ID: 947749978

View in Genome Browser
Species Human (GRCh38)
Location 2:232526836-232526858
Sequence CCCCTCCAGTGTCAGCTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947749972_947749978 27 Left 947749972 2:232526786-232526808 CCTGGGAAACGTGCTGCGGCTGC 0: 1
1: 0
2: 1
3: 15
4: 110
Right 947749978 2:232526836-232526858 CCCCTCCAGTGTCAGCTCTGCGG 0: 1
1: 0
2: 3
3: 35
4: 279
947749974_947749978 -2 Left 947749974 2:232526815-232526837 CCCTGAGAGGCTGCTGTCCTGCC 0: 1
1: 0
2: 3
3: 25
4: 272
Right 947749978 2:232526836-232526858 CCCCTCCAGTGTCAGCTCTGCGG 0: 1
1: 0
2: 3
3: 35
4: 279
947749975_947749978 -3 Left 947749975 2:232526816-232526838 CCTGAGAGGCTGCTGTCCTGCCC 0: 1
1: 0
2: 5
3: 45
4: 346
Right 947749978 2:232526836-232526858 CCCCTCCAGTGTCAGCTCTGCGG 0: 1
1: 0
2: 3
3: 35
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947749978 Original CRISPR CCCCTCCAGTGTCAGCTCTG CGG Intronic
900321838 1:2088338-2088360 CCCCTGCAGTCTCAGCTCGGAGG + Intronic
900568129 1:3345427-3345449 CACCTCCACTGTGAGTTCTGTGG + Intronic
900690721 1:3978769-3978791 CCCACCCAGCTTCAGCTCTGTGG + Intergenic
901081842 1:6588154-6588176 CCCTTCCAGTGCCACCTCTGTGG + Exonic
901238185 1:7678692-7678714 CCCATGGAGTGTCACCTCTGTGG - Intronic
901432456 1:9225346-9225368 CCACTGCAGTGTCAGGGCTGGGG + Intergenic
901504719 1:9677202-9677224 CCCGTCAAGTGTCAGCTATGTGG - Intronic
902814964 1:18911101-18911123 TCACTCGAATGTCAGCTCTGTGG + Intronic
903180481 1:21602671-21602693 CCCCACTAGTGACAGCTGTGTGG - Intronic
903449422 1:23442711-23442733 GCCCTCCTGTGCCAGCTGTGTGG + Intronic
904181197 1:28667933-28667955 CGCCTCTAGTGCCAGCTCTTCGG + Intergenic
904748351 1:32725229-32725251 CCCCACCATTGCCAGCTGTGTGG - Intergenic
905093106 1:35445687-35445709 CCCTACTAGTGTTAGCTCTGTGG - Intronic
905224846 1:36472348-36472370 GCCCTTCAGTATGAGCTCTGCGG - Exonic
907310575 1:53536792-53536814 CCTTCCCAGCGTCAGCTCTGGGG - Intronic
910709389 1:90163717-90163739 CCCCTCCAGTGGCCTCTCTAGGG + Intergenic
914326513 1:146622489-146622511 CCCCTCCAACTTCAGCTTTGGGG + Intergenic
915224699 1:154404046-154404068 TCCCTCCAGATTCAGCTATGAGG + Intergenic
915274911 1:154781830-154781852 CCCCTGAAATGTAAGCTCTGTGG - Intronic
915879994 1:159659452-159659474 CCCCTTCAGTGTGAGTTCGGGGG + Intergenic
916674455 1:167054187-167054209 CTTCCCCAGTGTCAGCTGTGGGG - Exonic
918236524 1:182585773-182585795 GCCCCCCAGTGTGAGCTCTGAGG + Exonic
918703582 1:187635504-187635526 TCCATCAAGGGTCAGCTCTGGGG - Intergenic
920059344 1:203216856-203216878 CCCCTCCAGTCCCAGCTTTGAGG - Exonic
921280923 1:213567452-213567474 CAGCTGCAGTATCAGCTCTGGGG + Intergenic
921412216 1:214847904-214847926 TCCCTCCAGAGTCAGACCTGAGG - Intergenic
923024440 1:230193867-230193889 CCCCGCCAGCATCAGCTCTGTGG - Intronic
923723237 1:236484818-236484840 ACCCTCCAGTGTCATCTCCGGGG + Intronic
1063691370 10:8290614-8290636 CCTCTCCATTGTCAGCTCCCAGG - Intergenic
1064618635 10:17191603-17191625 GCCCTCCCCTGACAGCTCTGAGG - Intronic
1064974598 10:21100385-21100407 CTGCTCCATTGTCAGCTGTGCGG + Intronic
1065399338 10:25279346-25279368 CCGCTGCAGTGTCACTTCTGTGG - Intronic
1067293067 10:44958617-44958639 CCCATCCTTTGACAGCTCTGAGG - Intergenic
1067338593 10:45383146-45383168 CACCCCAAGTGCCAGCTCTGAGG + Intronic
1069503120 10:68972215-68972237 CTACTCAAGTGTCAGTTCTGAGG - Intronic
1070835724 10:79445754-79445776 CCCCTCCAGCGGCGGCTCCGGGG + Intergenic
1070870660 10:79748692-79748714 CCCCTTCAGTGCCAGCTGTATGG - Intergenic
1070914661 10:80145113-80145135 CCCCTCCAGGCTCAGACCTGGGG + Exonic
1072348940 10:94538992-94539014 CCACTACAGTGTAAACTCTGAGG + Intronic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1074576380 10:114673608-114673630 CCGCTTCAGTGTCAGCTCCTTGG + Intronic
1074597069 10:114877222-114877244 GCCCTCCAGTGACAGCACTCGGG - Intronic
1075416491 10:122268235-122268257 CCCCTCTAGTGGCCACTCTGGGG - Intergenic
1076569124 10:131420809-131420831 CCCCTCCAAACTCAGTTCTGTGG + Intergenic
1076798633 10:132810697-132810719 CTCCTCCAGGGACAGCTGTGAGG + Intronic
1076853421 10:133103952-133103974 CCCCGCCAGAGGCTGCTCTGTGG + Intronic
1077344364 11:2039519-2039541 CACCTCCTGTGGCAGCTCAGGGG + Intergenic
1077420383 11:2447255-2447277 CCCCTGCCTTGCCAGCTCTGCGG - Intronic
1079083335 11:17428782-17428804 CCCCTTCAGTGTGGGCTTTGTGG - Intronic
1082794222 11:57368392-57368414 CCCCACCATCATCAGCTCTGTGG + Exonic
1083184070 11:61007523-61007545 CCCCACCGGTCTCAGCTCTCTGG + Intronic
1083619315 11:64041096-64041118 ACTCTCCAGAGGCAGCTCTGTGG + Intronic
1083624024 11:64062809-64062831 CCCCTGCTGTGTGAGCTGTGTGG - Intronic
1085473313 11:76771936-76771958 ACCCTCCAGTCTCAGCCCTGAGG + Intergenic
1086250357 11:84805151-84805173 AGCCTCCATTGTTAGCTCTGTGG - Intronic
1088576575 11:111277875-111277897 CCCTCCCATTTTCAGCTCTGTGG - Intronic
1088595113 11:111435443-111435465 GTCCTCAAGTGTCATCTCTGGGG - Intronic
1089139951 11:116276862-116276884 CGCCTTCAGGGTCTGCTCTGCGG - Intergenic
1089329619 11:117680421-117680443 CCCCTACACTTTCTGCTCTGTGG - Intronic
1089631390 11:119786747-119786769 CCCCTCCCTTGTCAGCTGTGTGG + Intergenic
1090252849 11:125263492-125263514 CCTCTCCGGGGTCAGCACTGTGG + Intronic
1090613130 11:128489548-128489570 CTCCTTCAGTGTCCTCTCTGAGG - Intronic
1090802536 11:130181875-130181897 TCCCTGCAGTGTGAGTTCTGTGG - Intronic
1202827350 11_KI270721v1_random:94708-94730 CACCTCCTGTGGCAGCTCAGGGG + Intergenic
1093387490 12:18576276-18576298 CCTCTTCACTGCCAGCTCTGGGG + Intronic
1094628217 12:32146652-32146674 CCCTTCCTCTGTCTGCTCTGAGG - Intronic
1095455791 12:42384547-42384569 GCCTTCCAGTGTCAGCTTTATGG + Intronic
1095981439 12:47976886-47976908 CCTCTCCTTTGTCACCTCTGGGG + Exonic
1097080221 12:56424848-56424870 CTCCTCCACTGGCACCTCTGAGG + Exonic
1097194954 12:57238137-57238159 CCCCTCCAGAGCCCGCCCTGTGG + Intronic
1097298442 12:57992271-57992293 CCTCTGCAGTGCCTGCTCTGGGG + Intergenic
1101013098 12:100471531-100471553 CACCTCCACTGTCATCTCTCTGG - Intergenic
1101448503 12:104755523-104755545 CCCCTGCAGTCTCAGCACTTTGG + Intronic
1101508925 12:105375297-105375319 CCCCTCCAGTGCCTGGTTTGTGG + Intronic
1101610849 12:106290229-106290251 CCCCTCAAGACTCAGCTTTGGGG + Intronic
1102486354 12:113260399-113260421 GGCCCCCAGTCTCAGCTCTGGGG + Exonic
1102674320 12:114646310-114646332 CCCCTCCAGTGTCATCTCTTAGG + Intergenic
1102748756 12:115273527-115273549 CCCCTCCAGCCTCAGCTCTGGGG - Intergenic
1104164460 12:126214526-126214548 CAAATCCACTGTCAGCTCTGTGG - Intergenic
1104418949 12:128619440-128619462 CGCCTGCAGGGTCTGCTCTGGGG - Intronic
1104921740 12:132294199-132294221 CTGCTCCAGGGACAGCTCTGGGG - Intronic
1108260318 13:48649189-48649211 CCCAAGCAGTGTCAGCTCTCTGG - Intergenic
1110812885 13:79829932-79829954 CCCTTCAAATGTCAGCTTTGTGG + Intergenic
1111979690 13:95003104-95003126 CCCCGCCAGGCCCAGCTCTGTGG + Intergenic
1112614327 13:100987862-100987884 ACCCTCAAGTATCAGCTCTTTGG + Intergenic
1113414098 13:110114405-110114427 ACCCTCCAGTGACAGATGTGGGG - Intergenic
1114204101 14:20551867-20551889 CCCACCCTGTGGCAGCTCTGAGG + Intergenic
1114243510 14:20891465-20891487 CCCCTCCTGTCCCAGCTCTGGGG - Intronic
1114246495 14:20919418-20919440 CCCCTCCTGTCCCAACTCTGGGG - Intergenic
1114250449 14:20955550-20955572 CCCCTTCTGTCCCAGCTCTGGGG - Intronic
1116660978 14:47709907-47709929 CCCCTCCAGGGTCATCTTTGTGG - Intergenic
1117574298 14:57082709-57082731 CCCCACCAGCAGCAGCTCTGAGG + Intergenic
1118375216 14:65170976-65170998 CCCTTCCAGTGGCATTTCTGCGG + Intergenic
1118406494 14:65429339-65429361 CTCCTCCAGTGTCTGCTCTGTGG - Intronic
1119034023 14:71215046-71215068 CCCCACGAGTGACAGCTCTAGGG + Intergenic
1119323426 14:73744866-73744888 CAGCTCCTGTCTCAGCTCTGGGG - Intronic
1119888471 14:78164323-78164345 CCCCAGCAGTGGCAGCTTTGTGG - Intergenic
1120311228 14:82830835-82830857 CCCCTCCAGTCTCCAGTCTGAGG - Intergenic
1120623710 14:86798000-86798022 ATTCTCCAGTCTCAGCTCTGAGG - Intergenic
1121695828 14:95911151-95911173 CCCCTCCAGCCTCAGCTCTTAGG + Intergenic
1122828902 14:104386000-104386022 CCCTTCCAGTGCCATCACTGGGG - Intergenic
1122864699 14:104598244-104598266 TCCCTCCAGTGGGAGCCCTGAGG + Intronic
1122876155 14:104666309-104666331 CAGCTCCAGTGTCACCTCGGCGG - Intergenic
1122987630 14:105219872-105219894 CTTCTCCAGTGTCGGCTCGGGGG - Intronic
1124354469 15:28984700-28984722 TCCCTCCACTGCCATCTCTGGGG + Intronic
1124569407 15:30848379-30848401 TCCCTGCTGTGTGAGCTCTGGGG - Intergenic
1128222517 15:65979279-65979301 CCACCCCCTTGTCAGCTCTGGGG + Intronic
1128313556 15:66646382-66646404 GCCCTCCAGAGTCAGCAATGAGG - Intronic
1128358237 15:66943324-66943346 CCCCAGCAGGGCCAGCTCTGGGG + Intergenic
1128816109 15:70609679-70609701 CTCCTCCAGTTTCATCTCTTTGG + Intergenic
1129127565 15:73457259-73457281 CCTGTCCTGTGTGAGCTCTGGGG + Intronic
1129150267 15:73684167-73684189 CCCCGCCAGGGTCAGGCCTGGGG + Intronic
1129617888 15:77114391-77114413 ATCCTCCAGTGTCTGCTCTGGGG - Exonic
1130771573 15:86929446-86929468 CCCCTCCAATATCAACTCAGAGG + Intronic
1130987180 15:88852142-88852164 CCCAGCCAGTGTCAGGGCTGGGG - Intronic
1131209549 15:90482068-90482090 CTCAGCCATTGTCAGCTCTGTGG + Exonic
1132497441 16:270589-270611 CCCCTCCAGGGTCTGCTCCATGG + Exonic
1132605143 16:790516-790538 CCTCTCCAGTCTCAGGTCGGGGG + Exonic
1132779244 16:1614042-1614064 CTCCTCCAGGGCCAGCTCTGGGG + Intronic
1133133236 16:3691211-3691233 CCCCTCCAGTTTCGCTTCTGCGG - Intronic
1137422735 16:48349919-48349941 CACATCCAGTGTCAGTGCTGAGG - Intronic
1138660045 16:58511468-58511490 CCTCACCAGTGCCAGCTCGGTGG + Exonic
1139554407 16:67697730-67697752 TCCTTCCACTGTCTGCTCTGGGG + Intronic
1140007051 16:71088456-71088478 CCCCTCCAACTTCAGCTTTGGGG - Exonic
1142247955 16:88978409-88978431 CCCCTCCAGCCTCAGTCCTGGGG - Intergenic
1143334917 17:6165058-6165080 GACTTCCAGTCTCAGCTCTGAGG + Intergenic
1144950228 17:18989950-18989972 CACCTCCGCTGTCCGCTCTGGGG - Intronic
1145961077 17:28886852-28886874 CCCCCACAGTGCCAGCCCTGGGG + Intronic
1146547211 17:33749612-33749634 CCCACCAAGTGACAGCTCTGAGG - Intronic
1147140606 17:38458676-38458698 CCTCTCCAGCGTGAGCTCTCAGG + Intronic
1148008488 17:44454681-44454703 CCCCTGCAGTCCCAGCACTGTGG - Intronic
1148455182 17:47807652-47807674 TCCCTCCCGTCTCAGCTCAGCGG - Exonic
1148618020 17:49014537-49014559 CCCCTCAAGTGCCCTCTCTGTGG - Intronic
1151772317 17:76172096-76172118 CCACCCCAGGGTCAACTCTGGGG - Intronic
1151917566 17:77129668-77129690 CTCCTCCACCTTCAGCTCTGCGG - Intronic
1152069299 17:78127095-78127117 CCCCTCCAGTGTCAGGGGAGGGG + Intronic
1152458719 17:80430484-80430506 CCCCTCCCGTGTCAGGGCAGAGG - Intronic
1152580208 17:81162469-81162491 CCCGGGCAGTGTCAGCTGTGGGG + Intronic
1155621655 18:27786556-27786578 CTTCTCCAGTCTAAGCTCTGTGG + Intergenic
1157426346 18:47587639-47587661 TTCCTCCAGTGTCAACTCTATGG - Intergenic
1158480355 18:57816545-57816567 CTCCTCCAGGGCCAGCACTGGGG - Intergenic
1159871847 18:73767370-73767392 CCCCTCCTTTGTGGGCTCTGAGG - Intergenic
1160747331 19:718369-718391 GCCCTGCAGTGGGAGCTCTGTGG + Intronic
1160837354 19:1131206-1131228 ACCCTCCAGCCTCAGCTCAGCGG + Intronic
1161857272 19:6773060-6773082 CCCCTCGACTGTCAGCCCCGGGG - Intronic
1162657947 19:12146049-12146071 TGTGTCCAGTGTCAGCTCTGTGG + Exonic
1163637317 19:18443327-18443349 GCCCTCCACAGTCAGCTCTTTGG + Exonic
1164532145 19:29056857-29056879 CCCCAACACTGTGAGCTCTGAGG + Intergenic
1164869651 19:31632164-31632186 CCCCTCCCCTCCCAGCTCTGAGG - Intergenic
1165368520 19:35386281-35386303 CACCTGCAATGTCAGCTCTTTGG - Intergenic
1166299695 19:41906733-41906755 CCCCTCCTGTCTCAGCTTGGGGG + Exonic
1166650066 19:44566672-44566694 CCCCTCCAGTGACGGCACAGGGG + Intergenic
1167263218 19:48470356-48470378 CTCCTCCGGAGTCAGGTCTGGGG - Exonic
1167745260 19:51347026-51347048 CCCCTCCAGCGTCACCTGGGAGG + Exonic
1167997652 19:53419335-53419357 ACCCTCAAGTGGCAGTTCTGGGG + Intronic
1168291756 19:55360640-55360662 CCCCTCCTCCCTCAGCTCTGGGG + Intronic
1168487284 19:56774773-56774795 CCTTACCAGTGTCAGCTATGTGG - Exonic
925578449 2:5384935-5384957 AGTCTCCAGTGTAAGCTCTGTGG - Intergenic
929773060 2:44909006-44909028 CCCGGCCAGTGTCAGCTTTATGG - Intergenic
930336451 2:50053503-50053525 CCCTTCCAGGGCCAGCTCTCTGG - Exonic
931906556 2:66849399-66849421 GCCCCGCAGTGCCAGCTCTGGGG + Intergenic
932055258 2:68436992-68437014 TCCCTCCAATGTCTGCTGTGGGG - Intergenic
933199646 2:79434573-79434595 CCCCTCCAGCCTCAGCCCTGTGG - Intronic
934847513 2:97671777-97671799 CCTCGCCAGTTTCTGCTCTGAGG + Intergenic
937438270 2:121896828-121896850 TCCCAAAAGTGTCAGCTCTGAGG - Intergenic
938265065 2:129922762-129922784 CCCCTCCAGGCTCAGACCTGGGG - Intergenic
938302817 2:130228628-130228650 CCCCTTCAGCGCCAGGTCTGGGG + Intergenic
938453852 2:131445594-131445616 CCCCTTCAGCGCCAGGTCTGGGG - Intergenic
939861980 2:147431783-147431805 TCCCACCTGTGCCAGCTCTGTGG - Intergenic
942753404 2:179313343-179313365 CACCTCCATTGTCACCTCTTTGG - Intergenic
944428449 2:199608106-199608128 CCTCTCCAGTTTCATCTCTTGGG - Intergenic
944968285 2:204961309-204961331 CACCTCCAGTGTCACCACTTTGG - Intronic
945222052 2:207494032-207494054 GCTCACCAGTGACAGCTCTGGGG + Intergenic
946187578 2:217989720-217989742 CCTCTCCTGTGGCAGCTCAGAGG - Intronic
946267913 2:218564509-218564531 CCTTTCCAGTCTCAGCTCTTGGG + Intronic
947749978 2:232526836-232526858 CCCCTCCAGTGTCAGCTCTGCGG + Intronic
947837661 2:233187418-233187440 CACCTCGAGTGTCACCTCTGAGG - Intronic
948082043 2:235214441-235214463 CCCTTCCTGTCTCATCTCTGAGG + Intergenic
948248738 2:236507801-236507823 TTCATCCACTGTCAGCTCTGCGG + Intergenic
1168782594 20:506352-506374 GCCCTCCAGGGCAAGCTCTGGGG + Intronic
1169199081 20:3698977-3698999 ACCCTCCAATGCCAGCCCTGTGG - Intronic
1170860476 20:20098482-20098504 CGCCTGCAGTCCCAGCTCTGCGG + Intronic
1171251659 20:23653550-23653572 CCCCTCCAGTGTCAGATCAAGGG + Intergenic
1171311708 20:24150194-24150216 CCACGCCAGTGTCTGCTCTCGGG - Intergenic
1172250299 20:33474793-33474815 CCCCTCCAGAGCCAGCTCCTGGG + Intergenic
1172925736 20:38533168-38533190 CCACTACACTGTGAGCTCTGAGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175930699 20:62492531-62492553 CCCCTCAAATGTCAGCCCTGAGG - Intergenic
1176012008 20:62902679-62902701 CCCCACCAGGGCCATCTCTGTGG + Intronic
1176128119 20:63485049-63485071 CCAGCCCACTGTCAGCTCTGGGG - Intergenic
1176307719 21:5132917-5132939 CCCCTGCAGAGTGAGCACTGCGG + Intronic
1179117495 21:38507449-38507471 CCCTCCCAGTGTCAGCACTGGGG - Intronic
1179849341 21:44129113-44129135 CCCCTGCAGAGTGAGCACTGCGG - Intronic
1179967634 21:44816724-44816746 TCCCTCCAGTCTCAGTCCTGGGG - Intronic
1181089570 22:20463432-20463454 CCCCCCTAGGGACAGCTCTGTGG + Intronic
1181634239 22:24167012-24167034 CTCCTCCAGGGACAGCTCAGTGG - Exonic
1182065891 22:27431399-27431421 TCCCTCCAGGGAAAGCTCTGTGG - Intergenic
1182516513 22:30862074-30862096 CCCCTCCTGTGTCTGGTCAGAGG + Intronic
1183234360 22:36606197-36606219 CCTCTCAAGACTCAGCTCTGGGG - Intronic
1183366753 22:37410956-37410978 CCCTTCTAGAGTCACCTCTGAGG - Intronic
1184110555 22:42391451-42391473 TCCCACCAGTGTTAGCGCTGGGG + Intronic
1184470216 22:44691930-44691952 CACCTCCACAGTCGGCTCTGTGG + Intronic
1184477649 22:44730093-44730115 CCCCGCCAGGGGCAGCCCTGGGG - Intronic
1185300537 22:50077625-50077647 CCCATCCAGGGCCAGCTGTGAGG + Intronic
950066586 3:10116463-10116485 CCCGACCTGTGTTAGCTCTGAGG - Intronic
950109060 3:10407017-10407039 TCCTTCCAGGGTCAGGTCTGGGG - Intronic
950525172 3:13519026-13519048 CCCCTCCAGGGTCAGCCTCGGGG - Intergenic
951011326 3:17683693-17683715 CCCCACCACTTTCAGCTGTGTGG + Intronic
951778454 3:26336409-26336431 CCCATCAAGTGAGAGCTCTGTGG - Intergenic
952263799 3:31766196-31766218 CATCTCCAGTGTCAGCTGAGTGG - Intronic
952729883 3:36627556-36627578 CCCCTCCAGTCTCAGCTGGGAGG - Intergenic
953473410 3:43185390-43185412 CCCAGCCAGTGTCATCCCTGAGG + Intergenic
953789447 3:45936368-45936390 CCTCTCCAGTGCCGGCGCTGGGG - Intronic
955346743 3:58167241-58167263 CCCCTCAAGCAGCAGCTCTGAGG - Intronic
955731251 3:61989650-61989672 CACGTCTAGTGTCAGCTGTGGGG + Exonic
957455752 3:80442127-80442149 CCCCTCCAACTTCAGCTTTGGGG + Intergenic
957641976 3:82866060-82866082 CTCCTCCATTGTCAGATATGTGG + Intergenic
958154109 3:89730838-89730860 CCCCTACAGTGTCCCCACTGGGG + Intergenic
961410968 3:126720140-126720162 CGCCTCCAATCTCAGCTCTTTGG - Intronic
961722229 3:128904521-128904543 TCCCTCCAGCGCCAGCTCTCTGG - Intronic
962180131 3:133197934-133197956 ATTCTCCAGTGTCAGCTATGGGG - Intronic
962310918 3:134326279-134326301 CCCTTCCGGTGCCACCTCTGTGG - Intergenic
962456160 3:135567440-135567462 CCTCTCCAGGGCCAGCTGTGGGG + Intergenic
967333818 3:188320379-188320401 GCCCTGCAGTCTCAACTCTGGGG + Intronic
967865312 3:194185438-194185460 CGCCTGCAGTGCCATCTCTGGGG - Intergenic
968703612 4:2067890-2067912 AACCCCAAGTGTCAGCTCTGTGG - Exonic
968845956 4:3041680-3041702 CCTCAGCAGGGTCAGCTCTGGGG - Intergenic
968881684 4:3303398-3303420 CTCCCCCAGTCTCACCTCTGTGG + Intronic
968908686 4:3465987-3466009 CCCCTCAAGTGTCTGGCCTGGGG - Intronic
969829243 4:9781795-9781817 CCCCTCCAGTCTCCGCGATGGGG - Exonic
972638980 4:40908775-40908797 CTCCCCCATTGTCGGCTCTGAGG - Intronic
973872277 4:55178281-55178303 CCCATCCTGTTTCATCTCTGAGG - Intergenic
973960648 4:56106546-56106568 CCCTTTCAGTGTTAGCTATGTGG + Intergenic
978885203 4:113760861-113760883 CCCCTGGTTTGTCAGCTCTGGGG - Intronic
982705193 4:158701374-158701396 CCTCCCCATTGTCTGCTCTGTGG + Intronic
984944118 4:184957904-184957926 CCACTGCAGTGTCAGCTCCAGGG - Intergenic
985283021 4:188305772-188305794 CCACTCCATTGGCAGCACTGTGG + Intergenic
985657685 5:1140526-1140548 TCCCTCCAGGGACAGCTGTGGGG - Intergenic
985789092 5:1915808-1915830 TCCCTCCCGGGGCAGCTCTGAGG - Intergenic
986593494 5:9395902-9395924 CTCCTCCAGTTTCATCTCTGTGG - Intronic
986862935 5:11949323-11949345 CCCCTCCAGTTTCAGTTTTGAGG + Intergenic
992632847 5:78698593-78698615 TCCCTCCAGTGTCTGCTTTGTGG - Intronic
994153060 5:96472356-96472378 TCTTTCCAGTGTCAGCTCTTTGG + Intergenic
994902515 5:105793709-105793731 CACCTGCAGTGTCAGCACTTTGG - Intergenic
999353092 5:150896020-150896042 TCTCTCCAGTATGAGCTCTGTGG + Exonic
999441642 5:151605883-151605905 CCCCTCCAGGGTCACCTGTTTGG - Intergenic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1003635815 6:7830517-7830539 CCCCTCCAGAATGACCTCTGAGG + Intronic
1005182827 6:23125952-23125974 ATCCTTCCGTGTCAGCTCTGGGG + Intergenic
1006008901 6:31026022-31026044 CACCTCCACTGCAAGCTCTGAGG + Exonic
1006411303 6:33875497-33875519 CTCCTCCGCTGTCAGCTGTGGGG - Intergenic
1006839042 6:37016371-37016393 GGTCTCCAGTGTCAGCTCAGCGG + Intronic
1007162550 6:39803689-39803711 TCCTTCCAGTGTTAGCACTGAGG - Intronic
1007235901 6:40391379-40391401 CCCTTCCAGTGTCGGGTGTGGGG + Intergenic
1007398022 6:41588191-41588213 CCCCTCCAGCCTCAGCCCCGGGG + Intronic
1010487731 6:76435428-76435450 CCCCTCCATTGCCTGCTCTGTGG - Intergenic
1011040339 6:83022972-83022994 TCCCTAAAGTGTCAGCTCTGAGG + Intronic
1013292826 6:108733259-108733281 ACACTCCAGTGACACCTCTGGGG + Intergenic
1016367667 6:143337031-143337053 CCCCTCCCCTGTGAGCCCTGAGG - Intronic
1017648985 6:156563867-156563889 TCCCTCCAGTGACAGCGGTGGGG - Intergenic
1019906421 7:4068542-4068564 GCCCTCCAGTGAGAGCCCTGAGG + Intronic
1020045047 7:5034361-5034383 CCCCTCTACTCTCAGCTCTTTGG - Intronic
1020901861 7:14013599-14013621 CTTCTCCAGTGTGAGTTCTGAGG - Intergenic
1021807479 7:24371611-24371633 CTAATCCAGTGTCAGCTGTGTGG - Intergenic
1022528910 7:31054801-31054823 CACCTCCAGTGTCAGCCCCATGG - Intronic
1023825275 7:44004810-44004832 CCCCTCTACTCTCAGCTCTTCGG + Intronic
1024482219 7:49875614-49875636 GCCTTCCAGTATCAGCTCTGTGG + Intronic
1024895709 7:54259408-54259430 CACCTCCAGTGACAGGTCAGTGG - Intergenic
1025192549 7:56907078-56907100 CCTCTCCAGTGACAGCTCAGGGG - Intergenic
1025679397 7:63669844-63669866 CCTCTCCAGTGACAGCTCAGGGG + Intergenic
1026725429 7:72866765-72866787 CCCCTCTACTCTCAGCTCTTCGG - Intergenic
1026823763 7:73568225-73568247 CCATCCCACTGTCAGCTCTGTGG - Intergenic
1027273383 7:76536567-76536589 CCCCTCTACTCTCAGCTCTTCGG - Intergenic
1028392679 7:90334595-90334617 CCCCACCAGTGCCGGCCCTGTGG + Intergenic
1029719074 7:102351121-102351143 CCCCTCTACTCTCAGCTCTTCGG - Intergenic
1029753540 7:102558137-102558159 CCCCTCTACTCTCAGCTCTTCGG + Intronic
1029771488 7:102657221-102657243 CCCCTCTACTCTCAGCTCTTCGG + Intronic
1031627840 7:124010539-124010561 TCCCTCCTGTGTCTTCTCTGTGG - Intergenic
1033559921 7:142521517-142521539 CCTCTCCACCATCAGCTCTGGGG - Intergenic
1034394095 7:150807054-150807076 CTCCTCCAGTGCCAGGTATGGGG - Intergenic
1034839016 7:154378510-154378532 CCTCTCCAGTGCCAGGTCTGTGG - Intronic
1035242759 7:157542879-157542901 CCCCTCAAACGCCAGCTCTGAGG - Intronic
1035572678 8:683408-683430 CCCCTCCAGGGTCAGCCGTGAGG + Intronic
1037829877 8:22181112-22181134 ACCCTCCAGTCTTTGCTCTGTGG + Intronic
1038612777 8:29070432-29070454 CCCTGCCAGTGACAGCCCTGAGG - Exonic
1039786038 8:40834909-40834931 ACCCTGCAGTGGCAGCTTTGGGG + Intronic
1040309635 8:46230085-46230107 ACCCTCCTGGGACAGCTCTGGGG - Intergenic
1040335423 8:46413541-46413563 GCCCTCCCGGGTCAGCCCTGGGG - Intergenic
1040339359 8:46432657-46432679 GCCCTCCAGGGACAGCCCTGGGG - Intergenic
1040342482 8:46447949-46447971 GCACTCCTGTGACAGCTCTGGGG + Intergenic
1044749278 8:95400709-95400731 CTTCCCCAGTGTCAGCTCTTAGG + Intergenic
1049617244 8:143581020-143581042 CCCCTGCAGTGTCAGGCGTGGGG + Intronic
1051513623 9:17906500-17906522 CCCCTCCCGTGTCAGCCCAGCGG - Intergenic
1051681155 9:19609350-19609372 CCCCTCCAGGGCCACCTCAGAGG + Intronic
1056311029 9:85341141-85341163 CCTCCCCAGTGTGAGCCCTGGGG + Intergenic
1056326832 9:85486971-85486993 CCCCTCCAGTGTCCCCAGTGGGG - Intergenic
1056823383 9:89860196-89860218 CCTGTCCAGTGTGTGCTCTGAGG - Intergenic
1057488843 9:95506936-95506958 CCCCTCCCTTCTCAGCTCTGGGG - Intronic
1060164233 9:121395875-121395897 CCCCTTCAGTGGCATCTCTGAGG + Intergenic
1060280005 9:122209448-122209470 CCGCTCCAGTGACTGCTGTGGGG + Intronic
1060655710 9:125371312-125371334 CCCCTCTTGAGTCAGCTCAGTGG - Intergenic
1060767745 9:126307743-126307765 CGGCTCCAGTGTGAGCTCTGTGG + Intergenic
1061039572 9:128132087-128132109 CCTGTCCAGTGTGTGCTCTGAGG + Intergenic
1061438513 9:130582324-130582346 CCCCTGCAGTCTCAGCTGTTTGG + Intronic
1061592317 9:131605811-131605833 CACCTGCAGTCTCAGCTCTTTGG + Intronic
1061652211 9:132059877-132059899 CTCCCTCAGTGTTAGCTCTGAGG - Intronic
1062025287 9:134337441-134337463 CCCATCAAGTGGCAGCACTGGGG - Intronic
1062627545 9:137450075-137450097 CTCCTCCACGGTCCGCTCTGTGG - Intronic
1186485584 X:9932285-9932307 GCCCTCCCGGGGCAGCTCTGGGG - Exonic
1186689762 X:11962796-11962818 CCCTTCCAGATTCTGCTCTGTGG - Intergenic
1189656844 X:43253438-43253460 CCTCTCAAGTGTCAGCCCTGGGG + Intergenic
1191720270 X:64223240-64223262 CCCCTGCTGTGTCTCCTCTGTGG + Intergenic
1192536723 X:71934702-71934724 CCCCTCCACTGCCATCTGTGTGG - Intergenic
1198683029 X:139202923-139202945 CCACTCCAGCGTCTGCTCCGTGG + Intronic
1200120749 X:153789221-153789243 CCCCACAAGAGTCAGCTCAGAGG + Intronic
1202115885 Y:21468456-21468478 TTCCTCCAGTGTCGACTCTGGGG - Intergenic
1202329222 Y:23728849-23728871 CACCTCCAGTGCCAGCACTATGG - Intergenic
1202541549 Y:25941205-25941227 CACCTCCAGTGCCAGCACTATGG + Intergenic