ID: 947750693

View in Genome Browser
Species Human (GRCh38)
Location 2:232530449-232530471
Sequence CCGTGGGCCTGGCACACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 8, 3: 107, 4: 666}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947750682_947750693 24 Left 947750682 2:232530402-232530424 CCTCTGTCAGGGCAGAGACCAAG 0: 1
1: 0
2: 5
3: 31
4: 236
Right 947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG 0: 1
1: 0
2: 8
3: 107
4: 666
947750681_947750693 25 Left 947750681 2:232530401-232530423 CCCTCTGTCAGGGCAGAGACCAA 0: 1
1: 2
2: 3
3: 42
4: 484
Right 947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG 0: 1
1: 0
2: 8
3: 107
4: 666
947750685_947750693 0 Left 947750685 2:232530426-232530448 CCCTCACGGTCACCAGTGTGTGA 0: 1
1: 0
2: 1
3: 127
4: 4769
Right 947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG 0: 1
1: 0
2: 8
3: 107
4: 666
947750684_947750693 6 Left 947750684 2:232530420-232530442 CCAAGTCCCTCACGGTCACCAGT 0: 1
1: 0
2: 1
3: 10
4: 116
Right 947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG 0: 1
1: 0
2: 8
3: 107
4: 666
947750686_947750693 -1 Left 947750686 2:232530427-232530449 CCTCACGGTCACCAGTGTGTGAC 0: 1
1: 0
2: 3
3: 12
4: 281
Right 947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG 0: 1
1: 0
2: 8
3: 107
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947750693 Original CRISPR CCGTGGGCCTGGCACACAGG AGG Intronic
900140205 1:1136670-1136692 CGGGCCGCCTGGCACACAGGAGG + Intergenic
900158935 1:1214261-1214283 CTGTGGGCTGGGCACAAAGGCGG + Intergenic
900376968 1:2359279-2359301 CACAGGGCCTGGCACACAGCTGG + Intronic
900395114 1:2450291-2450313 CCGTGGGCCTCCAGCACAGGCGG + Intronic
900863365 1:5249409-5249431 GCATGTGCCTGGCACACAGTAGG + Intergenic
900967635 1:5970046-5970068 CCCTGGGCCTGGCAGGAAGGCGG - Intronic
901214896 1:7549850-7549872 CTGGGCGCTTGGCACACAGGAGG - Intronic
901435894 1:9247299-9247321 AAGTAGGCCTGGCACAGAGGCGG + Intronic
901622965 1:10604054-10604076 CCAGGGGTCTGGCACACAGTAGG - Intronic
901689902 1:10965988-10966010 CTCAGGGCCTGGCACACAGTAGG - Intronic
901754610 1:11434033-11434055 CTTCCGGCCTGGCACACAGGAGG - Intergenic
901858368 1:12058625-12058647 CCAAGGGCCTGGTACACAGCAGG + Intergenic
902341163 1:15784559-15784581 CCGTGGGCTCGACAGACAGGAGG - Intronic
902448163 1:16480464-16480486 CCAAGAGCCTGGCACACAGTAGG + Intergenic
902506571 1:16942535-16942557 CCAAGAGCCTGGCACACAGTAGG - Intronic
902611491 1:17600190-17600212 CAGAGGGCCTGGCTCACAGGAGG + Intronic
902719274 1:18293211-18293233 CCCAGGGCCTGGCACACAGTGGG + Intronic
902719728 1:18295943-18295965 CCCAGGGCCTGGCACACAGTGGG + Intronic
902785535 1:18730642-18730664 CCGAGGGCCTGGGACTGAGGAGG - Intronic
902787203 1:18740328-18740350 CCATGGGCCCAGCACACAGTAGG - Intronic
902804943 1:18855162-18855184 CCTAGGGCCTGGCACACAGTAGG - Intronic
902839428 1:19065893-19065915 CCAAGAGCCTGGCACAGAGGCGG - Intergenic
902873481 1:19327580-19327602 CTGGGTGCCTGGCACACAGGAGG - Intronic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
903037757 1:20505179-20505201 CCCGGGGGCTGGCACATAGGAGG + Intronic
903139163 1:21328367-21328389 CCTTGTGCCTGGCACATAGTGGG + Intronic
903181151 1:21605624-21605646 CCCAGGGCCTGACACACAGTGGG + Intronic
903225368 1:21891527-21891549 CCGCGTGCCTGGTACACAGCGGG + Intronic
903289249 1:22297419-22297441 ACCTGGGCCTGGCACTCAGGGGG + Intergenic
903365670 1:22804241-22804263 CACTGTGCCTGCCACACAGGAGG + Intronic
903379149 1:22884982-22885004 CCCAGCGCCTGGCACACAGTAGG + Intronic
903381835 1:22902631-22902653 CCCAGGGCCTGGCACACAGTGGG - Intronic
903667441 1:25016689-25016711 CCTGGGCCCTGGCACACAGTAGG - Intergenic
903780019 1:25815093-25815115 CTTTGTGCCTGGCACACAGTAGG - Intronic
904312682 1:29639535-29639557 CCTTGTGCCTGGCACATAGTAGG - Intergenic
904330309 1:29754256-29754278 CGGTGGGCCTGGCACTCAGTGGG - Intergenic
904370536 1:30045042-30045064 ACCAGGGCCTGGCACACAGAAGG + Intergenic
904409615 1:30317540-30317562 AGGTGGCCCTGGCACACAGTAGG + Intergenic
904788996 1:33003871-33003893 CCCAGGGCCCGGCACAGAGGAGG - Intergenic
904825843 1:33273213-33273235 CCCTGTGCCTGTCACACAGTAGG + Intronic
905242147 1:36588268-36588290 CTCAGGGCCTGGCACACAGTAGG + Intergenic
905284955 1:36873191-36873213 CACAGGGCCTGGCACTCAGGTGG + Intronic
905287154 1:36889018-36889040 GCATGGGCCTGGCACGCAGGAGG - Intronic
905336349 1:37247403-37247425 CAGAGGGCCTGGCACATAGTAGG - Intergenic
905739991 1:40361700-40361722 CCGTGGGCCTGGGGCACTGGTGG + Intronic
905789109 1:40781042-40781064 GACTGGGCCTGGCACACAGATGG + Intergenic
905815736 1:40949383-40949405 CCAGGGGCCTGGCACAGAGCAGG + Intergenic
905861500 1:41355086-41355108 CACAGTGCCTGGCACACAGGAGG + Intergenic
905886485 1:41494712-41494734 CCCTGGGCCTGACACAGAGTGGG - Intergenic
905923283 1:41732962-41732984 CCCTGGGCCTGGTACACAGCAGG + Intronic
906212547 1:44020152-44020174 CTCAGGGCCTGGCACACAGTGGG - Intronic
906436783 1:45803474-45803496 CCGTGGCCCTGGCGCGCAGTCGG - Intronic
906471867 1:46137756-46137778 CCCAAGGCCTGGCACACAGTGGG + Intronic
906791517 1:48662221-48662243 TCCTGTGCCTGGCACACAGCAGG - Intronic
907110241 1:51920471-51920493 CCCTGTGCCTGACACAGAGGGGG + Intronic
907247623 1:53118028-53118050 CGGTGGCCCTGGCACTCCGGGGG - Intronic
907304677 1:53506972-53506994 CCCTGGGCCTGGCACACCCAGGG + Intronic
907457002 1:54582374-54582396 AGAGGGGCCTGGCACACAGGAGG - Intronic
907514858 1:54987222-54987244 CCGAGTGCCTGGTACACAGTGGG + Intronic
908435396 1:64100861-64100883 CCATGGTCCAGGCACAGAGGGGG - Intronic
908850912 1:68374919-68374941 CCCTGGGCCTGACACCTAGGAGG + Intergenic
910653995 1:89601379-89601401 CAGACTGCCTGGCACACAGGAGG - Intergenic
910654304 1:89604428-89604450 CCTTGGAGCTGGCACCCAGGTGG - Intergenic
911102734 1:94106981-94107003 CCCAGTGCCTGGCTCACAGGAGG + Intronic
911110503 1:94179148-94179170 GCCAGAGCCTGGCACACAGGAGG + Intronic
912440177 1:109691726-109691748 CCCCGGGCCTGGTACCCAGGTGG - Intronic
912713470 1:111965895-111965917 CAGAGTGCCTGGCACACAGAGGG - Intronic
912746108 1:112247013-112247035 CATGGGGCCTGGCACACAGGAGG + Intergenic
913531485 1:119737167-119737189 CCTTGGTGCTGGCACCCAGGTGG - Exonic
914900011 1:151706760-151706782 GCGTGGACCTGGCACACAGTGGG + Intronic
915326466 1:155083454-155083476 CCCTTGCCCTGGCACTCAGGTGG - Intronic
919741831 1:200985645-200985667 CTGTGGGCCTGGCCCACATGTGG + Intronic
919784280 1:201249332-201249354 CAGTGGGGCTGGAACAAAGGTGG - Intergenic
919857484 1:201715638-201715660 CGCTGTGCCTGGCACACAGCTGG - Intronic
919986981 1:202682179-202682201 CCGTGTGCCTGGCTCCCAGCCGG - Intronic
922422180 1:225467535-225467557 CCCTGGGCTTGGCACAGTGGAGG - Intergenic
922791838 1:228315169-228315191 CGGTGGCGCTGGGACACAGGTGG + Intronic
922882250 1:228989885-228989907 GCTTGGGCCTGGCACACTGCAGG - Intergenic
923310999 1:232735300-232735322 GCGTGGGCCTGGGACACAGCAGG - Intergenic
923450025 1:234107778-234107800 CAGAGGCCCTGGTACACAGGAGG + Intronic
923525660 1:234770588-234770610 CTGGGGGCCTGGCACACAGCAGG - Intergenic
923541762 1:234893354-234893376 CCCTGTTCCTGGCACACAGAAGG - Intergenic
1065900980 10:30207695-30207717 CCTTGGGGCTGGAACAGAGGAGG + Intergenic
1065977555 10:30855957-30855979 CTCTGTGCCTGGCACACAGGAGG + Intronic
1067048276 10:42998011-42998033 CCGCTTGACTGGCACACAGGGGG + Intergenic
1067221342 10:44346391-44346413 CCCAGGGCCAGGCACACAGTCGG + Intergenic
1067470757 10:46536175-46536197 CCCTGCCCCTGCCACACAGGAGG + Intergenic
1067628318 10:47941785-47941807 CCATGGGCCTGGCCCATAGTAGG - Intergenic
1067788642 10:49271283-49271305 CCCAGGGCCTGGCACACTGTAGG - Intergenic
1068553808 10:58435489-58435511 CAGTGAGCCTGGCATGCAGGGGG + Intergenic
1068957311 10:62829832-62829854 CCCAGGGCCTGGCACTCAGTAGG - Intronic
1069217490 10:65840344-65840366 CCGTGGACCTGGTAAACAAGGGG + Intergenic
1069618314 10:69820440-69820462 CTGGGGGCCTGGCACCCAGAAGG - Intronic
1069752050 10:70751255-70751277 CCTTGGGCCTGGCACACAGCAGG + Intronic
1069833663 10:71295792-71295814 CCATGCCCCTGGCCCACAGGAGG + Exonic
1069890747 10:71650977-71650999 CCATGTGCCTAGCACACAGCAGG - Intronic
1070016037 10:72532452-72532474 GCATGGGCCTGGCACACAGGAGG - Intronic
1070365368 10:75731776-75731798 CCCAGGGCCTGGCACATGGGTGG + Intronic
1070491677 10:76982418-76982440 CACAGGGCCTGGCACTCAGGGGG + Intronic
1070714404 10:78708611-78708633 CCCAAGGCCTGGCACAGAGGAGG - Intergenic
1070782844 10:79147515-79147537 CCCAGGTCCTGGCACACAGTAGG - Intronic
1070831297 10:79419582-79419604 CCAAGGGCCTGGCACACTGGAGG + Intronic
1070967736 10:80539779-80539801 CCCTGGGCCCAGCACAGAGGTGG + Intronic
1071290507 10:84185567-84185589 CAAAGGGCCTGGCACACAGAGGG + Intergenic
1071876155 10:89845457-89845479 CTGTGTGGCTGGAACACAGGTGG + Intergenic
1072743253 10:97922854-97922876 CTCAGTGCCTGGCACACAGGAGG + Intronic
1073148050 10:101293131-101293153 CCTTGCGCCTGGCACCCAGTAGG - Intergenic
1073466143 10:103695566-103695588 ACCAGGGCCTGGCACAAAGGAGG - Intronic
1074112362 10:110431607-110431629 GTGTGGCCCTGGCACACAGAAGG - Intergenic
1074301020 10:112233524-112233546 ACATGTGCCTGGCACACAGGAGG - Intergenic
1074393502 10:113077819-113077841 GCATGGGCCTGCTACACAGGAGG - Intronic
1074543452 10:114384924-114384946 CAGAGTGTCTGGCACACAGGTGG - Intronic
1075227251 10:120640735-120640757 CCCAGGGCCTGGCACACAAGGGG + Intergenic
1075516437 10:123112533-123112555 CAGGGGGGCTGGCACACAGGGGG - Intergenic
1075591393 10:123694050-123694072 CACAGGGCCTGGCACACAGTAGG - Exonic
1076994895 11:293071-293093 GCGTGGGGCTGGCACACGTGAGG - Intronic
1077223150 11:1426191-1426213 ATGGGGGCCTGGCACACAGCGGG + Intronic
1077364852 11:2157511-2157533 CTGTGGGCCTGGCTCACATGGGG + Intronic
1077476781 11:2794233-2794255 CGGTGGGGCTGGCAGACTGGGGG - Intronic
1077490684 11:2859523-2859545 GCCTGGGCCTGCCACTCAGGAGG - Intergenic
1077544102 11:3161548-3161570 CCCAGGGGCTGGCACACAGTAGG - Intronic
1077727075 11:4685222-4685244 CCATGGGAATGGCACACAAGTGG - Intronic
1078177726 11:8982747-8982769 TACTGGGCTTGGCACACAGGAGG + Exonic
1078565695 11:12412229-12412251 GCGTGAGCCTGGCACACAGTAGG + Intronic
1078583205 11:12556419-12556441 CAGAGTGCTTGGCACACAGGAGG + Intergenic
1079005018 11:16785447-16785469 CACAGGGCCTGGCACACAGTGGG - Intronic
1079084893 11:17438240-17438262 CCCCAGGCCTGGCACACAGAAGG + Intronic
1080117097 11:28633344-28633366 CCCAGTGCCTGGCACACAGTAGG + Intergenic
1080481769 11:32658598-32658620 CTATGTGCCTGACACACAGGAGG - Intronic
1080668599 11:34357080-34357102 CCGTGCGCCTGGTGCACAGCTGG - Exonic
1080805039 11:35645167-35645189 CCCTTAGCTTGGCACACAGGAGG + Intergenic
1080826768 11:35855154-35855176 CAGAGAGCCTGGAACACAGGAGG - Intergenic
1080855109 11:36105355-36105377 CCAGGGGCCTGGCACAGGGGAGG - Intronic
1081473824 11:43404490-43404512 GCATTAGCCTGGCACACAGGTGG - Intronic
1081583049 11:44365618-44365640 CCCAGGGCCTGGCACACGGGAGG - Intergenic
1081759595 11:45567998-45568020 CTGCGGGCCTGGCACATAGTAGG + Intergenic
1083184759 11:61011002-61011024 CCCAAGGCCTGGCACACAGTAGG + Intronic
1083266073 11:61547398-61547420 CCCGGGGCCGGGCACACAGTGGG + Intronic
1083287669 11:61670821-61670843 CTGTGTGCCTGGCACATAGTAGG - Intergenic
1083361947 11:62115274-62115296 CAATGGGCATGGCACACTGGTGG - Intergenic
1083581810 11:63829900-63829922 CCTGGGGCCTGGCACATAGTAGG + Intergenic
1083722653 11:64611107-64611129 CAGTGGGCCTGGCACAGAATTGG + Intronic
1083990385 11:66242872-66242894 CCCAGGGGCTGGGACACAGGTGG + Intronic
1084105623 11:66978412-66978434 CTCTGGGCCTGGCACATAGTAGG + Intergenic
1084433085 11:69122348-69122370 CCCAGTGCCTGGCACACAGCGGG + Intergenic
1084435577 11:69137383-69137405 CACTGTGCCTGGCACACAGTAGG + Intergenic
1084739244 11:71128323-71128345 CCTTGGGCCAGGCACGCAGCAGG - Intronic
1084855597 11:71983642-71983664 CACAGGGCCTGGCACACAGTAGG - Intronic
1085179407 11:74521001-74521023 CCATGGCCCTGGAACCCAGGTGG - Intronic
1085260673 11:75203014-75203036 CCCCAGGCCTGGCACACAGTGGG - Intronic
1085273836 11:75285707-75285729 CAAGGGGCCTGGCACAAAGGGGG + Intronic
1085298724 11:75445899-75445921 CCCAGGACCTGGCACACAGCAGG + Intronic
1085306512 11:75488992-75489014 CACTGGGCCTGGCACCAAGGAGG + Intronic
1085309173 11:75506126-75506148 CCAAGGGCTTGGCACACAGTAGG + Intronic
1085450401 11:76628796-76628818 CCCAGGGCCTGACACACAGGTGG - Intergenic
1085517259 11:77118794-77118816 CACAGAGCCTGGCACACAGGTGG - Intronic
1085517806 11:77121670-77121692 CAGGGGGCTTGGCACACAGCAGG + Intronic
1085531486 11:77194683-77194705 CTGTGTGCCTGGCACACAGATGG - Intronic
1085531488 11:77194687-77194709 CTGTGTGCCAGGCACACAGAGGG + Intronic
1085532123 11:77198127-77198149 CACAGGGCCTGGCACACAGCAGG - Intronic
1085711350 11:78831640-78831662 CAGCGGGGCTGGCACACAGGAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086091010 11:83004706-83004728 CCATGGGCCTGACACACATGTGG - Intronic
1086595067 11:88560821-88560843 CCGAGGGCCTAGCACAGTGGTGG + Intronic
1086988344 11:93274461-93274483 CACTGTACCTGGCACACAGGAGG - Intergenic
1087194828 11:95294828-95294850 CACAGGGCTTGGCACACAGGAGG - Intergenic
1089273443 11:117316479-117316501 CAGTGTGCCTGGCATACAGTGGG - Intronic
1089461023 11:118653720-118653742 CTATGTGCCTGGCACACAGTAGG - Intronic
1089625353 11:119747771-119747793 CCTAGGGCCTGGCACATAGTAGG - Intergenic
1089764995 11:120756785-120756807 CCCTGAGGCTGGGACACAGGTGG + Intronic
1090969013 11:131623709-131623731 GAGTGGGCCTGGCCCAGAGGGGG - Intronic
1091225011 11:133951785-133951807 CCGTGGGCTCGGCCCCCAGGAGG + Intronic
1091390039 12:120544-120566 GCCTGGTCCTGGCACACAGATGG - Intronic
1091641677 12:2241833-2241855 CAGTGTGCCTGGCACGCAGTGGG + Intronic
1092291309 12:7160875-7160897 CACAGGGCCTGGCACACAGTAGG + Intergenic
1093066091 12:14659802-14659824 GAGGGGGCCTGGCAGACAGGTGG - Intronic
1094838056 12:34331440-34331462 CCCGGGGCCTCGCACAGAGGCGG + Intergenic
1095312994 12:40723124-40723146 GCGGGAGCCTGGCACAGAGGAGG + Intronic
1095491620 12:42740417-42740439 GCCTGTGCCTGGCACACAGGAGG - Intergenic
1096163874 12:49404036-49404058 CCCAGTGCCTGGCACACAGCAGG - Intronic
1096230495 12:49894218-49894240 GCGTGGGCCTGGCACAGGGGTGG + Intronic
1096604596 12:52755494-52755516 ACATGGGCTTGGTACACAGGTGG - Intergenic
1098092884 12:66922868-66922890 CTCTGAGCCTGGCACACAGTGGG + Intergenic
1098544841 12:71700355-71700377 GCATGGGGCTGGCACAAAGGAGG - Intronic
1100467228 12:94857053-94857075 CATTGGGCCTGGCACATAGTAGG - Intergenic
1101262840 12:103050165-103050187 CACTGTGCCTGGCACACAGCAGG + Intergenic
1101330632 12:103755156-103755178 CTCTGTGCCTGGCACACAGTAGG - Intronic
1101591717 12:106130826-106130848 CCTGGTGCCTGGCACACAGTAGG - Intronic
1101734674 12:107454095-107454117 CCCTGTGCCTGGCACATAGTAGG + Intronic
1101928559 12:108993470-108993492 CTTTGGGCCTGGCACAAAGCAGG - Intronic
1102029076 12:109729709-109729731 CCCTGGGCCTGGCACCCACCTGG + Intronic
1102212129 12:111135064-111135086 TCCAGGGCCTGGCACACAGCAGG - Intronic
1102452642 12:113053321-113053343 CCCAGTGCCTGGCACATAGGAGG + Intergenic
1102672611 12:114632882-114632904 CCCAGGGCCTGGCACAGAAGAGG - Intergenic
1102734235 12:115143947-115143969 CCCTGAGCCAGGCACACAGTAGG + Intergenic
1102859752 12:116325553-116325575 CACAGGGCCTGGCACACAGTAGG - Intergenic
1103368727 12:120402301-120402323 CCCTGGGCGCTGCACACAGGGGG - Intergenic
1103567777 12:121825469-121825491 CAGAGGGGCTGGCACACAGAGGG + Intronic
1103736376 12:123063423-123063445 CCCAGGGCTTGGCACACAGCTGG + Intronic
1103992640 12:124809587-124809609 CCGGGCACCTGGCACACAGTAGG + Intronic
1104640567 12:130464428-130464450 CAGAGGGCCTGGCACATAGCAGG - Intronic
1104963620 12:132499435-132499457 CCCAGGGCCTGGCACACAGCCGG - Intronic
1105069804 12:133227557-133227579 CCTGGTGCCTGGCACACAGTGGG + Intronic
1106108519 13:26756752-26756774 CATGGGGCCTGGCACACATGTGG + Exonic
1106229028 13:27807592-27807614 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1107928984 13:45290856-45290878 CCCTGTGCCTGGCACACAGTGGG - Intergenic
1107953035 13:45483026-45483048 CCCTGTGCCTGGCACAAAGTAGG - Intronic
1112602430 13:100869535-100869557 CTGTGGATCTGGCACACAGTGGG - Intergenic
1113682015 13:112251137-112251159 CCATGTGCCTGGCACACACTGGG + Intergenic
1113808134 13:113121788-113121810 CATTGTGCCTGGCACACAGGAGG - Intergenic
1113896595 13:113768513-113768535 ACCTGGGCCAGGCACAGAGGGGG - Intronic
1117553671 14:56862396-56862418 CCCTGTGCCTGGCACACAGTGGG - Intergenic
1118625736 14:67657345-67657367 CCTTGAGCCTGCCACACTGGGGG + Intronic
1118816343 14:69316935-69316957 CCCTGCACCTGGCACACAGTAGG - Intronic
1118884387 14:69854103-69854125 ACATGAGCCTGGCACACGGGAGG + Intergenic
1119042708 14:71289605-71289627 CCTAGGGCCTGGCTCACATGTGG - Intergenic
1119336553 14:73838141-73838163 GTGTGGGCCTGGTATACAGGTGG - Intergenic
1119391715 14:74295462-74295484 CCCAGGGCCTGGCCCAAAGGAGG + Intronic
1119630800 14:76230160-76230182 CCTTGGGCCTGACACAGAAGGGG + Intronic
1120763573 14:88307872-88307894 CACAGTGCCTGGCACACAGGAGG - Intronic
1121120868 14:91375168-91375190 CCCAGGGCCTGGCACACAGCAGG + Intronic
1121229428 14:92345800-92345822 CCCAGTGCCTGGCATACAGGGGG - Intronic
1121248459 14:92482082-92482104 CACGGGGCCTGGCACACAGCAGG - Intronic
1121437772 14:93930260-93930282 CCCCGGGCCTGGCACACACCAGG + Intergenic
1121452328 14:94016845-94016867 CCGGGGGGCTGGCACAAAGCAGG + Intergenic
1121464130 14:94103303-94103325 TCTGGGGCCAGGCACACAGGAGG - Intronic
1121554881 14:94828981-94829003 CATTGTGCCTGGCACACAGCAGG - Intergenic
1121572772 14:94959941-94959963 CAGAGGCCCTGGCACACAGAAGG + Intergenic
1121642547 14:95495515-95495537 CCCAGTGCCTGGCACACAGCAGG - Intergenic
1121779671 14:96614156-96614178 CCCAGTGCCTGGCACACAGTAGG + Intergenic
1122104410 14:99441388-99441410 CCTAGTGCCTGTCACACAGGAGG - Intronic
1122115533 14:99525605-99525627 CGTGGTGCCTGGCACACAGGAGG - Intronic
1122340199 14:101023015-101023037 CAGTGCGCCTGGCACACAGCAGG + Intergenic
1122406226 14:101502763-101502785 ACGAGGGCCTGGCACGCAGTGGG + Intergenic
1122499303 14:102185950-102185972 TAGAGGGCCTGGCACACAGAAGG - Intronic
1122616012 14:103018497-103018519 CAGTGGTCCTGGAACAGAGGAGG + Intronic
1123030625 14:105449551-105449573 CCGTGGGCCGGACACAAGGGAGG - Intronic
1123105891 14:105840880-105840902 CGGTGAGCCTGGCTCCCAGGTGG - Intergenic
1124953351 15:34343314-34343336 CCGTGTACCTAGCACACAGTAGG - Exonic
1124997226 15:34735600-34735622 CCGTTTGCCTGGCACACAGTAGG + Intergenic
1125390058 15:39182665-39182687 CAGTGGGCCTAGCACATAGAGGG + Intergenic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1125748935 15:42015575-42015597 CATAGGGCCTGGCACACAGTAGG - Intronic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1126847730 15:52776790-52776812 CCTAGTGCCTGGCACATAGGAGG + Intronic
1127253879 15:57271371-57271393 CCGTGGGCCTGGGACCCACCAGG + Intronic
1128417624 15:67461253-67461275 ACATGGGCCTGGCACGGAGGAGG + Intronic
1128801437 15:70499592-70499614 CCCAGGGCCTGGCATGCAGGAGG - Intergenic
1129685633 15:77684787-77684809 CCCTGGGCCTGGCACACAGTAGG - Intronic
1129695130 15:77736363-77736385 CCCAGGGTCTGGCACACAGTAGG - Intronic
1129704179 15:77785170-77785192 CTCAGGGCCTGGCACACAGTGGG + Intronic
1129853608 15:78809899-78809921 CCGTGAGGCTGGCACACAGTAGG + Intronic
1129888551 15:79055897-79055919 CTTTTGGCCTGGCACACAGTAGG - Intronic
1130060574 15:80567033-80567055 ACATGAGCCTGGCACAGAGGTGG - Intronic
1130369092 15:83268347-83268369 TTCTGGGCCTGGCACACAGTGGG - Intronic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1131525330 15:93147887-93147909 TCGCAGGCCTGGCACACAGGGGG - Intergenic
1132039208 15:98511183-98511205 CCCAGGGCCGGGCACGCAGGTGG + Intronic
1132105376 15:99059218-99059240 CCGCGGGCCTGGCGCGCAGAGGG - Intergenic
1132134599 15:99322751-99322773 CTCTGTGCCTGGAACACAGGAGG - Intronic
1132134916 15:99326366-99326388 CTCTGTGCCTGGAACACAGGAGG - Intronic
1132195560 15:99912269-99912291 CCCTGAGCCTGGCATACAGTAGG - Intergenic
1132344815 15:101101696-101101718 CCGATGGTCTGGCACACAGCTGG + Intergenic
1132544874 16:528329-528351 CCGGGGGCCGCGCACACCGGAGG + Intronic
1132554515 16:566663-566685 CCTTGGGTCTGGACCACAGGCGG - Intergenic
1133329111 16:4960276-4960298 CTGTGTGCCGGGCACACAGTAGG + Intronic
1133339654 16:5028093-5028115 CCGTGGCCGTGGCAGTCAGGCGG + Exonic
1133339801 16:5028778-5028800 CCCGGGGCCTGGCACATAGCAGG + Intronic
1133826830 16:9285447-9285469 CACTGTGCCTGGCACACAGTTGG + Intergenic
1134017372 16:10898566-10898588 CTCTGGGCCTGGCACACAGTGGG - Intronic
1134017385 16:10898598-10898620 CCCAAGGCCTGGCACACAGTGGG + Intronic
1134019885 16:10914154-10914176 CCCTGGGCCTGGCACATAGTAGG + Intronic
1134239396 16:12494275-12494297 ACGGGGGCCAGGCACGCAGGAGG - Intronic
1134441037 16:14299853-14299875 CTCTGTGCCTGGCACACAGAGGG + Intergenic
1135259672 16:20970024-20970046 CCCAGGGCCTGGCACAATGGGGG + Intronic
1135578393 16:23604437-23604459 CGCAGTGCCTGGCACACAGGAGG + Intronic
1135603592 16:23803735-23803757 CTATGGGACTGGCAAACAGGAGG - Intergenic
1135732618 16:24907331-24907353 CCCTGTGCCTGGTACACAGTAGG - Intronic
1136019987 16:27434180-27434202 ATGTAGGCCTGGCACCCAGGGGG - Intronic
1136072890 16:27799012-27799034 CCCAGGGCCTAGCACACAGTAGG - Intronic
1136160213 16:28415038-28415060 CCTAGGGGCTTGCACACAGGTGG - Intergenic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136202875 16:28700252-28700274 CCTAGGGGCTTGCACACAGGTGG + Intronic
1136220635 16:28825510-28825532 CTGTGGGCCCGGCACACACAAGG + Intronic
1136538214 16:30912983-30913005 CCCTGGTGCTGGCACACAGTAGG - Intergenic
1137292308 16:47060278-47060300 TCCTGTGCCTGGCACACAGAAGG + Intergenic
1137504550 16:49041654-49041676 CCCAGGGCCAGGCACAAAGGGGG + Intergenic
1137825360 16:51489883-51489905 CCGTGGGTTGGGCACCCAGGAGG + Intergenic
1138822534 16:60278958-60278980 CACAGGGCCTGGCACACAGCAGG + Intergenic
1139349811 16:66327910-66327932 GCCTGGGCCTGGGACACAGGAGG - Intergenic
1139434466 16:66928034-66928056 ACAAGGGCCTGGCACACAGTAGG - Intergenic
1139594533 16:67950149-67950171 CCCTGGGCCTGGCACTCACCTGG - Intronic
1139838623 16:69860336-69860358 CTGTGGGCCAGGCACACACTAGG + Intronic
1139842570 16:69893297-69893319 CCGGGAGCCTGGCACAGAGTAGG + Intronic
1139973884 16:70793565-70793587 TCATGTGCCTGGCACACAGTGGG - Intronic
1141124227 16:81388652-81388674 CAGAGGGCCTGTCACACAAGAGG - Exonic
1141143786 16:81514984-81515006 TGTTGGGCCTGGCACACAGCAGG - Intronic
1141203366 16:81914122-81914144 CCTGGGGCCTGGCACACAGCAGG - Intronic
1141326116 16:83060991-83061013 CAGAGGGCCTGGCACATAGTGGG + Intronic
1141357652 16:83363708-83363730 CCGTCAGCCTGGCACATGGGAGG + Intronic
1141491942 16:84379709-84379731 AAGAGGGCCTGGCAAACAGGAGG - Intronic
1141554152 16:84826119-84826141 CTGGGGCCCTGGCACAAAGGTGG + Intronic
1141677695 16:85526201-85526223 AGCTGGGCCTGGCACACAGTAGG - Intergenic
1141764384 16:86048971-86048993 CAGGGTGCCTGGCACATAGGAGG - Intergenic
1141764554 16:86049883-86049905 CACTGGGCCTGGCGCACAGGAGG - Intergenic
1141804362 16:86332970-86332992 CCCAGAGCCTGGCACACAGTAGG - Intergenic
1142079516 16:88141589-88141611 CCGTGGGAGAGGCACACAGCAGG - Intergenic
1142087161 16:88189544-88189566 CCTAGTGCCTGGCACACAGTAGG - Intergenic
1142135388 16:88449661-88449683 CAGTCGGCCTGGCACATAGGTGG + Intergenic
1142164763 16:88580298-88580320 CCTGGGGCCTGGCACATAGTGGG + Intronic
1142229613 16:88893721-88893743 CCAGGGGCCTGGCAGACATGGGG + Intronic
1142745816 17:1957421-1957443 GGGTAGGCCTGGCACACAGAAGG - Intronic
1143742585 17:8965424-8965446 CCGTGGACCTGGCCCACCGCGGG - Intronic
1144746868 17:17621746-17621768 CCGGGTGCCTGGAACCCAGGGGG - Intergenic
1144771350 17:17761404-17761426 CCCTGTGCCTGGCACAGAGTAGG - Intronic
1144830374 17:18127719-18127741 GCCTGGGACTGGCACACAGTAGG - Intronic
1144944815 17:18964464-18964486 CCCAGGGCCTGGCACACAGTAGG - Intronic
1146466592 17:33091128-33091150 CCCAGGGCCTGGCCCTCAGGTGG + Intronic
1146626548 17:34439509-34439531 CCCTGGGTGTGGCACACAGTAGG + Intergenic
1146787817 17:35733916-35733938 CAGAGGGCCTGGCACATAGCAGG - Intronic
1147045834 17:37751479-37751501 TGGTGGGCCCGGCACACAGCAGG + Intergenic
1147169645 17:38610483-38610505 GCATGGACCTGGCACACAGCAGG - Intergenic
1147246326 17:39123558-39123580 CCCAGTGCCTGGCCCACAGGAGG + Intronic
1147390832 17:40108204-40108226 CCGTGGGCCAGAGAAACAGGAGG - Intergenic
1147610481 17:41799175-41799197 CCAAGTGCCTGGCACACAGCAGG + Intergenic
1147920237 17:43911859-43911881 CCATGTGCCAGGCACACAGAAGG + Intergenic
1147955828 17:44133961-44133983 CAGGAGGCCTGGCACACAGTTGG + Intergenic
1148083919 17:44982837-44982859 CCATGGGCCTGGCATATAGCTGG - Intergenic
1148204577 17:45771813-45771835 CACTGGGCCCGGCACACAGCAGG - Intergenic
1148650659 17:49247995-49248017 GCCTGGTCCTGGCACACAGTAGG - Intergenic
1148905614 17:50909949-50909971 CACAGGGACTGGCACACAGGTGG - Intergenic
1149087259 17:52733029-52733051 CCTAGGGTCTGGTACACAGGTGG + Intergenic
1151346813 17:73507392-73507414 CAGTGGTCCTGGCAGCCAGGAGG + Intronic
1151826039 17:76524996-76525018 TCCTGGGCCTGGCACAGGGGAGG - Intergenic
1151956612 17:77383323-77383345 CCCAGGGCCTGGCACCTAGGAGG - Intronic
1152309086 17:79538261-79538283 GTGTGTGCCTGGCACACAGCAGG + Intergenic
1152348279 17:79768258-79768280 CACAGGGCCTGGCACACAGTGGG + Intergenic
1152421601 17:80196208-80196230 CCTTGGGCCTTGCACACAGTAGG + Intronic
1152551945 17:81034593-81034615 CCGCGGGCCGGGCTTACAGGTGG - Intergenic
1152646423 17:81470875-81470897 CCTGGTGCCTGGCACACAGTAGG - Intergenic
1152734592 17:81991252-81991274 CCAGGGGCCGGGCACACTGGGGG - Intronic
1153557230 18:6328027-6328049 CCATGTGCTTGGCACACAGTAGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1154162908 18:11993436-11993458 TCGGGGGCCTTGCACACATGGGG - Intronic
1154980533 18:21499387-21499409 CCGTGGGCCTGACACAGGGAGGG + Intronic
1155170918 18:23266328-23266350 CCCAGGGCCTGGCATACAGTAGG + Intronic
1155828974 18:30487635-30487657 CAATGGGCCTGGGGCACAGGAGG + Intergenic
1157600088 18:48888370-48888392 CTGTGAGGCTGGCACAGAGGGGG + Intergenic
1157734583 18:50035509-50035531 CCGCGGGTATGGCACAGAGGAGG - Intronic
1158573832 18:58619190-58619212 CCTTGGGGCTGACACACAGTAGG - Intronic
1160072216 18:75638962-75638984 CCCTGGGCCTCGCGCAGAGGTGG - Intergenic
1160154090 18:76419939-76419961 GCGTGGGCCTCACACACAGTGGG - Intronic
1160243419 18:77138467-77138489 AAGAGTGCCTGGCACACAGGAGG + Intergenic
1160660067 19:293771-293793 AAGGGGGCCTGGCACACAGTAGG + Intergenic
1160737809 19:672290-672312 CCCAGGGCCTGGCACACAGTGGG + Intergenic
1160774783 19:850487-850509 CCCAGAGCCTGGCACACAGCAGG - Intergenic
1160835912 19:1124399-1124421 GCATGGGGCTGGCACACAGTGGG - Intronic
1160939535 19:1613900-1613922 CCTTGGGCCTGGCACAGAACAGG - Intronic
1160979052 19:1808064-1808086 CCCAGGGCCTGGCACACAAGAGG - Intronic
1161029872 19:2052542-2052564 GCCTGGGCCTGGCTCACAGAGGG + Intergenic
1161114070 19:2487267-2487289 CAGTAGGCATGGCACGCAGGTGG + Intergenic
1161286330 19:3470232-3470254 CCCTGTGCCTGGCACAGAGTGGG - Intergenic
1161287855 19:3478052-3478074 CATTGGGCCTGGAACACAGGAGG - Intronic
1161457768 19:4378102-4378124 CACAGGGCCTGGCACCCAGGTGG + Intronic
1161493046 19:4572857-4572879 CATGGGGCCTGGCACACAGTAGG + Intergenic
1161625054 19:5321588-5321610 CTCTGGGCCTGGCACACAGTGGG - Intronic
1161795396 19:6383492-6383514 CCCTGTGCCTGGCCCGCAGGAGG - Exonic
1161956731 19:7500263-7500285 CTGTAGGCCTGGCACACAGTAGG - Intronic
1162185238 19:8899813-8899835 CCTTGGGTCTGGTACACAGTAGG + Intronic
1162385325 19:10357553-10357575 ACTTGTGCCTGGCACACAGAAGG - Intronic
1162486409 19:10962988-10963010 CCCTGGGCCTGACACATAGTAGG + Intronic
1162991257 19:14303893-14303915 CCCAGGGCCTGGTACCCAGGGGG + Intergenic
1163429919 19:17261216-17261238 CAGTGTGGCTGGAACACAGGGGG - Intronic
1163446121 19:17347478-17347500 CTGGGGCCCTGGCACACAGCTGG + Intergenic
1163557083 19:17998996-17999018 GCTGGGGCCTGGCACACAGTGGG - Exonic
1163612874 19:18310136-18310158 CCGTGGGCCTGGCTCAGGAGTGG + Intronic
1163678266 19:18666286-18666308 CCCTGAGCCTGGCTCACAGGAGG + Intronic
1163728072 19:18933598-18933620 CCCTCGGCCTGGTACACAGCAGG + Intronic
1163987704 19:20968820-20968842 GCCTGGGCCTGGCCCACAGAAGG + Intergenic
1164129235 19:22346775-22346797 TCCTGGGCCTTGCCCACAGGGGG + Intergenic
1164233453 19:23311593-23311615 GCCTGGGCCTTGCCCACAGGAGG + Intronic
1164283361 19:23788774-23788796 CCCTGGGCCCTGCCCACAGGTGG + Intronic
1164313981 19:24070738-24070760 GCCTGGGCCTGGCACACAGATGG + Intronic
1165023886 19:32945440-32945462 ACGTGCACCTGGCACACAGGTGG - Intronic
1165074568 19:33273681-33273703 CCCTGGGCCTGGCTCACACGTGG + Intergenic
1165351194 19:35276911-35276933 CGGAGGGCCTGGCACATAGTAGG + Intronic
1165362555 19:35345792-35345814 GCATGGGCCTGGCACAAAGAGGG - Intronic
1166318941 19:42004483-42004505 CCCAGGGTCTGGCACACAGTTGG - Intronic
1166331226 19:42079114-42079136 ACTCGGGCCTGGCCCACAGGAGG - Exonic
1166846697 19:45733014-45733036 CCTGGTGCTTGGCACACAGGAGG + Intergenic
1166864089 19:45825767-45825789 CCGTGGACCAGGCAAAGAGGAGG - Intronic
1167009902 19:46800453-46800475 CCTGGGGCCAGGCACACAGAAGG + Intergenic
1167464954 19:49645794-49645816 CCTTGGGGCTGGCATGCAGGAGG + Intronic
1167496782 19:49824098-49824120 CACAGGGCCTGGTACACAGGAGG + Intronic
1167587513 19:50383312-50383334 CCCAGTGCCTGGCCCACAGGAGG - Intergenic
1167608889 19:50496722-50496744 CCGTGGGCCAGGCCCGCAGGAGG + Intergenic
1167667877 19:50833190-50833212 CCTGGGGCCTGGTACACAGGAGG + Intronic
1167736154 19:51295778-51295800 CCCGCGGCCTGGCACACAGGAGG - Intergenic
925035768 2:684456-684478 CCATGTGCCTGGCACAGAGCTGG - Intergenic
925468454 2:4133394-4133416 CTGTGCACCTGGCACACATGTGG + Intergenic
926109097 2:10170738-10170760 CCGTGTGCCTGGCACAGCAGGGG + Intronic
927157551 2:20229999-20230021 CCCTGGGCCTGGCTCCCAGTAGG - Intergenic
927872012 2:26629718-26629740 TGGTGTGCCTGGCACACTGGAGG - Intronic
928088190 2:28358704-28358726 CAATGGGCCTGGCACGCAGTTGG - Intergenic
928134951 2:28681165-28681187 TCCTGTGCCTGGCACAGAGGAGG - Intergenic
928700010 2:33888994-33889016 CCTGGGGCCTGGCACATAGTAGG - Intergenic
929489066 2:42380484-42380506 CCCTGTGCTTGGCACACAGTAGG + Intronic
929750852 2:44711759-44711781 TGATGGGCCTGGCACACAGTAGG - Intronic
931462430 2:62460843-62460865 CGGAGTGCCTGGCACACAGCAGG - Intergenic
932322763 2:70834207-70834229 CCATGTGCCAGGAACACAGGTGG + Intronic
932422497 2:71609527-71609549 AAGAGCGCCTGGCACACAGGAGG - Intronic
932585487 2:73025399-73025421 CCCAGGGCCTGGAACACAGTAGG + Intronic
932761258 2:74440497-74440519 CCGTGGGCCTGGCGTGGAGGCGG - Intronic
933943263 2:87262910-87262932 CACCTGGCCTGGCACACAGGAGG - Intergenic
934043347 2:88148019-88148041 CCCTGGGCAGGGCACACAGGTGG - Intergenic
935418868 2:102846097-102846119 CCATGTGCTTGGCACATAGGAGG - Intergenic
935815597 2:106843501-106843523 CCGTGGGCCTGGCTCCCCGGGGG + Exonic
936336951 2:111598651-111598673 CACCTGGCCTGGCACACAGGAGG + Intergenic
936341685 2:111639331-111639353 CCCTGGGCCTGACACATAGTAGG + Intergenic
937098923 2:119253882-119253904 CCCAGGGCCTGGCACACAGTAGG + Intronic
937279219 2:120705855-120705877 CCGTGGGCCTGGCAGTGCGGTGG + Intergenic
937394334 2:121521382-121521404 CGGTTGGCCTGGCAGAGAGGAGG - Intronic
937436909 2:121888438-121888460 CCCAAAGCCTGGCACACAGGAGG + Intergenic
937855866 2:126671690-126671712 GCCTGGGCCTGACACACAGCTGG - Intronic
938124296 2:128660871-128660893 GCAAGGGCCTGGCACACAGTTGG - Intergenic
938181759 2:129190820-129190842 CGGTGGTCCTGGCACTCTGGTGG + Intergenic
938698410 2:133855045-133855067 CTGTGGGCCTAGCCCACAGTAGG - Intergenic
938970184 2:136424561-136424583 TCTTGTGCCTGGCACACAGGTGG - Intergenic
940040882 2:149359312-149359334 CCGAGTGCCTGGCACACAGTAGG + Intronic
940389517 2:153115672-153115694 CATTGGTCCTGGCACACAGTAGG + Intergenic
941921746 2:170857811-170857833 CAGGAGGCCTGGCACACAGTGGG - Intronic
944318315 2:198307114-198307136 CCCAGTGCCTGGCACACAGTGGG - Intronic
944614656 2:201448220-201448242 CTGTGGGGCTGGTACACAGTAGG + Intronic
946022971 2:216654311-216654333 GAGAGGGCCTGGCACACAGTAGG - Intronic
946049941 2:216854263-216854285 CCCTGGGTCTAACACACAGGAGG - Intergenic
946152425 2:217785511-217785533 CCCTGAGCCGGGGACACAGGAGG - Intergenic
946408819 2:219506543-219506565 CACAGGGCCTGGCACACAGCAGG - Intronic
946451770 2:219786000-219786022 CACTGTGCCTGGCACACAGTAGG + Intergenic
947750693 2:232530449-232530471 CCGTGGGCCTGGCACACAGGAGG + Intronic
947797123 2:232901668-232901690 GGGAGGGCCTGGCACACGGGTGG - Intronic
948465138 2:238148619-238148641 CCCCGGGCCTGGTACCCAGGTGG - Intronic
948499788 2:238383318-238383340 CCCGGGCCCTGGCACACAGTAGG + Intronic
948888099 2:240893822-240893844 GGGTGGGCCTGTCTCACAGGTGG + Intronic
948942801 2:241204474-241204496 CCCTGGGGCTGGAACACGGGTGG + Intronic
1168798534 20:628671-628693 CACAGGGCCTGGCACACAGTAGG + Intergenic
1169136250 20:3199608-3199630 TCGAGGGCCTGGCATACAGAAGG - Intronic
1170546417 20:17438843-17438865 CCCTTGGCCTGGCCCACAGGGGG - Intronic
1171186390 20:23126931-23126953 CCGTGGGCCTGGCAGACGCTGGG + Intergenic
1172038534 20:32027790-32027812 CAGAGTGCCTGGCACATAGGAGG - Intronic
1172038546 20:32027855-32027877 ACCTGGGCCTGGCACATAGTAGG + Intronic
1172620711 20:36316585-36316607 GCTGGGGCCTGGCACACAGCAGG + Intronic
1172624333 20:36338629-36338651 CCCAGGGCCTTGCACACAGGCGG - Intronic
1172628683 20:36363832-36363854 CCATCAGCCTGGCACACAGGAGG - Intronic
1172798102 20:37557184-37557206 CTCTGTGCCTGGCACATAGGTGG + Intergenic
1172832342 20:37846547-37846569 CACAGGGCCTGGCACACAGAAGG + Intronic
1172877741 20:38176207-38176229 CACAGAGCCTGGCACACAGGAGG - Intergenic
1172878593 20:38181815-38181837 CCCAGGGCCTGGCACAGAGCTGG - Intergenic
1172889973 20:38257211-38257233 TAGAGGGCCTGGCACACAGTAGG + Intronic
1173170995 20:40723754-40723776 CCCAGGGCCTGGCACATAGTAGG - Intergenic
1173388017 20:42606455-42606477 CCCAGGGCCTGGCACATAGCAGG - Intronic
1173520000 20:43692289-43692311 CCGTGGGCTGGGCACTCTGGAGG - Exonic
1173606515 20:44335920-44335942 CCCTGGGCCTGGCACATAGCAGG + Intergenic
1173691413 20:44964100-44964122 CTGGGGGCCTGGCACAGAAGTGG + Intergenic
1173839375 20:46147382-46147404 CTCAGGGCCTGGCACACAGTAGG - Intergenic
1173847025 20:46194584-46194606 CTGTGTGCCTGACACACAGTAGG - Intronic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1174378613 20:50142260-50142282 CCTCAGGCCTGGCACACAGCCGG - Intronic
1174391269 20:50219717-50219739 TCGTGGGCTTGGCACATAGTAGG + Intergenic
1174398818 20:50264859-50264881 CCTAGGGCCTGGCACCCAGGAGG + Intergenic
1174421597 20:50402540-50402562 CTGGGGACCTGGCACACAGGAGG + Intergenic
1174485238 20:50856819-50856841 CAGAGGGCCTGGCACACAGTAGG - Intronic
1174585106 20:51602339-51602361 CCTTGGGCCTGGCACTTAGTAGG - Intronic
1174591579 20:51649452-51649474 CCCAGGGCCTGGCACAGAGCAGG + Intronic
1174600996 20:51724696-51724718 CACAGGGCCTGGCACACAGCAGG + Intronic
1174677436 20:52371954-52371976 CCAAGGGCTTGGCACATAGGAGG + Intergenic
1175140493 20:56857361-56857383 ACCTGGGCCTGGCACATAGTAGG + Intergenic
1175342989 20:58246667-58246689 CCATGGGCCTGCCATACAGCAGG + Intergenic
1177868083 21:26536906-26536928 ATCTGGGCCTGGCACACAGTAGG - Intronic
1178925167 21:36768686-36768708 GAGTGGGCCTGGCACATGGGCGG - Intronic
1179388577 21:40966432-40966454 CAGAGTGCCTGGCACACATGGGG - Intergenic
1179418183 21:41215069-41215091 CCGTGGGCCTGGAGCACGGGAGG + Intronic
1179789753 21:43749608-43749630 ACGTGAGCCTGGGACCCAGGTGG - Intronic
1179922746 21:44515964-44515986 CCATGGGGCAGGCACAGAGGAGG + Intronic
1180182606 21:46124664-46124686 CCGAGGGCCTGGCTCACCAGGGG - Exonic
1180199410 21:46215563-46215585 CCTGGGGCCTGGCACAGAGGAGG + Intronic
1180594767 22:16965883-16965905 CAGTGGCCCTGGCTCACAGCAGG - Intronic
1180847274 22:18990772-18990794 CCCAGGGCCTGGCACCGAGGGGG + Intergenic
1181463922 22:23100683-23100705 CAGAGGGCCTGGCACACAGTGGG + Intronic
1181545160 22:23598360-23598382 CCGTGGGCCTGGCACTCCCTAGG + Intergenic
1181629461 22:24142987-24143009 CCCAGGGCCTGGCACACAGCAGG - Intronic
1181727707 22:24823013-24823035 CACTGAGCCTGGCACACAGTAGG - Intronic
1181766837 22:25098369-25098391 CCCTGTCCCTGGCACACTGGAGG - Intronic
1181770259 22:25120053-25120075 ACCTGTGCCTGGCACACAGCAGG - Intronic
1181815151 22:25431521-25431543 CCGTGGGCCTGGCACTCCCTAGG - Intergenic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1182026102 22:27120443-27120465 CCTAGTGCCTGGCACAGAGGAGG - Intergenic
1182041235 22:27240243-27240265 CATAGGGCCTGGCACACAGCGGG + Intergenic
1182461292 22:30485772-30485794 GCTTGGGCCTGGCTCACAGTCGG + Intergenic
1182829848 22:33296189-33296211 ACGGGGGCCTGGCACTAAGGAGG + Intronic
1183071847 22:35401679-35401701 CGCAGTGCCTGGCACACAGGTGG - Intronic
1183231145 22:36582877-36582899 AAGAGGGCCTGGCATACAGGGGG + Intronic
1183262277 22:36803457-36803479 CAGTGTTCCTGGCACACAGTAGG + Intronic
1183309613 22:37102334-37102356 CCCAGAACCTGGCACACAGGAGG + Intronic
1183325425 22:37188753-37188775 CCATGTGCCTGGCACAAAGGGGG - Intronic
1183362815 22:37391465-37391487 GCGGGGGCCTGGCACACAGCGGG - Intronic
1183431114 22:37766237-37766259 CCCAGTGCCTGGCACACAGCTGG - Intronic
1183586807 22:38757502-38757524 CGGGGGTCCTGGCAGACAGGGGG + Intronic
1183648880 22:39142387-39142409 CTCTGGGCCTGGTACACAGCAGG + Intronic
1183670182 22:39268338-39268360 ACCTGCGCCTGGCACACAGTGGG - Intergenic
1183696600 22:39427228-39427250 CTGTGTGCCTGGCACAAGGGAGG - Intronic
1183729971 22:39612874-39612896 CCGGGGACCTAGCACACAGTAGG - Intronic
1183987809 22:41578918-41578940 GCCAGGGCCTGGCACACAGCAGG - Intronic
1184101825 22:42344796-42344818 CTCTGGGCCTGGCCCACAGTAGG + Intergenic
1184188038 22:42877630-42877652 CACTGGGCCTGGCAAACAGTAGG - Intronic
1184238458 22:43199145-43199167 CTAGGAGCCTGGCACACAGGAGG + Exonic
1184277592 22:43419024-43419046 GCCAGGGCCTAGCACACAGGAGG - Intronic
1184280888 22:43436769-43436791 CCCCGTGCCTGGCACACAGCGGG - Intronic
1184341693 22:43889679-43889701 GGGAGGGCCTGGCACACAGTAGG + Intronic
1184449353 22:44573793-44573815 CACAGGGCCTGGCACACAGTTGG + Intergenic
1184472696 22:44704629-44704651 CCTGGGGCCTGGCACATAAGAGG - Intronic
1184616536 22:45641648-45641670 CCCTGGGCTTGGGACACAGAGGG + Intergenic
1184648607 22:45909340-45909362 CCTGGAGCCTGGCACACAGCAGG - Intergenic
1184797532 22:46740707-46740729 CCCTGGGTCTGACACACAGCAGG - Intergenic
1184854992 22:47141999-47142021 TAGTGGGCCCAGCACACAGGAGG - Intronic
1184901441 22:47448827-47448849 CCGTGGGCCTGCCCCAGCGGAGG + Intergenic
1184967998 22:47995576-47995598 TCACGGGGCTGGCACACAGGGGG + Intergenic
1185044769 22:48523382-48523404 CCGCGAGCCGGCCACACAGGAGG - Intronic
1185370760 22:50459872-50459894 CCGTGGCCCAGGCCCACAGCGGG + Intronic
949951386 3:9231614-9231636 CTTAGGGCCTGCCACACAGGAGG - Intronic
950139680 3:10606823-10606845 CCCAGGGCCTGGCACATAGTAGG + Intronic
950183682 3:10932310-10932332 CCCAGGGCTTGGCACGCAGGAGG - Intronic
950390964 3:12696608-12696630 CCATGTGCCTGGCATACAGTAGG - Intergenic
950444952 3:13031603-13031625 CCCTGTGCCTGGCACACAGTAGG - Intronic
950499089 3:13352721-13352743 CCGAGTGCCTGGCACACCTGTGG - Intronic
950517884 3:13479583-13479605 CCGTGGGGCTGCAACCCAGGAGG - Intergenic
950519381 3:13487523-13487545 CCCTGGACCTTGCACACAGCAGG - Intronic
950581571 3:13865777-13865799 CCTGGGGCCTGGCACACAGTAGG - Intronic
950651396 3:14409576-14409598 CCCTGTGCCTGGCACACAGTAGG - Intronic
950691499 3:14661959-14661981 CCTTCGGCCTGGCACAGAGCTGG - Intronic
950808847 3:15632329-15632351 CCCTGGGGCTGGCCCACAGTTGG + Intronic
950869263 3:16214576-16214598 CCCAGGGCCTGGCACAGAGCAGG - Intronic
951445400 3:22774093-22774115 AGGTGGACCTGGCAGACAGGTGG - Intergenic
953604740 3:44404382-44404404 ATGGGTGCCTGGCACACAGGGGG + Intronic
954463549 3:50641308-50641330 CCCAGGGCATGGCACACAGTAGG + Intronic
954649791 3:52154156-52154178 CGCAGGGCCTGGCACGCAGGAGG + Intronic
954676502 3:52318568-52318590 GCATGGGCTTGGCACACAGCTGG - Intronic
954677295 3:52323008-52323030 TCCAGGGCCTGGCACACAGCAGG - Intronic
954686328 3:52372174-52372196 CGGTGGGCCTGGTGCACAGGAGG - Intronic
954743243 3:52771209-52771231 TTGTTGGCCTGGCACATAGGCGG - Intergenic
955041874 3:55325371-55325393 CCTAGTGCCTGGCACACAGCAGG - Intergenic
955119502 3:56042393-56042415 TCGTGGGGCTGGCACATAGGAGG + Intronic
955222064 3:57031144-57031166 CTGTGTGCTTGGCACACAGTAGG - Intronic
957040460 3:75332018-75332040 CCCAGGGCCTGGCACCCATGAGG - Intergenic
959297127 3:104550542-104550564 CCTTGGACCTGGCACATAGTAGG + Intergenic
959863050 3:111236924-111236946 CAGTTTGCCTGGCACTCAGGGGG - Intronic
960965335 3:123100537-123100559 CCATGGGCCTGGCAAACAGTGGG - Intronic
961014098 3:123454189-123454211 CCTGGTGCCTGGCACATAGGAGG + Intergenic
961045243 3:123703580-123703602 CCCAGGGCCTGGCACCCATGAGG - Intronic
961196133 3:125003003-125003025 ACATGGGCCTTGAACACAGGTGG - Intronic
961371315 3:126433662-126433684 CCCTGTGCCTGGCACACAGCAGG - Intronic
961475908 3:127146219-127146241 CATAGGGCCTGGCACACAGCAGG + Intergenic
961819791 3:129570153-129570175 TCCTGGGCCTGGCACAGAGGTGG + Intronic
962370084 3:134814018-134814040 CCCGGGGCCTGGCACAGAGTAGG + Intronic
962867774 3:139461844-139461866 CCATGGGCCTGGCAGGCAGAGGG - Intronic
966869178 3:184278782-184278804 CACTGGACCTGGCACACAGTAGG - Intronic
967135436 3:186509056-186509078 CAGTGTGCCTGGCACAGAGTAGG - Intergenic
967172528 3:186833301-186833323 CATAGAGCCTGGCACACAGGAGG - Intergenic
967275945 3:187774610-187774632 ACCTGGACCTGGCAAACAGGAGG - Intergenic
967298227 3:187986479-187986501 GCATTGGCGTGGCACACAGGAGG + Intergenic
967986757 3:195100890-195100912 CCCTGTGCCTGGCACAAAGCAGG + Intronic
968522688 4:1041171-1041193 CCGTGGGCCTGCCACCCATGAGG - Intergenic
968574250 4:1357665-1357687 CAGGGTCCCTGGCACACAGGGGG - Intronic
968962020 4:3750507-3750529 CCCAGGGCCTGGCACACAGTAGG - Intergenic
969089636 4:4684241-4684263 CACAGGGCCTGGCACACAGCAGG - Intergenic
969240110 4:5892126-5892148 CCCGGGGCCCGGCACACAGTAGG + Intronic
969307664 4:6335120-6335142 CCCAGGGCCTGGCACAGAGTAGG - Intronic
969321063 4:6412894-6412916 CCGTATGCCTGGTTCACAGGTGG - Intronic
969336778 4:6515363-6515385 CCTTTGGCCTGGCACAGAGTAGG - Intronic
969342299 4:6549772-6549794 CGTAGGGCCTGGCACACAGTAGG + Intronic
969393887 4:6908716-6908738 CCCTGGGCCTGGCAAATAGTTGG - Intergenic
969396743 4:6926780-6926802 CCCAGGGCCTGGCCCACAGCAGG + Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
969521722 4:7681906-7681928 CTTCTGGCCTGGCACACAGGAGG + Intronic
969605809 4:8201773-8201795 CTCCGGGCCTGGCACACAGCTGG - Intronic
970436505 4:16040739-16040761 CACCGGGCCTGGCACACAGTGGG + Intronic
971405755 4:26320011-26320033 CCGAGGGCCTGGCACAGCCGAGG - Intronic
971570681 4:28206679-28206701 CCATGGGCCTAGTACACAGTAGG + Intergenic
972631306 4:40844240-40844262 CAGTGTGCCTGGCACACAGAGGG - Intronic
972660364 4:41110211-41110233 ACATGTGCCTGGCACGCAGGAGG + Intronic
973218125 4:47694704-47694726 CGGAGTGCCTGGCACTCAGGAGG + Intronic
973295542 4:48515999-48516021 CTGTGGGGCTGCCACACAGCAGG + Intronic
973627983 4:52791652-52791674 TCTAGGGCCTGGCACACAGTAGG + Intergenic
973846178 4:54915457-54915479 CTGTGTGCCTGGCACACATTTGG + Intergenic
975935650 4:79576583-79576605 CTGTGGGCCTTGCACAGACGAGG + Intergenic
977217620 4:94300607-94300629 ACCTGGGCATGGCACACAGTAGG - Intronic
977890728 4:102308370-102308392 CCCAGGGCCTGGCACCCAGTAGG + Intronic
981505484 4:145494678-145494700 CGGTTGGGCTGGCACACAGTAGG + Intronic
982137439 4:152285135-152285157 CATGGGGCCTGGCACACAGTAGG + Intergenic
985474648 5:72785-72807 CGGAGGCCCTGGAACACAGGAGG + Intergenic
985474664 5:72834-72856 CGGAGGCCCTGGAACACAGGAGG + Intergenic
985474679 5:72883-72905 CAGAGGCCCTGGAACACAGGAGG + Intergenic
985474723 5:73030-73052 CAGAGGCCCTGGAACACAGGAGG + Intergenic
985474827 5:73373-73395 CAGAGGCCCTGGAACACAGGAGG + Intergenic
985474844 5:73422-73444 CGGAGGCCCTGGGACACAGGAGG + Intergenic
985474875 5:73520-73542 CGGAGGCCCTGGGACACAGGAGG + Intergenic
985474904 5:73618-73640 CAGAGGCCCTGGAACACAGGAGG + Intergenic
985474920 5:73667-73689 CGGAGGCCCTGGAACACAGGAGG + Intergenic
985474936 5:73716-73738 CGGAGGCCCTGGAACACAGGAGG + Intergenic
985630860 5:1013349-1013371 CCAAGGGCCAGGCACACAGAGGG - Intronic
985918688 5:2948985-2949007 CAGTGGGGCTGGGACACTGGAGG - Intergenic
988539684 5:32097817-32097839 ACATGGGCCTGGCATCCAGGAGG - Intronic
989210739 5:38856408-38856430 CCTGGGGCCTGAAACACAGGGGG + Intronic
991899921 5:71450530-71450552 CCCTGTGCCTGGCGCACAGTGGG - Intergenic
992000635 5:72432646-72432668 CAGTGGGCTTGGCAGCCAGGTGG - Intergenic
993088388 5:83393078-83393100 CAGTGTGCCTGGCATAAAGGAGG + Intergenic
993680396 5:90870761-90870783 CCCTGGGGCTGCCACACAAGGGG + Intronic
995178321 5:109204977-109204999 ATGTGGGCCTAGCACACAAGGGG - Intergenic
995264136 5:110138722-110138744 CCCTGGGCCTGAGCCACAGGGGG - Intergenic
995540120 5:113177290-113177312 CACTGTGCCTGGCACAAAGGAGG + Intronic
997472897 5:134126477-134126499 CCTAGGGCCTGGCACACAGTAGG + Intronic
997695446 5:135857552-135857574 CCCTGTGCCTGGCACCCAGTAGG - Intronic
998081453 5:139278441-139278463 CCACAGGCCTGGCACAGAGGAGG - Intronic
998194981 5:140060989-140061011 CCCTGGGGCTGGTACACAGTTGG - Intergenic
998253900 5:140570477-140570499 CACAGAGCCTGGCACACAGGTGG - Intronic
998352402 5:141510073-141510095 CAGAGTGCCTGGCACACAGTAGG + Intronic
998397509 5:141828229-141828251 GCGTGGGCCTGGTACGCAGTAGG - Intergenic
998405430 5:141871747-141871769 CCCTGGACCTGGCACACAGTGGG + Intronic
998639814 5:143996829-143996851 CCTAGCACCTGGCACACAGGAGG - Intergenic
999088779 5:148916684-148916706 CCCAGTGCCTGGCATACAGGAGG - Intergenic
999144328 5:149382379-149382401 CCTGAGGCCTGGCACACAGCAGG - Intronic
999687963 5:154119117-154119139 CCCTGGGCCTGGGACATAGTGGG - Intronic
999693982 5:154172069-154172091 CTGTGTGCCTGGCACAGAGGTGG + Intronic
999695596 5:154186144-154186166 TCCTGGGTCTGGCACACAGTAGG - Intronic
999743754 5:154576382-154576404 CCCAGTGCCTGGCACACAGTAGG + Intergenic
1000244843 5:159440774-159440796 CCCAGGGCCTGGTACACAGTAGG + Intergenic
1000278812 5:159764270-159764292 CCCAGTGCCTGGCACATAGGAGG + Intergenic
1000957368 5:167559026-167559048 CCCAGGGCCTGGCACATAGTGGG + Intronic
1001106010 5:168855113-168855135 CACAGTGCCTGGCACACAGGAGG + Intronic
1001556483 5:172640947-172640969 AAGAGGGCCTGGCACACAGTGGG + Intergenic
1001691696 5:173638165-173638187 CTGCTGGCCTGGCACACAGTAGG + Intergenic
1002061363 5:176627787-176627809 CCCAGGGCCTGGCACAGAGTAGG - Intronic
1002182403 5:177437515-177437537 CAGTGGGCCAGGCACCCAGCAGG + Intronic
1002203589 5:177547171-177547193 GCCTGGGCCTGGCACAAAGTAGG + Intronic
1002655658 5:180744641-180744663 CCCTTCCCCTGGCACACAGGGGG - Intergenic
1002706181 5:181161998-181162020 CCTTGGGCCTGGGGCACAGCAGG - Intergenic
1002785777 6:398863-398885 CCGGGAGCCTGGGACTCAGGTGG - Exonic
1003573235 6:7269664-7269686 CTATGGGCCTGGCACATAGTAGG - Intronic
1004510084 6:16278047-16278069 CCGTGGGACAGGCAGGCAGGAGG + Intronic
1004763770 6:18701008-18701030 ACCTGGGCCCGGCACAAAGGGGG - Intergenic
1005386235 6:25287923-25287945 CCATGTGCCTGGGACACAGCAGG - Intronic
1006294510 6:33164175-33164197 CCTTGGGCAGGGCACCCAGGGGG - Intronic
1006460604 6:34155418-34155440 CCGCCGGCCTGTCACACAGAGGG - Intronic
1006514463 6:34538259-34538281 CCCTGGGCCAGGCACTCAGATGG + Exonic
1006795315 6:36728647-36728669 CCAGGAGCCTGGCACACAGTGGG + Intronic
1006920011 6:37621480-37621502 CTGTGTGCCAGGCACACAGTAGG + Intergenic
1006984880 6:38169574-38169596 CCCTGGCCCTGGCGCAGAGGAGG - Exonic
1007077615 6:39078061-39078083 CAGTGTGCCTGGCACACAGGAGG + Intronic
1007754428 6:44089796-44089818 CCTAGGGCCTGGCACATAGAAGG + Intergenic
1007754447 6:44089934-44089956 CCATGGGCTTGGCACACAGTAGG + Intergenic
1012547280 6:100433860-100433882 ACCAGGGCCTGGCACACAGTAGG + Intronic
1013969421 6:115998727-115998749 TAGAGGGCCTGGCACACAGTGGG + Intronic
1015254738 6:131165621-131165643 CCTGGGGCCTGGCACATAGTAGG + Intronic
1015941977 6:138461954-138461976 CTCAGGGCCTGGCACACAGTAGG - Intronic
1016629981 6:146217615-146217637 CCCAGTGCCTGGCACACAGTAGG - Intronic
1016979778 6:149843556-149843578 GGGTTGGCCTGGAACACAGGAGG - Intronic
1017533502 6:155321730-155321752 CAGGGTGCCTGGCACACAAGGGG + Intergenic
1017712963 6:157186369-157186391 CCGAGGGCCTGTGACACAGGAGG + Intronic
1017954087 6:159163767-159163789 TCATGGGCCAGGCACACAGGTGG + Intergenic
1018395565 6:163375599-163375621 CCCTGGAGCTGGCACCCAGGGGG + Intergenic
1019411812 7:909885-909907 CAGTGGGACCGGCACACAGTAGG - Intronic
1019511779 7:1421397-1421419 CCCGGGGCCTGGCACATAGCAGG - Intergenic
1019519371 7:1453805-1453827 CCGTGGGCCAGGCACACAGTCGG + Intronic
1019636899 7:2080887-2080909 CAGGGGACCTGGCTCACAGGCGG + Intronic
1020023856 7:4884588-4884610 CCTAGGGCCTGGCACACAGGTGG - Intergenic
1020432183 7:8125706-8125728 CCCAGTGCCTGGCACACAGTGGG + Intronic
1022199095 7:28098461-28098483 CCAAGTGCCTGGCACATAGGAGG + Intronic
1022466373 7:30655476-30655498 CCGTGGGACTGGCACACCCATGG - Intronic
1022488271 7:30797189-30797211 TGGTGGGTCTGGCACACAGTAGG - Intronic
1023518731 7:41029500-41029522 CAGTGGGCCTGGGAGACAAGGGG - Intergenic
1023742059 7:43289613-43289635 CCATTGGCCTGGCCCATAGGTGG + Intronic
1024566659 7:50687005-50687027 CCCTGAGTCTGGCACACAGCAGG + Intronic
1024581597 7:50805261-50805283 CCATGGGCCTGGGAGTCAGGAGG - Intergenic
1024971969 7:55079047-55079069 CCGTGGGCCGGGCAGGCAGCAGG + Intronic
1025028898 7:55539732-55539754 GCGTGGACCTGGGACAGAGGTGG + Intronic
1025249221 7:57340924-57340946 CTGGGGACCTGGCACACAGGAGG - Intergenic
1025254209 7:57372613-57372635 CCCAGGGCCTGGCACATAGTAGG - Intergenic
1026015156 7:66666502-66666524 CTGGGAGCCTGGCACAGAGGGGG - Intronic
1026019971 7:66698781-66698803 CCGTGGGTCTGACACAAAGCTGG - Intronic
1027170923 7:75871831-75871853 CACAAGGCCTGGCACACAGGAGG + Intronic
1028594440 7:92532574-92532596 CAGAGTGCCTGACACACAGGAGG - Intronic
1028985232 7:97004103-97004125 CTGGGGGCCAGGCACAGAGGAGG - Intergenic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1029670170 7:102024680-102024702 CATGGGGCCTGGCACACAGTGGG - Intronic
1031979383 7:128114960-128114982 CCCAGTGCCTGGCACACAGTGGG + Intergenic
1032978521 7:137253548-137253570 CTGTGGGCTGGGCACACGGGAGG - Exonic
1034164219 7:149013274-149013296 GCTGGGGCCTGGCACACAGGAGG + Intronic
1034558631 7:151865538-151865560 CCCTGTGCCTGGCACACAACAGG + Intronic
1035012310 7:155730099-155730121 CCCAGTGCCTGGCACACAGGCGG - Intronic
1035258290 7:157646105-157646127 CTGTGTGCCTGGCAAACAGTTGG - Intronic
1035288030 7:157818814-157818836 CCATGTGCCTGGCACCCAGGAGG - Intronic
1035344695 7:158190512-158190534 AGGTGGGCCTGGCACAGAGCAGG + Intronic
1036740385 8:11355873-11355895 CACAGGGCCTGGCTCACAGGAGG + Intergenic
1037841829 8:22250406-22250428 CCGTGGGCCTTGGAGACAGTAGG + Exonic
1038218346 8:25584070-25584092 CCTTGTGCCTGGCACACAGTTGG - Intergenic
1040060051 8:43096090-43096112 CCCAGTGCCTGGCACACAGCGGG - Intronic
1040974290 8:53172768-53172790 CCCTGTGCCTGGCACAGAGTAGG - Intergenic
1041121301 8:54589107-54589129 GACTGGGCCTGGCACACAGCAGG + Intergenic
1041244035 8:55874190-55874212 TCTTGTTCCTGGCACACAGGGGG + Intergenic
1042154484 8:65827933-65827955 CTGTGTGCCTGGCACATAGAAGG - Intronic
1042435361 8:68758062-68758084 CAGTGTGCCTGGCACACAGCAGG - Intronic
1042815581 8:72874769-72874791 CCGAGTCCCTGGCACACAGATGG - Intronic
1044518235 8:93165663-93165685 CAGAGTGCCTGGCACACAGTAGG + Intronic
1044866749 8:96578682-96578704 GCCTGGGGCTGTCACACAGGGGG - Intronic
1045387984 8:101689654-101689676 CCCAGGGCCGGGCACACAGTGGG - Intronic
1046357452 8:113107178-113107200 CTGGGGGCCTGGCACAGAAGTGG + Intronic
1047744916 8:127837625-127837647 CATTTAGCCTGGCACACAGGAGG - Intergenic
1047960555 8:130008550-130008572 CACGGGGCCTAGCACACAGGAGG + Intronic
1047997741 8:130352994-130353016 CCCTGGGCCTAGCACACTGCTGG + Intronic
1048140473 8:131789481-131789503 CCCTGTGCCTGGCACATGGGAGG - Intergenic
1048257280 8:132914651-132914673 GGGTGGGGCTGACACACAGGAGG + Intronic
1048812524 8:138301937-138301959 ACCAGTGCCTGGCACACAGGAGG + Intronic
1048890885 8:138945393-138945415 CCCAGTGCCTGGCACACAGTAGG - Intergenic
1049156701 8:141071626-141071648 CCCAGGGCCTTGCACACAGCAGG - Intergenic
1049159280 8:141087033-141087055 CCCAGTGCCTGGCACACAGCAGG - Intergenic
1049201174 8:141341381-141341403 CCCAGGGCCTGGCACTCAGCAGG - Intergenic
1049216593 8:141411121-141411143 CTGTGACCCTGGCATACAGGAGG - Intronic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1049574832 8:143385192-143385214 CCCTGGGGCCAGCACACAGGAGG + Intergenic
1049582043 8:143417198-143417220 TTCTGGGCCTGGCACACAGGTGG - Intergenic
1050284760 9:4089953-4089975 CCGTGGGCATGGCACACAGTGGG - Intronic
1050420010 9:5453468-5453490 CTGGGGCCCTGGCACACAGTAGG + Intronic
1050713388 9:8491793-8491815 CAGTGAGCATGGCACGCAGGAGG + Intronic
1053004844 9:34597584-34597606 CTCTAGGCCTGGCACACAGTAGG - Intergenic
1053306011 9:36985482-36985504 CATAGGGCCTGGCACACACGTGG - Intronic
1057858347 9:98620070-98620092 CCCAGAGCCTGGCCCACAGGAGG + Intronic
1057891872 9:98875738-98875760 CCCAGTGCCTGGCACACAGAGGG - Intergenic
1057942168 9:99294800-99294822 CCCAGAGCCTGGCACACAGTGGG - Intergenic
1058908308 9:109498547-109498569 CTGAGGGCCTGGCACACAGTAGG - Intergenic
1059774711 9:117463553-117463575 CCCAGTGCCTGGCACACAGTGGG - Intergenic
1060029408 9:120201428-120201450 CCTTATGCCTGGCACACAGTAGG + Intergenic
1060032152 9:120224275-120224297 CCCTGTGCTTGGCACACAGGAGG + Intergenic
1060205547 9:121680685-121680707 CCCAGTGCCTGGCACACAGTAGG - Intronic
1060214895 9:121732886-121732908 CGCTGGGCCTGGCACATAGCAGG + Intronic
1060419001 9:123454188-123454210 CAGGGTGCCTGGCACACAGTAGG + Intronic
1060429736 9:123540419-123540441 CACTGGGCCTGGTACAGAGGAGG + Intronic
1060469777 9:123938800-123938822 CACAGGACCTGGCACACAGGAGG - Intergenic
1060485547 9:124044275-124044297 CACTGGGCCTGGCACAAAGTAGG + Intergenic
1060518990 9:124283223-124283245 CCCAGGGCCTGGCACATAGTAGG + Intronic
1060543368 9:124446717-124446739 CCTGGAGCCTGGCACACAGCAGG - Intergenic
1060556633 9:124511386-124511408 CTGGGGACCTGGCACATAGGGGG - Intergenic
1060812196 9:126616050-126616072 CAGTGAGCCTGGCAGAAAGGGGG - Intronic
1060910272 9:127344070-127344092 CCATGGACCTGGTACACAGCAGG + Intronic
1061224659 9:129273862-129273884 CATGGGGCCTGGCACACAGTAGG + Intergenic
1061303908 9:129721927-129721949 CCCTGGGCCTGGCTCTCAGCAGG - Intronic
1061366840 9:130176605-130176627 CTTTGTGCCTGGCACACAGAAGG + Intronic
1061787668 9:133040159-133040181 ACGTAGGCCTGGCACAGGGGAGG - Intronic
1061882268 9:133574322-133574344 GCCAGGGGCTGGCACACAGGGGG + Intronic
1062009970 9:134261677-134261699 CAGAGGGCCAGGCACACAGGAGG - Intergenic
1062012738 9:134275698-134275720 CCAAGGGCCGGGCACCCAGGAGG + Intergenic
1062030861 9:134361366-134361388 CCAGGGGCCGGGCACACAGCAGG - Intronic
1062388673 9:136325428-136325450 CCGTGTGCCTGGCACACGGTGGG - Intergenic
1062388687 9:136325511-136325533 CCATGTGCCTGGCACACAGTGGG - Intergenic
1062462587 9:136668110-136668132 CCGTGGGGCTGTCCCACCGGTGG + Intronic
1185669041 X:1791186-1791208 CTGTGTGCTTGGCACATAGGAGG + Intergenic
1186215984 X:7301717-7301739 CCGTGGGCTTGGGAGAAAGGAGG - Intronic
1187411885 X:19058178-19058200 CCCCGTGCCTGGCACACAGTAGG - Intronic
1189319833 X:40081174-40081196 CAATGGCCCTGGCTCACAGGAGG + Intronic
1189487293 X:41443390-41443412 GCCTGGGTTTGGCACACAGGCGG - Intergenic
1190257458 X:48774213-48774235 AACAGGGCCTGGCACACAGGTGG - Intergenic
1190305093 X:49077422-49077444 TCTAGGGCATGGCACACAGGAGG + Intronic
1190523056 X:51299416-51299438 CTGTGGGCCTGGGACAGTGGTGG + Intergenic
1192270206 X:69571952-69571974 CACAGGGCCTGGCACACAGTGGG + Intergenic
1192305163 X:69951490-69951512 CCCTGGGCCTGGCACATAATAGG - Intronic
1192385879 X:70669006-70669028 CCGTAAGTCAGGCACACAGGTGG - Intronic
1194192753 X:90857701-90857723 TCCTGGGCCTGGCACACAAAGGG - Intergenic
1197772128 X:130095918-130095940 CCCTGGGCCTGGCACCTATGAGG - Intronic
1198517970 X:137427696-137427718 CACTGGGTCTGGCACACAGTAGG - Intergenic
1199822732 X:151465295-151465317 CCAAGGGCCTGGCACAGAGAAGG + Intergenic
1200177415 X:154126542-154126564 CCGTGGGCCTGGGGCAGTGGTGG + Intergenic
1200539381 Y:4440150-4440172 TCCTGGGCCTGGCACACAAAGGG - Intergenic
1201144081 Y:11053181-11053203 CCTTGGGCCAGGCCCACAGCAGG - Intergenic