ID: 947750557

View in Genome Browser
Species Human (GRCh38)
Location 2:232529922-232529944
Sequence CGTTCTCTGAGGGCGGCACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947750557_947750566 0 Left 947750557 2:232529922-232529944 CCATGTGCCGCCCTCAGAGAACG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 947750566 2:232529945-232529967 GGGAGTGGGAGATAGTCCACCGG 0: 1
1: 0
2: 0
3: 15
4: 160
947750557_947750567 4 Left 947750557 2:232529922-232529944 CCATGTGCCGCCCTCAGAGAACG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 947750567 2:232529949-232529971 GTGGGAGATAGTCCACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
947750557_947750569 10 Left 947750557 2:232529922-232529944 CCATGTGCCGCCCTCAGAGAACG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 947750569 2:232529955-232529977 GATAGTCCACCGGCCGGCCAGGG 0: 1
1: 0
2: 0
3: 0
4: 29
947750557_947750572 19 Left 947750557 2:232529922-232529944 CCATGTGCCGCCCTCAGAGAACG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 947750572 2:232529964-232529986 CCGGCCGGCCAGGGTCAACGTGG 0: 1
1: 0
2: 0
3: 9
4: 86
947750557_947750568 9 Left 947750557 2:232529922-232529944 CCATGTGCCGCCCTCAGAGAACG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 947750568 2:232529954-232529976 AGATAGTCCACCGGCCGGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947750557 Original CRISPR CGTTCTCTGAGGGCGGCACA TGG (reversed) Exonic
903121000 1:21217188-21217210 TGTCCTTTGAGGCCGGCACAGGG - Intergenic
907667946 1:56449816-56449838 CCTTCTCTGAGGGTGAGACATGG + Intergenic
912652035 1:111448708-111448730 CCTTCGTTGGGGGCGGCACAGGG + Exonic
1063896013 10:10682975-10682997 CGTTCTGTGAGTGTGGCACTGGG - Intergenic
1064585932 10:16839181-16839203 CGGTCTCTGAGGGTGGGCCAGGG + Intronic
1067279372 10:44859720-44859742 CGTTCTCTGTGTGCTGCACAGGG + Intergenic
1073564172 10:104521135-104521157 CGTTCATTGAGGGGGGCACTGGG + Intergenic
1076061514 10:127417379-127417401 CTTTCTCTGAGGGCCCCACAGGG - Intronic
1077199760 11:1300276-1300298 GATCCTCTGAGAGCGGCACATGG - Intronic
1089921509 11:122213497-122213519 CGTTCTCTGATGGTGGTCCAGGG + Intergenic
1105768100 13:23579987-23580009 CGTTGTCTGTGAGCGGCCCAGGG + Intronic
1119726287 14:76923696-76923718 CTTTCTCTGAGGGAGGAACTAGG - Intergenic
1131958321 15:97761978-97762000 GTTTCTCTGATGGCGGAACATGG + Intergenic
1132506301 16:310987-311009 TGGTCTCTGAGGGAGGCACAAGG + Intronic
1135348105 16:21706412-21706434 GATTCTCTGAGGGTGGCACCTGG - Intronic
1141310841 16:82912012-82912034 GGGGCTCTGAGGGCTGCACACGG - Intronic
1141635550 16:85312147-85312169 TGTTCTCTGAGCTGGGCACACGG - Intergenic
1142299732 16:89249350-89249372 CCTTCTCTGAGGGTGCCACGAGG + Intergenic
1148809284 17:50279948-50279970 CTCTCTCCGAGGGCGGCCCATGG - Exonic
1152550997 17:81030176-81030198 CCTTCTGTGTGGGCTGCACATGG - Intergenic
1155316397 18:24575747-24575769 AGATCTCTGGGGGTGGCACAGGG + Intergenic
1155699488 18:28725723-28725745 GCTTCTCTGAGGGCGGTATAAGG + Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156241979 18:35263558-35263580 GGTTCTCTAAGGGCTGCACCGGG + Exonic
1159848429 18:73495214-73495236 AGAACTCTGAGGGTGGCACAAGG + Intergenic
1161718988 19:5892888-5892910 CGTCCTCTGAGGACAGAACAAGG + Exonic
1167036720 19:46999204-46999226 CCTTCTCTGAGGACAGCCCAGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
927923061 2:26988750-26988772 CCCTCTCTGAGGGTGGCCCAAGG + Intronic
929530004 2:42744174-42744196 CATTGTCTGAGGGCAGCAGATGG + Intronic
943407080 2:187502605-187502627 GGCTCTCTGAGGGCTCCACAAGG - Intronic
947750557 2:232529922-232529944 CGTTCTCTGAGGGCGGCACATGG - Exonic
948269715 2:236664948-236664970 CCTCCTCTGAGGGCAGCTCAGGG + Intergenic
1174431539 20:50473472-50473494 AGTTCCCTGAGGGAGGGACAGGG + Intergenic
1175037137 20:56010367-56010389 CGTTCTCTGAGGCCCGCATGAGG + Intergenic
1177418990 21:20831184-20831206 CTTTCTCTGAGGGTGGCTTAGGG + Intergenic
1180969375 22:19807171-19807193 CGTCCTCTGAGGGCAGCTCCGGG + Intronic
949650720 3:6155840-6155862 CGTTCTGTTAGGGCTGCACAGGG + Intergenic
953705451 3:45226546-45226568 CGTTCTCAGAGGGAGGCTCCAGG + Intergenic
955074752 3:55602938-55602960 GGTTCTCAGAGGGTGGGACAGGG + Intronic
961479022 3:127167592-127167614 CATGCTATGAGGGCTGCACAGGG - Intergenic
976012451 4:80507309-80507331 CATTCTATGGGGGCGTCACATGG + Intronic
979436872 4:120703528-120703550 AGTTCTATGAGGGCAGGACATGG + Intronic
982361491 4:154523987-154524009 CCTTCTTTGGGGGTGGCACAGGG - Intergenic
984858427 4:184215830-184215852 CCTTCTCTCAGGACAGCACAAGG + Intronic
987225163 5:15832198-15832220 CTTTCCCTGAGGGCAGTACATGG + Intronic
997612662 5:135226135-135226157 CGTTTTCCAAGGGCGGCAGAGGG + Intronic
1002649817 5:180682866-180682888 CGTCCTCTGAGGAAGCCACAGGG + Intergenic
1002765385 6:234654-234676 CTTTCTGTTAGGGCAGCACAAGG - Intergenic
1006931453 6:37691348-37691370 CGTTCTGAGAGGTCAGCACAAGG - Intronic
1019595684 7:1857329-1857351 TGTGCTCGGGGGGCGGCACAAGG + Intronic
1024609605 7:51053369-51053391 GGGTCCCTGAGGGCAGCACAGGG - Intronic
1026848702 7:73711827-73711849 GGGTCTCTGAGGGCAGGACAGGG - Intronic
1026988293 7:74568738-74568760 CCTTCTCTCAGGGAGGGACAGGG + Intronic
1034255231 7:149721130-149721152 TGTGCTCAGAGGGCGGCACACGG - Intronic
1035201496 7:157270211-157270233 TGTTCTGTGAGGGATGCACAGGG - Intergenic
1038532412 8:28329077-28329099 CATTCTCGGAGGGCTGCTCAGGG - Intronic
1040518562 8:48154550-48154572 CCTTCTCTGGGGGCTGCCCAAGG + Intergenic
1041241844 8:55855002-55855024 GTATCTCTGAGGGTGGCACAAGG + Intergenic
1060887198 9:127162781-127162803 TGTTCTCACAGGGCAGCACAGGG + Intronic
1185642871 X:1598162-1598184 CGAGCTCGGAGGGCGGCTCAGGG - Intronic