748819 9:20320476-20320498 GTCCTGCTGGACCACTAGCTTGG - Intergenic
1052375341 9:27712620-27712642 GTCTTTCTGCACCATGAGATAGG - Intergenic
1053793498 9:41703900-41703922 GTCATGCTGATCCAAGAGGTGGG - Intergenic
1054181908 9:61915915-61915937 GTCATGCTGATCCAAGAGGTGGG - Intergenic
1055713272 9:79088682-79088704 GTCCTGCTGATGCAAGAGGTAGG + Intergenic
1055775430 9:79762509-79762531 CACATCCTGGACCATGAGGTTGG + Intergenic
1056042779 9:82685488-82685510 GTCATGCTGAAGCAAGAGGTGGG + Intergenic
1059331390 9:113537814-113537836 GGCCTGCTGAAGCAGGAGGTAGG + Intronic
1060510517 9:124228859-124228881 GCTCTGCTGGCCCCTGAGGTGGG + Intergenic
1061178034 9:129009101-129009123 GCCCTGCTGGCTGATGAGGTGGG - Exonic
1062397737 9:136359194-136359216 GACCTGCTGGAGCCTGAGATGGG + Exonic
1185650211 X:1642144-1642166 GTCCTCATGGACCATCAGGATGG - Intronic
1188646193 X:32570095-32570117 GTCCTGCTTGCCATTGAGGTGGG - Intronic
1190154459 X:47977073-47977095 TTTCTGATGGACAATGAGGTTGG + Exonic
1190266971 X:48832339-48832361 CTCCTGCGGGAAAATGAGGTGGG + Exonic
1191170921 X:57446176-57446198 GTGCTGATGGACAATGAGGGAGG + Intronic
1193601009 X:83508542-83508564 GTCCTGCTGGTCCAGGGGGCTGG - Exonic
1196566011 X:117206259-117206281 GTCATGCTGAAGCAAGAGGTGGG + Intergenic
1201592410 Y:15629377-15629399 GTCCTGCTGATGCAAGAGGTAGG - Intergenic