ID: 947752323

View in Genome Browser
Species Human (GRCh38)
Location 2:232539567-232539589
Sequence ACAGCGTTGTCAGCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947752323_947752328 -4 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752328 2:232539586-232539608 CTGTGGTCAGACAGCTGGTGGGG 0: 1
1: 0
2: 6
3: 47
4: 332
947752323_947752336 23 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752336 2:232539613-232539635 GCCAGGCTGGCCGGGCTGGCTGG 0: 1
1: 1
2: 19
3: 162
4: 1863
947752323_947752339 28 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752339 2:232539618-232539640 GCTGGCCGGGCTGGCTGGGCTGG 0: 2
1: 8
2: 56
3: 676
4: 2238
947752323_947752334 15 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752334 2:232539605-232539627 GGGGCTGGGCCAGGCTGGCCGGG 0: 1
1: 2
2: 22
3: 247
4: 2544
947752323_947752331 6 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752331 2:232539596-232539618 ACAGCTGGTGGGGCTGGGCCAGG 0: 1
1: 0
2: 6
3: 110
4: 751
947752323_947752335 19 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752335 2:232539609-232539631 CTGGGCCAGGCTGGCCGGGCTGG 0: 1
1: 0
2: 12
3: 106
4: 844
947752323_947752329 0 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752329 2:232539590-232539612 GGTCAGACAGCTGGTGGGGCTGG 0: 1
1: 0
2: 7
3: 54
4: 386
947752323_947752326 -6 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752326 2:232539584-232539606 CGCTGTGGTCAGACAGCTGGTGG 0: 1
1: 0
2: 3
3: 16
4: 184
947752323_947752327 -5 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752327 2:232539585-232539607 GCTGTGGTCAGACAGCTGGTGGG 0: 1
1: 0
2: 2
3: 41
4: 286
947752323_947752330 1 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752330 2:232539591-232539613 GTCAGACAGCTGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 30
4: 338
947752323_947752333 14 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752333 2:232539604-232539626 TGGGGCTGGGCCAGGCTGGCCGG 0: 1
1: 0
2: 10
3: 126
4: 1011
947752323_947752338 24 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752338 2:232539614-232539636 CCAGGCTGGCCGGGCTGGCTGGG 0: 1
1: 0
2: 8
3: 177
4: 1830
947752323_947752325 -9 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752325 2:232539581-232539603 CAACGCTGTGGTCAGACAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 133
947752323_947752332 10 Left 947752323 2:232539567-232539589 CCTGGAACAGCTGACAACGCTGT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 947752332 2:232539600-232539622 CTGGTGGGGCTGGGCCAGGCTGG 0: 1
1: 2
2: 14
3: 138
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947752323 Original CRISPR ACAGCGTTGTCAGCTGTTCC AGG (reversed) Intergenic
908181103 1:61606821-61606843 AGAGCCTTGCCGGCTGTTCCTGG + Intergenic
909528507 1:76654737-76654759 CCAGCCTTGTCAGCTGTTCTTGG - Intergenic
918850191 1:189678247-189678269 ACAGCTGTGTAAGCTGCTCCAGG - Intergenic
921474389 1:215588936-215588958 TCAGCATTGTCATCTGTTCAAGG + Intronic
921692810 1:218171348-218171370 ACAGGGATGTTAGCTGTTTCAGG - Intergenic
922050345 1:221983394-221983416 AGAGAGTTGTCATGTGTTCCAGG - Intergenic
1067561674 10:47308927-47308949 ACAGCCATGTCAGCAGTCCCAGG - Intronic
1070389279 10:75954573-75954595 GCAGCCTTGGCAGCTGTTCCTGG + Intronic
1071486345 10:86104928-86104950 ACAGCCTTGTCACCTGCTGCAGG - Intronic
1071677481 10:87668771-87668793 ACAGCGTTAAGAGCTGTGCCAGG + Intronic
1072552436 10:96489037-96489059 ACAGCGCTCTTTGCTGTTCCTGG - Intronic
1072915437 10:99534944-99534966 ACAGCGTCCTTAGCTGTTCCCGG - Intronic
1073331462 10:102672729-102672751 GCAGAGTTGGCAGCTGTCCCGGG - Intergenic
1076250023 10:128978195-128978217 TCAGGGTTGTCAGCTCTGCCAGG - Intergenic
1077199606 11:1299067-1299089 ACAGCTGTGAGAGCTGTTCCCGG + Intronic
1078345247 11:10541894-10541916 GCAGCAGTGTCAGCTGTACCTGG - Intergenic
1078662244 11:13296933-13296955 ACAGTGTTGTCAGGAGTTCTTGG + Intronic
1079721201 11:23816766-23816788 TGAGCGTCGTCAGCTTTTCCAGG + Intergenic
1084994614 11:72963893-72963915 ACAGAGTTGTCATCTAATCCAGG - Intronic
1087152589 11:94872081-94872103 ACAGTGTTGTCAGGTTTTTCCGG + Exonic
1087990252 11:104740406-104740428 CCACCGTTTTCAGGTGTTCCTGG + Intergenic
1092207845 12:6626877-6626899 GCATGGTAGTCAGCTGTTCCTGG + Intronic
1094091006 12:26649741-26649763 ACAGCATTATCAGATGTTACAGG + Intronic
1101850999 12:108402172-108402194 ACAGTGTTGTCAGCTCAGCCAGG + Intergenic
1102904931 12:116667227-116667249 TTAAAGTTGTCAGCTGTTCCTGG - Intergenic
1109222973 13:59659267-59659289 ACAGTGTTGTCAGCTCTACTAGG - Intergenic
1111102397 13:83605326-83605348 ATAGTGTTGGCATCTGTTCCTGG - Intergenic
1115128441 14:30024549-30024571 ACAGGGATGTGATCTGTTCCAGG + Intronic
1116937798 14:50759936-50759958 CCAGGCTTGTCAGCTGCTCCTGG + Exonic
1135247427 16:20869039-20869061 CCAGCGCTGGCCGCTGTTCCTGG + Intronic
1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG + Intergenic
1141445966 16:84058513-84058535 ACAGCTCTGACAGCTGTCCCTGG + Intronic
1142167806 16:88602173-88602195 CCTGCTTTGCCAGCTGTTCCAGG - Intronic
1142240719 16:88943607-88943629 ACAGGGTGGTCAGATGGTCCTGG + Intronic
1146619697 17:34387788-34387810 ACAGGCTTCTCAGCTGTGCCTGG - Intergenic
1153893449 18:9538884-9538906 ACATCGTGCTGAGCTGTTCCCGG + Intergenic
1159616504 18:70586120-70586142 ACAGCTTTGCCAGGTATTCCTGG - Intergenic
1165169630 19:33882600-33882622 ACAGCCATGTTAGCTGGTCCAGG - Intergenic
1166910056 19:46148082-46148104 ACAGCTTAGTAAGATGTTCCTGG - Intronic
925030613 2:647847-647869 GCTGCATTGTCAGCTGCTCCCGG + Intergenic
926080620 2:9983254-9983276 ACAGCTTTGTCACCTTCTCCTGG + Intronic
929563545 2:42970354-42970376 ACACCTTGGTCAGCTGCTCCAGG - Intergenic
929597348 2:43184546-43184568 ACGGTGGTGTCTGCTGTTCCGGG - Intergenic
930030929 2:47057555-47057577 ACAGCTTAATCAGCTGTGCCAGG + Intronic
930695705 2:54409856-54409878 TCAGTATTTTCAGCTGTTCCAGG + Intergenic
931751217 2:65331749-65331771 ACAGCAGTGTCAGCTCTCCCAGG - Intronic
931784739 2:65608790-65608812 ACAGCATTGTCAGCCAGTCCTGG + Intergenic
935756234 2:106278058-106278080 AAAGCCTTTTCAGCTCTTCCTGG + Intergenic
937791812 2:125969903-125969925 ACAGTGTATTCGGCTGTTCCTGG - Intergenic
942974206 2:181995556-181995578 ACATCATTGTCAGTTGTTCTGGG + Intronic
947752323 2:232539567-232539589 ACAGCGTTGTCAGCTGTTCCAGG - Intergenic
948877369 2:240836799-240836821 ACAGCGTGGGCAGCTCTGCCGGG + Intergenic
1170074841 20:12408394-12408416 CCAGCCTTTTCAGCAGTTCCTGG + Intergenic
1176293150 21:5056692-5056714 ACAGTGGTGACAGCCGTTCCGGG - Intergenic
1179864110 21:44206958-44206980 ACAGTGGTGACAGCCGTTCCGGG + Intergenic
1184317592 22:43708774-43708796 ACAGATTTGTCATATGTTCCTGG - Intronic
949824889 3:8154972-8154994 ACAGCTTTGTCACCATTTCCTGG - Intergenic
950515066 3:13459835-13459857 CCAGTGTTGTCAGCTGCTCATGG - Intergenic
951736620 3:25873282-25873304 TCTGCGTTTTCAGTTGTTCCAGG + Intronic
954360728 3:50121498-50121520 ACAGCCATGACAGCTGCTCCTGG - Intergenic
954971482 3:54654963-54654985 TCTGCTTTGTCAGCTATTCCTGG - Intronic
957118051 3:76052211-76052233 ACAGAATTGGCAGCTCTTCCTGG - Intronic
957447615 3:80335212-80335234 ACAGCGAAGTCATCTGGTCCTGG + Intergenic
965074088 3:163953923-163953945 ACGGAGTTCTCACCTGTTCCTGG + Intergenic
965670151 3:171139760-171139782 ACATCGCAGTCAGCTGTTGCAGG - Intronic
968489607 4:882990-883012 AGAGCTCAGTCAGCTGTTCCTGG + Intronic
969651238 4:8469539-8469561 ACACAGATGTCAGCTGTGCCTGG + Intronic
975271651 4:72442359-72442381 ACAGCTTTGTCATCTGCTTCTGG + Intronic
975762183 4:77631343-77631365 ACAGTGATGACACCTGTTCCAGG + Intergenic
976818419 4:89176708-89176730 ACAGAGTTGACACCTATTCCAGG - Intergenic
990361328 5:55023319-55023341 AATGCATTGTCATCTGTTCCTGG + Intergenic
1003151145 6:3550117-3550139 ACAGATTTGGCAGCTGTTTCTGG - Intergenic
1004537784 6:16519623-16519645 GCATCGTGGTCAGCTGCTCCTGG - Intronic
1006901579 6:37505861-37505883 ACACTGTTGCCAGCAGTTCCAGG - Intergenic
1008086883 6:47254634-47254656 ACAGTGTGCCCAGCTGTTCCAGG + Intronic
1008114113 6:47527675-47527697 ACTATGTTGTCAGCTGTGCCAGG + Intronic
1011495504 6:87933407-87933429 ACAACGTTGTCTGATGTTCAGGG - Intergenic
1021197450 7:17688954-17688976 ACTACGTTGTCCTCTGTTCCTGG - Intergenic
1026953655 7:74363592-74363614 ACAGTGTTGTCAGCTGGGCGCGG + Intronic
1027185195 7:75966922-75966944 ACAGAGGTGGCAGCTGTCCCAGG - Intronic
1028419026 7:90611598-90611620 TCAGCTTTGTCATCTCTTCCTGG + Intronic
1036280376 8:7395296-7395318 ACAGTGCTGTCAGTGGTTCCTGG - Intergenic
1036341093 8:7916274-7916296 ACAGTGCTGTCAGTGGTTCCTGG + Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1056634624 9:88321265-88321287 ACAGTGTCCTCAGCTGGTCCGGG - Intergenic
1056790328 9:89621191-89621213 ACAGGGCTGTCTGCTGTTGCAGG - Intergenic
1058109677 9:101018499-101018521 AGAGGGGTGACAGCTGTTCCAGG + Intergenic
1058717183 9:107733213-107733235 CCAGCGTTGTAATCTGTTTCAGG + Intergenic
1062003359 9:134227728-134227750 AGAGCGTTGGAAGCTGCTCCTGG + Intergenic
1203654596 Un_KI270752v1:10791-10813 ACAGGATTTTCAGCCGTTCCAGG + Intergenic
1193923875 X:87462576-87462598 ACAGCTATGTCAGCTGATACTGG - Intergenic