ID: 947752110

View in Genome Browser
Species Human (GRCh38)
Location 2:232538608-232538630
Sequence ACTGCATCTAGGGGGACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947752110 Original CRISPR ACTGCATCTAGGGGGACCAG AGG Intergenic
900707479 1:4089681-4089703 TCTGGATCCAGAGGGACCAGGGG - Intergenic
901202069 1:7472706-7472728 ACTACTTCTAGGGGGACCCAGGG - Intronic
903779589 1:25812805-25812827 GCTGGATCTAAGGGGAGCAGTGG + Intronic
904339924 1:29828120-29828142 TCAGCATCTAGGGGAATCAGAGG + Intergenic
905311025 1:37049110-37049132 ACTGCATGGATTGGGACCAGAGG + Intergenic
905695298 1:39969225-39969247 CCTGCATCTGGGGAAACCAGTGG + Intronic
908818446 1:68057767-68057789 AATGCAGCTAGGGGGAGCAGGGG - Intergenic
915656597 1:157365851-157365873 ACTGGATCTAAGGGATCCAGAGG - Intergenic
917209773 1:172619941-172619963 ACTGGATCTAAGGGATCCAGAGG + Intergenic
917615556 1:176740154-176740176 ACTGCATCTCAGAGGACGAGGGG + Exonic
919280418 1:195482589-195482611 ACTGGATCTAAGGGATCCAGAGG - Intergenic
919812482 1:201417806-201417828 ACAGCACCTAGGGGGCACAGAGG + Exonic
920349854 1:205330535-205330557 ACTGCAGCTTGGGGTTCCAGAGG + Intergenic
922235315 1:223718075-223718097 GCTGCCACTAGGAGGACCAGGGG + Intronic
924801087 1:247330288-247330310 ACTGCATCTAGAAGTATCAGTGG + Intronic
1067219683 10:44335045-44335067 ACTGCAGCTGTGGGGACCATGGG - Intergenic
1067698510 10:48552443-48552465 AGTGCATCTGGGGGGACAAGGGG - Intronic
1075641040 10:124064762-124064784 AATGCATCTAGCAGGGCCAGTGG - Intronic
1076187704 10:128461853-128461875 ACTGTATCCGGGGGCACCAGGGG + Intergenic
1076867021 10:133172249-133172271 TCTGCATCAAGGGGGACTCGCGG - Intronic
1077080424 11:722449-722471 ACGGCATCTCGGGAGAGCAGTGG - Exonic
1079417378 11:20252187-20252209 ACTCCATCTAGAGGCTCCAGGGG + Intergenic
1081673221 11:44953293-44953315 AGTGCTTGGAGGGGGACCAGGGG + Intergenic
1082659611 11:55894468-55894490 ACTGGATCTAAGGGATCCAGAGG + Intergenic
1083740878 11:64711304-64711326 ACAGCTTCTAGAGGGACCAGGGG + Intronic
1085316082 11:75545680-75545702 ACTGCACTGAGGGAGACCAGAGG + Intergenic
1085767225 11:79293802-79293824 ACTGCAGCCACAGGGACCAGAGG + Intronic
1091996815 12:5000399-5000421 ACTGCCTCAAGGGGCACCACTGG + Intergenic
1098436714 12:70475877-70475899 ACTGGATCTAAGGGATCCAGAGG + Intergenic
1099395350 12:82131799-82131821 ACTGCATGTCGGGGGGCCGGGGG - Intergenic
1100085017 12:90900131-90900153 ACTGCATCTAGAGGAAAAAGAGG + Intergenic
1102519956 12:113471919-113471941 GCTGCACGTAGGGGGCCCAGCGG + Exonic
1103731916 12:123033378-123033400 ACTGCAGCAAGTGGGAGCAGTGG + Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104113442 12:125725688-125725710 AGTGCATAAAGTGGGACCAGGGG - Intergenic
1104661228 12:130612749-130612771 TCTGCATCCAGGGGGGCCTGCGG - Intronic
1111132855 13:83999253-83999275 ACTGGATCTAAGGGATCCAGAGG + Intergenic
1112458746 13:99584574-99584596 ACTGCAGCTGGTGGGGCCAGTGG - Intergenic
1113816632 13:113176097-113176119 CCTGCATCCAGGGGAACCTGAGG + Intergenic
1118012116 14:61620421-61620443 ACAGCATCTAGGGAGGCCTGTGG + Intronic
1118057394 14:62094372-62094394 GCTGCATTTAGGGGGAAGAGGGG - Intronic
1120850057 14:89161888-89161910 TCTGCTCCTAGGGGGACGAGGGG + Exonic
1123945690 15:25237785-25237807 TCACCATCTAGGGGGACTAGAGG - Intergenic
1124439803 15:29677744-29677766 ACTGCTTCTGGGAAGACCAGAGG + Intergenic
1125467309 15:39966538-39966560 ACTGAATTTTGGGGGACCGGAGG + Intronic
1128170015 15:65503471-65503493 ACTCCAGCTAGGGTGACCAAGGG - Intronic
1129053387 15:72801103-72801125 AGTGCATCTAGGGGAAAGAGCGG + Intergenic
1130276426 15:82478688-82478710 ACTCCAGCCAGGGGGACAAGAGG + Intergenic
1130433673 15:83874640-83874662 TCTGCATCTAGGGAGACCATCGG - Intronic
1130468794 15:84206083-84206105 ACTCCAGCCAGGGGGACAAGAGG + Intergenic
1130476284 15:84320634-84320656 ACTCCAGCCAGGGGGACAAGAGG + Intergenic
1130495481 15:84467496-84467518 ACTCCAGCCAGGGGGACAAGAGG - Intergenic
1130591088 15:85210682-85210704 ACTCCAGCCAGGGGGACAAGAGG + Intergenic
1132878683 16:2151501-2151523 AGTGAAGCTAGTGGGACCAGAGG + Intronic
1142061400 16:88032207-88032229 ACTCCATCTCGGGGGTACAGGGG - Intronic
1145791454 17:27630230-27630252 AGTGCATCTAGGTGGAGCACAGG + Exonic
1146653503 17:34621716-34621738 ACTGCAGCCTGGGGGCCCAGTGG + Intronic
1147308520 17:39579810-39579832 GGGGCATGTAGGGGGACCAGAGG - Intergenic
1155784628 18:29880881-29880903 ACTGGATCTAAGGGATCCAGAGG - Intergenic
1157332948 18:46716639-46716661 CCTGGATCTAGGGGATCCAGAGG + Intronic
1157898076 18:51487295-51487317 GCTGAATCAAGGGGGAACAGGGG - Intergenic
1161353940 19:3808916-3808938 ACTGCATCCCCGGGGCCCAGGGG + Exonic
1161704427 19:5812504-5812526 ACTGCGTCTGCGGGGGCCAGAGG - Intergenic
1163685095 19:18708142-18708164 ACAGCATATATGGGGCCCAGAGG + Intronic
1163962643 19:20711706-20711728 ACAGCATCTAGTGGGCCCACCGG - Intronic
1164981751 19:32619547-32619569 ACAGAATCTAGGGGGACAAGGGG + Exonic
1165029786 19:32989495-32989517 ACTGCCTCTAGGGCGTACAGAGG + Intronic
1165158736 19:33803595-33803617 ACTGCTCCTAGGCAGACCAGAGG - Intronic
1165994856 19:39836798-39836820 ACTGGAGGGAGGGGGACCAGTGG - Intronic
929178949 2:39011943-39011965 AATTCAGCTAGAGGGACCAGGGG + Intronic
931123794 2:59251305-59251327 ACTGTATCTATAGGAACCAGAGG + Intergenic
934562162 2:95318992-95319014 ACAGCATCTCCAGGGACCAGGGG + Intronic
935418699 2:102844656-102844678 ACTGCCTCTAGGAAGACCAGAGG + Intergenic
935722291 2:105990150-105990172 AGTGCATAAAGTGGGACCAGGGG - Intergenic
935722818 2:105994705-105994727 AGTGCATAAAGTGGGACCAGGGG - Intergenic
937142947 2:119617702-119617724 ACTGGATGTAGGGGAACCTGTGG - Intronic
938593309 2:132761387-132761409 CCTGGAGCTAGGGTGACCAGTGG - Intronic
943966632 2:194342346-194342368 GCTTCATCCAGGAGGACCAGGGG - Intergenic
945740999 2:213660968-213660990 AGTGCATAAAGTGGGACCAGGGG - Intronic
947752110 2:232538608-232538630 ACTGCATCTAGGGGGACCAGAGG + Intergenic
1169477118 20:5941691-5941713 CCTGCATCCAGTGGGACCACAGG + Intronic
1170676189 20:18483072-18483094 ACTCCATCTCGGGGGGCGAGGGG - Intronic
1170679957 20:18517662-18517684 ACTGCTTCTAGCGGGATTAGGGG + Intronic
1172223085 20:33286979-33287001 TCTGCATTCAGGGGGACTAGGGG + Intronic
1176231863 20:64037007-64037029 ACTCCATCCTGGGGGCCCAGGGG + Intronic
1177001195 21:15615223-15615245 ACTGCAGGTAGGGGGATGAGAGG + Intergenic
1177793731 21:25749796-25749818 ACTGCATCTTGGGCAACAAGAGG + Intronic
1180614578 22:17119439-17119461 ACTGCATCTCGGAGAACGAGGGG - Exonic
951345863 3:21546620-21546642 ACTGGATCTAAGGGATCCAGAGG + Intronic
952637170 3:35546117-35546139 ACTGGATCTAAGGGATCCAGAGG - Intergenic
954454099 3:50587722-50587744 AATGCATTTCTGGGGACCAGGGG + Intergenic
955575974 3:60363757-60363779 ACTGAAGCCAGGGGGGCCAGGGG - Intronic
958744226 3:98113545-98113567 ACTGGATCTAAGGGATCCAGAGG + Intergenic
961724861 3:128921100-128921122 AGTGCATAAAGTGGGACCAGGGG - Intronic
964304264 3:155324522-155324544 ACTGGATCTAAGGGATCCAGAGG + Intergenic
966523636 3:180898840-180898862 ACTGGATCTAAGGGATCCAGAGG + Intronic
971119109 4:23684292-23684314 ATTGCCTCTAGTGGGAGCAGGGG + Intergenic
971910903 4:32796534-32796556 ACAGCATCTAGAGGGATCATAGG - Intergenic
971963211 4:33516593-33516615 AGTGCATAAAGTGGGACCAGGGG + Intergenic
972316938 4:37935538-37935560 ACTGTATCTTGGGTTACCAGAGG - Intronic
972948686 4:44290886-44290908 ACTACACCTAGAGGAACCAGGGG + Intronic
973846840 4:54921493-54921515 ACAGCACCAAGGGGGACAAGGGG - Intergenic
974561222 4:63521610-63521632 AGTGCATAAAGTGGGACCAGGGG - Intergenic
975152542 4:71036701-71036723 GCTGCTTCTAGCGGGATCAGGGG - Intergenic
975614282 4:76230966-76230988 ACTGGATCTAAGGGATCCAGAGG - Intronic
976255896 4:83100384-83100406 TCTGCTTCTAGGGAGACCTGTGG - Intronic
979500697 4:121436718-121436740 ACTGGATCTAAGGGATCCAGAGG + Intergenic
980607703 4:135113674-135113696 AGTGCATCTAGGGTGAGAAGAGG + Intergenic
982973808 4:162026339-162026361 ACTCCAGCTTGGGGGACAAGAGG - Intronic
984283886 4:177705685-177705707 ACTGCCTATAGATGGACCAGAGG - Intergenic
984644544 4:182205503-182205525 ACTGCACCTGGGGGGCCCTGAGG - Intronic
985611987 5:894306-894328 ACTGCAGCAAGGGGGACCAAGGG + Intronic
985635406 5:1033356-1033378 AGTGCCACTAGGGGGACAAGAGG - Exonic
986213683 5:5698359-5698381 ACTGGATCTAAGGGATCCAGAGG + Intergenic
988193177 5:27964986-27965008 AGTGCATAAAGTGGGACCAGGGG - Intergenic
989167448 5:38445760-38445782 ACCGCATGCAGGGGGACCCGGGG + Intronic
994505722 5:100641140-100641162 ACTGAATCTAAGGGATCCAGAGG + Intergenic
995393588 5:111664379-111664401 ACTGGATCTAAGGGATCCAGAGG - Intronic
1000270928 5:159682468-159682490 TCTGCATCTAGGGAGACCTCAGG + Intergenic
1003065582 6:2901820-2901842 AGTGGCTCTAGGGAGACCAGAGG - Intronic
1003086604 6:3065425-3065447 AGTGGCTCTAGGGAGACCAGAGG + Intronic
1003684695 6:8290378-8290400 ACTGTATCTTGGGGGAAAAGGGG - Intergenic
1003880729 6:10477358-10477380 ACTTCATCTGGGGGGAGGAGGGG + Intergenic
1010669924 6:78675111-78675133 ACTGTATCTAAGGGATCCAGAGG - Intergenic
1020555529 7:9664925-9664947 ACTGGATCTAAGGGATCCAGAGG - Intergenic
1022617494 7:31946729-31946751 AGTGCATAAAGTGGGACCAGGGG - Intronic
1023626333 7:42118701-42118723 GCTGCAGCCAGGGGGCCCAGTGG + Intronic
1024491435 7:49990096-49990118 ACTGGATCTAAGGGATCCAGAGG + Intronic
1025867114 7:65393019-65393041 ACTGCAGCTTGGGTGACAAGTGG + Intronic
1027190630 7:75993976-75993998 GCTGCATCAAGGAGAACCAGGGG - Intronic
1032463234 7:132127009-132127031 GCTGCATCTGGGGGGACTTGTGG + Exonic
1032529825 7:132610854-132610876 ACTGCCTCTTGGAGGAGCAGAGG + Intronic
1033220995 7:139526028-139526050 ACTGCTCCTGGGGAGACCAGGGG - Intronic
1038101648 8:24384250-24384272 ACTGCTTATAGGAGCACCAGGGG + Intergenic
1042999638 8:74742128-74742150 ACTGCAACTGGGGGGACAGGAGG - Intronic
1044175956 8:89122614-89122636 ACTGCATTTAGGGTGACTAATGG - Intergenic
1044574718 8:93755191-93755213 ACTCCATTTACGGGGACTAGGGG - Intronic
1049292578 8:141812548-141812570 GCTGCCTCTTGGGGGAACAGAGG + Intergenic
1051739855 9:20240733-20240755 ACTGCATTTAGGGTGAGCAAAGG + Intergenic
1056037548 9:82623111-82623133 CATGAATTTAGGGGGACCAGAGG + Intergenic
1058127119 9:101207792-101207814 AGTGCTTCTGGGGGGACTAGAGG + Intronic
1058282080 9:103128109-103128131 ACTGGATCTCGGGGATCCAGAGG - Intergenic
1060391535 9:123281609-123281631 ACTGCATGTGGGTGGTCCAGTGG - Intergenic
1188803649 X:34560779-34560801 ACTGGATCTAAGGGATCCAGAGG - Intergenic
1189006249 X:36998670-36998692 ACTGGATCTAAGGGATCCAGAGG + Intergenic
1190059397 X:47201201-47201223 ACTACATCTTGAGGGACCCGTGG + Intronic
1192261067 X:69506016-69506038 ACTGTATCGAGGCGTACCAGCGG + Exonic
1192681183 X:73255302-73255324 ACTGGATCTAAGGGATCCAGAGG - Intergenic
1196520395 X:116664554-116664576 ACTGTATCTAAGGGATCCAGAGG - Intergenic
1196563369 X:117177154-117177176 ACTGGATCTAAGGGATCCAGAGG + Intergenic
1201319646 Y:12683755-12683777 ACTCCATCTTGGGGGGCGAGGGG + Intergenic