ID: 947752521

View in Genome Browser
Species Human (GRCh38)
Location 2:232540308-232540330
Sequence CAGTCCCCACAGGCCACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947752521_947752525 -9 Left 947752521 2:232540308-232540330 CCATTGGTGGCCTGTGGGGACTG 0: 1
1: 0
2: 1
3: 30
4: 197
Right 947752525 2:232540322-232540344 TGGGGACTGGCACTGAAGTCGGG 0: 1
1: 0
2: 2
3: 11
4: 214
947752521_947752527 -7 Left 947752521 2:232540308-232540330 CCATTGGTGGCCTGTGGGGACTG 0: 1
1: 0
2: 1
3: 30
4: 197
Right 947752527 2:232540324-232540346 GGGACTGGCACTGAAGTCGGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
947752521_947752524 -10 Left 947752521 2:232540308-232540330 CCATTGGTGGCCTGTGGGGACTG 0: 1
1: 0
2: 1
3: 30
4: 197
Right 947752524 2:232540321-232540343 GTGGGGACTGGCACTGAAGTCGG 0: 1
1: 0
2: 0
3: 21
4: 210
947752521_947752526 -8 Left 947752521 2:232540308-232540330 CCATTGGTGGCCTGTGGGGACTG 0: 1
1: 0
2: 1
3: 30
4: 197
Right 947752526 2:232540323-232540345 GGGGACTGGCACTGAAGTCGGGG 0: 1
1: 0
2: 0
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947752521 Original CRISPR CAGTCCCCACAGGCCACCAA TGG (reversed) Intronic
900687545 1:3958354-3958376 CAGTAGCCACAGGCCACTTAGGG - Intergenic
903559944 1:24219786-24219808 CACTCTCCACAGGCAACCAGAGG + Intergenic
907418824 1:54332834-54332856 CAGTGCCCACAGGGGACCAGAGG + Intronic
908682874 1:66682118-66682140 CAGGTCCCACAGGCCCCCCAGGG + Exonic
909376448 1:74947608-74947630 GAGGCACCACAGGCCACCCAGGG + Intergenic
912518014 1:110227914-110227936 CAGGCCCCACAGGCACCCCAGGG - Intronic
913942296 1:125119739-125119761 CAGCCCCCGCAGGCTGCCAAGGG - Intergenic
914249367 1:145908871-145908893 CAGGCCCCAGGGACCACCAAGGG + Intronic
914745552 1:150498585-150498607 CAGTCCCCCCAGACCACCAGAGG - Exonic
914902718 1:151720208-151720230 CAGTCACCACAAGCCACCTGTGG - Intronic
915839028 1:159200947-159200969 CAGTCCCCACAGGGCCCCTGGGG - Exonic
917929728 1:179814858-179814880 CAGTCCCCACAAGCCACCTTAGG - Exonic
918372375 1:183874013-183874035 CATTCCCCACAGTCCAAGAAGGG - Intronic
921104155 1:211959379-211959401 CAGGCCCCCCAGGACACCCAAGG - Intronic
921254323 1:213325592-213325614 CAGACCCCTCAGGCCCCCCAGGG - Intergenic
924776033 1:247114862-247114884 AAGTCCCCACAGGCCAGCCCTGG - Intergenic
924954670 1:248914819-248914841 CAGGCCCCACAGGACTCCACAGG - Intronic
1065862382 10:29882785-29882807 AAGCCCACTCAGGCCACCAAGGG - Intergenic
1066815470 10:39403923-39403945 CTTTCCCCATAGGCCACAAAAGG - Intergenic
1068416712 10:56733394-56733416 CATTCCCGACAGTCCCCCAAAGG + Intergenic
1069917379 10:71795928-71795950 CAGGCCCCACAGGACAGGAAGGG - Exonic
1072191601 10:93080702-93080724 CTGACCCCATAGACCACCAAGGG - Intergenic
1073181020 10:101583249-101583271 CAGTCTCCCCAGACCAGCAAGGG - Intronic
1073458890 10:103654168-103654190 CAATCCCATGAGGCCACCAATGG + Intronic
1076250162 10:128978881-128978903 CTGTCCCCACTGGGCAGCAATGG + Intergenic
1076517881 10:131059451-131059473 CAGTCCCCAGAGGCTACATATGG + Intergenic
1076734564 10:132452900-132452922 CAGTGCCCACAGCCCACCTAGGG + Intergenic
1077022813 11:426754-426776 CAGTGCCCCCAAGCCACCAGGGG - Intronic
1077101073 11:822642-822664 CACTCCTCACTGGGCACCAAGGG + Intronic
1077189989 11:1251948-1251970 CAGTCCCCACTGGCCACACTTGG + Intronic
1077190026 11:1252088-1252110 CAGTCCCCACTGGCCACACTCGG + Intronic
1077266617 11:1653870-1653892 CAGTCCCCAGAGGCCATCTCTGG - Intergenic
1077411302 11:2405154-2405176 GAGTCCCCACAGGCCAGCCTGGG + Intronic
1077975690 11:7246218-7246240 CAGTCCCTGCTGGCCACCAGTGG + Intronic
1085030681 11:73269245-73269267 CAGTGCCCACAGGCAACGGAGGG + Intronic
1085756122 11:79202642-79202664 GAGTCCCCAGGGGCCACCACTGG - Intronic
1086021020 11:82229528-82229550 CAGCCCCTAGAGGTCACCAATGG - Intergenic
1086113082 11:83219552-83219574 CTGTCCCCACTTGCCATCAAAGG + Intronic
1088094316 11:106080312-106080334 CAGTCCCCAGTGGATACCAACGG + Intronic
1088828019 11:113512170-113512192 AAGTCCTCACAGGCCATTAAGGG + Intergenic
1089556811 11:119319671-119319693 CTGTCCCCAGAGGCCATGAAGGG + Intronic
1091477530 12:790484-790506 CAGTACCCATAGACAACCAAGGG - Intronic
1092298037 12:7217713-7217735 CAGCCAGCCCAGGCCACCAAGGG - Intronic
1094436758 12:30429502-30429524 CAGTCCCCCAATTCCACCAAGGG - Intergenic
1101659420 12:106752783-106752805 TATTCCCCACAGGCCACAGAGGG - Intronic
1101894126 12:108742270-108742292 CAGCCTCCACACGCCACCACAGG + Intergenic
1102260900 12:111442730-111442752 CAGCCCCCAGAAGCCACCATGGG - Intronic
1104544939 12:129702011-129702033 CAGCCCCCTCATGCTACCAATGG - Intronic
1104805274 12:131585969-131585991 CAGTCCCCAGAGTCCACCCCAGG + Intergenic
1105069552 12:133226390-133226412 CAGTCCCCACAGACCACCCAAGG - Exonic
1106136928 13:26980372-26980394 GAGTCCACACAGGCCACCTCTGG + Intergenic
1107572537 13:41678111-41678133 AAGTCCCCAGAGGCCCACAATGG - Intronic
1107778242 13:43871282-43871304 CAGTTCCAACAGACCTCCAATGG + Intronic
1113581211 13:111430819-111430841 CATTCCACAGAGGCCACCCAAGG - Intergenic
1119590634 14:75884327-75884349 CTAGCCACACAGGCCACCAAGGG - Intronic
1122117450 14:99534998-99535020 CCTTCCCCACAGCCCACAAAGGG + Intronic
1122119395 14:99543897-99543919 CAGTGCCCACAGCCCACAAATGG + Intronic
1122549870 14:102544153-102544175 CAGCCCCCAGATGCCAGCAAAGG + Intergenic
1122635683 14:103128607-103128629 CTGAGCCCACAGGCCACCCAAGG - Intronic
1123105025 14:105837282-105837304 CAGTGTCCACAGGCCACAGAGGG + Intergenic
1124252152 15:28113935-28113957 CAGTACCCACAGGACACCCCAGG + Intronic
1128879402 15:71229346-71229368 CAATCCCCACTGCACACCAAGGG - Intronic
1129361654 15:75028309-75028331 CAGACCCCACATGGAACCAAAGG + Exonic
1130931087 15:88428457-88428479 CAGTCCCCACAAGCTACAGATGG + Intergenic
1131218241 15:90558363-90558385 CACTCCCCACAGTCCTCCAGCGG + Intronic
1133415558 16:5604445-5604467 CAGACCCTAGAGGCCACCTACGG + Intergenic
1137507480 16:49066857-49066879 CATTCCCCAGAGGTAACCAAAGG + Intergenic
1138685462 16:58721415-58721437 CAGCCCCCACAGTCCACCCATGG + Intronic
1139686068 16:68604692-68604714 CAGGCCTCACATGTCACCAAGGG - Intergenic
1141834548 16:86530131-86530153 CTGTCCCCACAGGCCTCCCTGGG + Intergenic
1143461481 17:7107141-7107163 CTGTCCCCTCAGGCTCCCAAAGG - Exonic
1145252438 17:21303991-21304013 GAGTCCCCACAGACCAGCATGGG - Intronic
1146115868 17:30138342-30138364 CAGTCCCCCAAGGACACCAAGGG - Intronic
1147675392 17:42201921-42201943 CAAGCCCCACAGGCCACCAGGGG + Intronic
1148201035 17:45750213-45750235 TAGACCCCACAGGCCTCCAGAGG + Intergenic
1148444912 17:47731650-47731672 GAGTCCCCATAGGCCCCTAAGGG + Intergenic
1151032601 17:70758488-70758510 CAGTTCCCACATCCCACCCATGG - Intergenic
1152109151 17:78347761-78347783 CAGACCCCTCAGGCCATCACAGG - Intergenic
1155276196 18:24189840-24189862 CAGTCCTCACAGGCCAGCCATGG + Intronic
1155487593 18:26363098-26363120 CAGTCCCCCGAGGATACCAAGGG + Intronic
1155651257 18:28145201-28145223 CTGTCCCCAGATGCCATCAACGG + Intronic
1156323208 18:36047650-36047672 CAGACCCTACAGGCATCCAAAGG + Intronic
1157590779 18:48835439-48835461 CAGACCCTGAAGGCCACCAAGGG - Intronic
1160169472 18:76541037-76541059 CAGGTCTCACATGCCACCAAAGG - Intergenic
1160234565 18:77075895-77075917 CAGTCCCCTGAGACCAGCAAGGG - Intronic
1160445930 18:78926652-78926674 CGCTCCCCTCAGGCTACCAAAGG - Intergenic
1160607692 18:80064728-80064750 CAGTCCCCACAGGCTACTTCAGG - Intronic
1161991380 19:7686176-7686198 CCATCCCCACCGGCCACCGAGGG + Exonic
1162795242 19:13083702-13083724 CAGGCCACACAGGCCACACAAGG - Intronic
1166823513 19:45595341-45595363 CAGTCCCCACTGGCAGCCCAGGG - Intronic
1167384316 19:49155223-49155245 CCGTCCCCATGGGCCACCATAGG - Exonic
933252139 2:80040661-80040683 CATTCCCCACAGGCCAGCAGAGG + Intronic
933362447 2:81305146-81305168 CAGTCCCCACCCACAACCAAGGG + Intergenic
934056865 2:88258496-88258518 CAGTCCCCAGAGGGCACCCAGGG - Intergenic
936009594 2:108916956-108916978 CAGGCCACCCAGGCCACCAAAGG + Intronic
936153258 2:110033046-110033068 GTGTCCCCACAGCCCACCAAGGG + Intergenic
936191423 2:110338369-110338391 GTGTCCCCACAGCCCACCAAGGG - Intergenic
936588514 2:113780390-113780412 CAGTCTCCCGAGGACACCAAGGG - Intergenic
936947130 2:117941072-117941094 CAGTCCACAAAGGCCACCACCGG - Intronic
940338724 2:152556953-152556975 CACAGCCCATAGGCCACCAATGG + Intronic
941978827 2:171433714-171433736 GTGTCCCCGCAGGCCACCCAAGG + Intronic
942665886 2:178316856-178316878 CAGTCCCCCAAGGATACCAAGGG + Intronic
943009124 2:182425124-182425146 CAATCCCCACAGCTCTCCAAAGG + Intronic
945183049 2:207111338-207111360 CAGTGCGCACAGGCCACATAAGG + Intronic
945952147 2:216049537-216049559 CAGTCCCCACCATCCACAAATGG + Intronic
947096903 2:226576978-226577000 CAGTCACTACAGGCCCCTAATGG + Intergenic
947752521 2:232540308-232540330 CAGTCCCCACAGGCCACCAATGG - Intronic
948392969 2:237626033-237626055 CAGTCCCCACAGTGCCCCAGGGG + Intergenic
1170699291 20:18688872-18688894 CACCCCCCACAGGCCACCCCAGG - Intronic
1171009842 20:21503251-21503273 CATTTCCCACAGGCCCCCAGTGG - Intergenic
1172594692 20:36142681-36142703 CAGCCCCATCAGGCCACCCAGGG - Intronic
1173005608 20:39137574-39137596 CATGCCCCACTGGCAACCAAGGG + Intergenic
1173549634 20:43923676-43923698 CTCTCCCCACAACCCACCAAGGG - Intronic
1173811805 20:45960419-45960441 CCGTCCCCAGGGGCCTCCAAGGG + Intronic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1175186466 20:57182344-57182366 CAGCACCCCCAGGCCACCAGAGG + Intronic
1176386978 21:6142992-6143014 CTGTCCCTCCAGGCCACCAGCGG - Intergenic
1179537038 21:42059446-42059468 CTGTCCCTAGAGACCACCAATGG + Intergenic
1179736495 21:43395260-43395282 CTGTCCCTCCAGGCCACCAGCGG + Intergenic
1180011661 21:45055254-45055276 CAGCCTCCAAAGGCCACCACAGG + Intergenic
1180878646 22:19187857-19187879 CAGGCCCCACAGGACACCAGTGG - Intronic
1180987418 22:19913033-19913055 CAGTCCCCACGGGTCTCCCAGGG - Intronic
1182585718 22:31343413-31343435 CAGTCCCCAGAGGCCAGCAGTGG + Intronic
1182798146 22:33006436-33006458 CAGGCCCCTCAGGCCACCTCAGG - Exonic
1183040822 22:35176659-35176681 CAGTCCCCACTTGCCCCCAGTGG + Intergenic
1184188472 22:42879538-42879560 CAGCCCCCTCAGGCCAGCATGGG + Intronic
1184892408 22:47388114-47388136 CTGTCTCCAAAGGCCAGCAACGG + Intergenic
950135031 3:10575009-10575031 CAGACCCCACATGTCAACAAGGG + Intronic
950136216 3:10582816-10582838 CAGACCACACAAGACACCAAGGG + Intronic
950361541 3:12452912-12452934 CAGTTCCCAGAGGCCACCATTGG - Intergenic
950609047 3:14113252-14113274 CAGTCCTCACAGGCTACTGAGGG + Intronic
952529827 3:34251999-34252021 CAGACTCCAAAGTCCACCAAAGG - Intergenic
953916472 3:46923867-46923889 CATTCCCCACAGGCCAAGAATGG + Intronic
954143315 3:48621467-48621489 CGGCGCTCACAGGCCACCAAGGG - Exonic
954881009 3:53836099-53836121 CACTCCCCTCAGCCCACCACAGG - Intronic
962988326 3:140556421-140556443 CTGTCCATACAGGGCACCAAGGG - Intronic
964223125 3:154368691-154368713 CTGTCCCCACTTGCCATCAAAGG - Intronic
964917152 3:161852417-161852439 CTGTCCCCACTTGCCATCAAAGG + Intergenic
965258274 3:166444755-166444777 CAGCCACCACAGGGCCCCAAGGG - Intergenic
968813638 4:2810974-2810996 CAGTCCCCTCAGGTGGCCAAGGG - Intronic
969283537 4:6188256-6188278 CAGTCACCACATGTCACAAAGGG - Intronic
969354473 4:6617368-6617390 CTGTCCCCAAAGGCCATCGAGGG + Exonic
975956723 4:79849470-79849492 CAGTGACCACAGTCCAGCAAGGG + Intergenic
981348768 4:143704295-143704317 CAGTCCCCACAGGTTACAAATGG - Intergenic
984978804 4:185257276-185257298 GACTCCCCACAGGGCCCCAAGGG - Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
985914119 5:2904463-2904485 CAGCTCCCAGAGGCCACCGAGGG + Intergenic
985923854 5:3000496-3000518 CAGCCCCCACAGGAATCCAATGG + Intergenic
986402630 5:7395584-7395606 CAGGCCCCGCAGCCCACTAAGGG + Intergenic
986798746 5:11238266-11238288 TTGACCCCACAAGCCACCAAAGG + Intronic
986799871 5:11247442-11247464 CAGTCCCCACAGTCCCCACAAGG - Intronic
991489226 5:67166445-67166467 CGGTCCCCAGAAGCCACCGACGG + Exonic
993794376 5:92248955-92248977 CAGTCCCCTCAGGCCAGTAACGG + Intergenic
994203018 5:97000403-97000425 AAGTTCCCACATGCCACCCAAGG - Intronic
994589125 5:101751972-101751994 CAGTCCCCACAAGATACCACTGG + Intergenic
995040723 5:107585069-107585091 CAGTCCCCATGGGCTACAAATGG + Intronic
995547979 5:113251881-113251903 ATGTCCCCTCAGGCCACCAGTGG - Intronic
996131524 5:119787406-119787428 CACTCCCCACAGCCCTCCAAAGG + Intergenic
996760651 5:126983181-126983203 CAGTCCCCACAGGTCCCAGAAGG + Intronic
996843344 5:127872545-127872567 CAAGTCCCACAGGTCACCAAGGG + Intergenic
997267429 5:132503074-132503096 CACTCCCAATAGGCCACCAGTGG - Intergenic
999946124 5:156597692-156597714 CAGTCCCCAGAGGACACAGAGGG - Intronic
1002518072 5:179774134-179774156 CCCCCGCCACAGGCCACCAATGG + Exonic
1005731868 6:28705434-28705456 CTTTCACCAGAGGCCACCAAAGG - Intergenic
1006292156 6:33146450-33146472 CAGCCCCCAAAGGCCCCCAAAGG - Intergenic
1006445970 6:34079987-34080009 AAGTCCCCACAGGCCCCCCCAGG + Intronic
1006796974 6:36738017-36738039 CAGGCCCCACAGGCCTCCTGAGG - Intergenic
1007073660 6:39053616-39053638 CAGTCCCCACAGCCATCCCATGG + Intronic
1007652604 6:43432671-43432693 CAGGCCCCACGGGCCAGCAAGGG - Exonic
1013203752 6:107927700-107927722 CAGTCCCCTGAGGATACCAAGGG - Intronic
1014269111 6:119316037-119316059 CTGTCACCACAGGCCTGCAAGGG - Intronic
1014724331 6:124956507-124956529 CATACCACACATGCCACCAAGGG + Intergenic
1015347580 6:132178196-132178218 GAGTTCTCACAGGCCTCCAAAGG + Intergenic
1017235330 6:152112472-152112494 GAGTACACAAAGGCCACCAAAGG + Intronic
1017374291 6:153750253-153750275 CTGTCTCCACAGGGCACAAAAGG + Intergenic
1019262187 7:87855-87877 CAGGGCCATCAGGCCACCAATGG + Intergenic
1019440535 7:1044187-1044209 CAGGCCCCACCGCCCTCCAAAGG - Intronic
1020274735 7:6617112-6617134 AGGTGCCCACAGGCCCCCAAAGG - Intronic
1020682139 7:11250419-11250441 CAGCCCCAGCTGGCCACCAATGG + Intergenic
1021550120 7:21862142-21862164 AATTCCCCTCATGCCACCAAGGG - Intronic
1021604544 7:22396959-22396981 CAGCCCCCAGAGGCCTGCAAAGG - Intergenic
1023534369 7:41193060-41193082 CTGTCCCCAGAGGCTACAAAAGG + Intergenic
1026166555 7:67915289-67915311 AAGTCCTCACAGGCCACAAATGG - Intergenic
1026999683 7:74643707-74643729 AGGTGCCCACAGGCCACCAAAGG + Intergenic
1027188238 7:75984235-75984257 CAGCCCTCCCAGGCCCCCAAGGG + Intronic
1027198453 7:76047676-76047698 GAGTCCCCTCTGGCCTCCAAGGG + Exonic
1029609062 7:101616999-101617021 CAGCCCCCACATTGCACCAATGG + Intronic
1029614465 7:101647642-101647664 CAGACCCCAGAGGCCTCCTAGGG - Intergenic
1032487753 7:132300794-132300816 CAGCCCCCTCAGGCCACCGTCGG + Intronic
1034210583 7:149358905-149358927 CAGTCCCCAAAGCCCACCCCTGG - Intergenic
1034627467 7:152504512-152504534 CAGTCCCCACCCCCCACCAATGG + Intergenic
1038790798 8:30666447-30666469 AAGTCCCCACTGGCCACAAAAGG - Intergenic
1039533242 8:38283652-38283674 CACTCGCCACATGCCACCAAAGG - Intronic
1040105344 8:43538375-43538397 CTGACCCAACTGGCCACCAATGG + Intergenic
1043260271 8:78186556-78186578 CAGTCCCAACAGGCCCCTAGAGG - Intergenic
1045478679 8:102575480-102575502 CATTTCTCACAGGCCCCCAAGGG + Intergenic
1046528210 8:115409030-115409052 CAGTTCCCAAAGGCCAGGAAAGG - Exonic
1048780093 8:137990643-137990665 CTGTCCCCACTTGCCATCAAGGG - Intergenic
1049423604 8:142527470-142527492 CAGAACCCACAGGCACCCAAGGG - Intronic
1049613787 8:143567702-143567724 CAGGCCCCACAGCCCCCCAGGGG + Intronic
1052626113 9:30979037-30979059 CCTTCCCAACAGGCCCCCAAAGG - Intergenic
1057116700 9:92530165-92530187 CAGTCCCCCAAGGGTACCAAGGG + Intronic
1057143295 9:92740804-92740826 CAGTCCCCACAGGCAACGTGAGG + Intronic
1057266244 9:93619881-93619903 CAGACCTCAGAGGCCACCAGGGG - Intronic
1058676615 9:107405586-107405608 CTGTCCTCACAGGCCACCCCTGG - Intergenic
1060146939 9:121261140-121261162 CTGTCCCCGCAGGCCACCAGTGG - Intronic
1061033212 9:128099272-128099294 CAGTGCCCACTGTGCACCAAGGG + Intronic
1061041731 9:128144651-128144673 CAGCCCCCGCAGGGCACCAGAGG + Intergenic
1061325785 9:129863320-129863342 CAGTCCCCACACACCGCCCAAGG - Intronic
1061330311 9:129888390-129888412 CAGTCCCCACAGCTCCACAATGG - Exonic
1061449884 9:130662202-130662224 CAGTTCCTCCAGGACACCAAAGG - Intergenic
1061478372 9:130884262-130884284 AAGTCCCCAAAGCCCAGCAATGG + Exonic
1061801259 9:133114533-133114555 CAGCACCCACAGGCCACCCTAGG + Intronic
1062457281 9:136645719-136645741 CAGTCCCCACCGCCTACCCATGG + Intergenic
1185516181 X:700732-700754 CAGTGCCCACAGATCAGCAAAGG - Intergenic
1185528182 X:795799-795821 CAGTCCCCTAAAACCACCAAAGG - Intergenic
1187298727 X:18027534-18027556 CCTTCCCCACAGGCAAACAAAGG + Intergenic
1188087390 X:25916748-25916770 CACTCCCAACAGGGCAACAAGGG + Intergenic
1189261306 X:39680666-39680688 CAGTCCCAATAGAGCACCAAGGG + Intergenic
1190213706 X:48466933-48466955 CTGGCCCCGCAGGCCACCTATGG + Intronic
1190216491 X:48482447-48482469 AGGTCCCCACAGGTCACAAAAGG - Exonic
1193342729 X:80369864-80369886 CAGTCCCCAAAAGATACCAAGGG + Intronic
1194657613 X:96592251-96592273 CCCAACCCACAGGCCACCAATGG - Intergenic
1196130545 X:112150720-112150742 CAGTACCCACAGCCCATCCATGG + Intergenic
1196403436 X:115339818-115339840 CAGTTCCCACAGGCCACACTTGG + Intergenic
1201750144 Y:17422939-17422961 CTGTCCCCACTTGCCATCAAAGG + Intergenic
1201981948 Y:19917932-19917954 CTGTCCCCACTTGCCATCAAAGG + Intergenic