ID: 947753058

View in Genome Browser
Species Human (GRCh38)
Location 2:232542769-232542791
Sequence GTGCCCTAAGGAGCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947753058_947753066 13 Left 947753058 2:232542769-232542791 CCTGCTGGTGCTCCTTAGGGCAC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 947753066 2:232542805-232542827 AGCTGGGTCACTCGGCTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 128
947753058_947753060 -4 Left 947753058 2:232542769-232542791 CCTGCTGGTGCTCCTTAGGGCAC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 947753060 2:232542788-232542810 GCACATGCTGCCCTTGCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 198
947753058_947753062 5 Left 947753058 2:232542769-232542791 CCTGCTGGTGCTCCTTAGGGCAC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 947753062 2:232542797-232542819 GCCCTTGCAGCTGGGTCACTCGG 0: 1
1: 0
2: 2
3: 17
4: 184
947753058_947753061 -3 Left 947753058 2:232542769-232542791 CCTGCTGGTGCTCCTTAGGGCAC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 947753061 2:232542789-232542811 CACATGCTGCCCTTGCAGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 207
947753058_947753065 12 Left 947753058 2:232542769-232542791 CCTGCTGGTGCTCCTTAGGGCAC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 947753065 2:232542804-232542826 CAGCTGGGTCACTCGGCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947753058 Original CRISPR GTGCCCTAAGGAGCACCAGC AGG (reversed) Intronic
900497156 1:2980946-2980968 GTCACCTGAGGAGCACCCGCTGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904932913 1:34104660-34104682 CTGCCACACGGAGCACCAGCTGG + Intronic
905852861 1:41286878-41286900 GTGCGCTCAGGAGTCCCAGCAGG - Intergenic
906227049 1:44130739-44130761 CTGACCTAAGGACCAGCAGCAGG - Exonic
907565300 1:55428578-55428600 GTGCCCAAAGGAGCACAAGGAGG - Intergenic
911956263 1:104239151-104239173 GTGCAGTAATGAGAACCAGCAGG - Intergenic
912650575 1:111435255-111435277 GTGGCCTAAGGAGCCCCAGATGG - Intergenic
920131694 1:203736937-203736959 GAGAGCTAGGGAGCACCAGCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921298183 1:213724015-213724037 GTGCACTGAGGAGCAGAAGCAGG + Intergenic
922220668 1:223556339-223556361 GTGCCCTAAAGAGAAAAAGCAGG + Intronic
922955673 1:229597360-229597382 GATCCCTGGGGAGCACCAGCTGG - Intronic
923224050 1:231922809-231922831 GTGCTCTGAGGAGCGCCTGCTGG - Intronic
1063439323 10:6059684-6059706 GTGCCTTAGGGAGCAGCAGGTGG - Intronic
1065751419 10:28891028-28891050 GTGCCCAAAGGAGACCCAGATGG - Intergenic
1068919128 10:62464917-62464939 GTGCACTCTGCAGCACCAGCAGG + Intronic
1075871133 10:125773514-125773536 CTTCCCTAGGGAGCAGCAGCTGG - Intronic
1076358042 10:129867066-129867088 GTGCCCTCATGAGCACCTCCTGG + Intronic
1076424030 10:130354761-130354783 GTGCCTTCACCAGCACCAGCTGG + Intergenic
1078105317 11:8354724-8354746 GCTCCCTGAGGAGCAGCAGCTGG + Intergenic
1078509785 11:11976751-11976773 GTGCCCTGAGGAAGAGCAGCAGG + Intronic
1078553144 11:12294115-12294137 CTGCCCTAGGGAGCAGCAGGGGG - Exonic
1081905555 11:46667295-46667317 GGGCCCTAAGCAGCAGCAGTGGG - Intronic
1085315503 11:75542460-75542482 GTGCCCAAAGGGGCAGCAACAGG - Intergenic
1088848160 11:113684683-113684705 GGGCCTTAATGAGGACCAGCTGG - Intergenic
1089438085 11:118488673-118488695 GCGCCCTCTGGAGGACCAGCTGG + Exonic
1090416474 11:126543950-126543972 ATGACCCAAGGAGGACCAGCCGG + Intronic
1091644208 12:2261550-2261572 GTGTCCCAAGGAACCCCAGCAGG - Intronic
1092976690 12:13751887-13751909 GTGTGCTAAGGAGCCCCAGATGG + Intronic
1097102612 12:56600213-56600235 GTGCCCTCAGGGGCACCATTAGG + Exonic
1101013945 12:100480159-100480181 GTGCCATCAGGAGCACAAGCAGG - Intronic
1103352049 12:120290868-120290890 GTGTCCTAAGCAGGTCCAGCTGG + Intergenic
1106199253 13:27522867-27522889 ATGACCTAAGAAGCTCCAGCAGG - Intergenic
1115486547 14:33916126-33916148 GTGCCCTAGGCTGCAACAGCAGG - Intergenic
1117343096 14:54808209-54808231 GTGCCCTCAGGAGCAAGGGCTGG + Intergenic
1118355529 14:65010503-65010525 GGGCCCTAAGTAGCCCCAACTGG + Intronic
1122286886 14:100657677-100657699 ATGCCCTTAGGAGCACAGGCAGG + Intergenic
1122980836 14:105191764-105191786 GTGGTCTAGGGAGCACCCGCAGG - Intergenic
1124517176 15:30376564-30376586 GTGCGCTAAAGAGCACACGCAGG - Intronic
1124725768 15:32154430-32154452 GTGCGCTAAAGAGCACACGCAGG + Intronic
1129232476 15:74204415-74204437 GTGCCCTGAGGTTCACCAGCTGG + Intronic
1131160664 15:90102620-90102642 GCGCCCAGAGAAGCACCAGCCGG - Intergenic
1132556516 16:575089-575111 GTGCCCTCAGGAGCACCCCCAGG - Intronic
1133965381 16:10527282-10527304 AGGCCATAAGGAGCCCCAGCTGG - Intergenic
1134250166 16:12568727-12568749 GTGCTCTCAGGATCACCAGGTGG - Exonic
1136227732 16:28870317-28870339 GTCCCCTGAGCAGCACAAGCAGG + Intronic
1141891319 16:86928605-86928627 GTGGCCTCCGGAGCACCTGCGGG - Intergenic
1142256159 16:89014810-89014832 GGGCCCTGGGGAGCCCCAGCAGG - Intergenic
1142286346 16:89173066-89173088 GTGCCCTCAGGGGCAGCTGCTGG - Intronic
1142607834 17:1091703-1091725 GTGCCCCAAGGTGCAACAGTGGG - Exonic
1143918557 17:10312946-10312968 GGTCCCTAAGGAGCACCTCCAGG + Intronic
1144429033 17:15173724-15173746 GTGACCTTAGGAGCAGCAGGAGG + Intergenic
1144767484 17:17740470-17740492 GAGCCCTAAAGAGGACCAGGTGG + Intronic
1147034615 17:37670895-37670917 GTGCCTTAAGGGGCCACAGCAGG + Intergenic
1150729187 17:67677176-67677198 GAGCTCTGAGGAGCACAAGCTGG - Intronic
1151474514 17:74338156-74338178 GTGGCCTGAGGAGCACCCTCTGG - Intronic
1151480843 17:74369344-74369366 GTGCTCTAAGGCGCACAGGCAGG - Intronic
1151684053 17:75636516-75636538 GTTCCCTTAGGAGCAGCGGCTGG + Intronic
1152895902 17:82911082-82911104 GTACCCCAAGGAGCACCTGAAGG - Intronic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1162671848 19:12264322-12264344 GCACCCTAAGGAGAACCACCTGG + Intronic
1163375966 19:16930773-16930795 GAGCCCTAAGCAGCTACAGCAGG + Intronic
1163612697 19:18309457-18309479 GTGCCCTGAGGACCGCCAGGAGG + Intronic
1164464610 19:28476704-28476726 GTGCCCTCAGGAGGATGAGCAGG - Intergenic
1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG + Intronic
924959009 2:17258-17280 GCGCACAAAGGAGCACCTGCAGG - Intergenic
925370162 2:3339195-3339217 GTGTCCAAATGAGAACCAGCAGG + Intronic
926685138 2:15692230-15692252 GAGCCCTCAGCATCACCAGCAGG - Intronic
926886335 2:17602167-17602189 GTGGCCCATGGAGCACCTGCGGG + Intronic
927194985 2:20540791-20540813 GTGCCCTGGGGAGCTCCAGGGGG + Intergenic
931426789 2:62178743-62178765 TTGCCCTAAGAAACAGCAGCAGG + Intergenic
933778799 2:85787573-85787595 GGGCCCTAAGCATCACCAGAAGG + Exonic
933897685 2:86825891-86825913 CTGCCCCAAAGAGCACCAGGAGG + Intronic
938257130 2:129868257-129868279 GTGACCACAGGAGCAGCAGCAGG + Intergenic
938367261 2:130744698-130744720 GAGCCCTACGGAGCAGCAGATGG + Intergenic
938599994 2:132827919-132827941 TTCCCCTAAGGACTACCAGCAGG - Intronic
943798297 2:192026241-192026263 GTACCCTAAGGAGCAACTCCAGG - Intronic
946217133 2:218193190-218193212 GTTCCCTAAATAGCACCAACAGG - Intergenic
947461319 2:230306789-230306811 TTGCCCAAAGGGGCACCTGCAGG - Intronic
947753058 2:232542769-232542791 GTGCCCTAAGGAGCACCAGCAGG - Intronic
1169945568 20:10984533-10984555 TTGCTCTAAGGAGCAGCTGCAGG + Intergenic
1171087141 20:22248000-22248022 GTTCCCTTATCAGCACCAGCGGG + Intergenic
1173970169 20:47146468-47146490 CTTCCCTAAGTAGCTCCAGCTGG - Intronic
1175262129 20:57681312-57681334 GTGCCCTCAGGAGCTCAGGCAGG - Intronic
1175783547 20:61698295-61698317 GTGCCCTCAATCGCACCAGCAGG - Intronic
1185038718 22:48493191-48493213 GTGCCCTATTCAGCACGAGCAGG + Intronic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
953350767 3:42214158-42214180 GTGCCTCTAGGAGCACCAGGGGG - Intronic
954798405 3:53173132-53173154 ATGGCCTGAGGAGCGCCAGCAGG - Intronic
954916039 3:54149397-54149419 CTGCCCTCAGGAGGACCACCTGG + Intronic
958005025 3:87799718-87799740 GTCCCCTGAGTAGCACCAGTAGG + Intergenic
982179751 4:152738845-152738867 GTGCCCCTAGAAGCACTAGCAGG - Intronic
982394688 4:154903592-154903614 GTGCCCTAAGGAGCCACTTCAGG - Intergenic
985085319 4:186307302-186307324 GTGGCCAAAGGAGCACCATGAGG - Intergenic
988531097 5:32027833-32027855 GTGACCGAAGGAGAACCAGATGG - Intronic
988735164 5:34013280-34013302 GTGCCCTAACAATCTCCAGCAGG - Intronic
990878173 5:60510162-60510184 GAGCCCTAAGCAGCAGCTGCTGG + Intronic
997632325 5:135378203-135378225 CTGCCCTGAGGAGCCACAGCAGG - Intronic
998421608 5:141992524-141992546 TTGCCATAAGCATCACCAGCAGG + Intronic
999110952 5:149121158-149121180 GTGACCTGAGCAGCAACAGCAGG + Intergenic
1000670916 5:164062050-164062072 CAACCCTAAGGACCACCAGCAGG + Intergenic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1010465946 6:76166680-76166702 GTGCCCTAAGGAGAAGAGGCTGG + Intergenic
1015880292 6:137865375-137865397 GTTTACAAAGGAGCACCAGCAGG + Intergenic
1017970620 6:159309626-159309648 GTGCCCTAAGAAGTTCAAGCAGG - Intergenic
1020009591 7:4800743-4800765 CTGCCCTGAGGGCCACCAGCTGG + Intronic
1021223341 7:17999786-17999808 GTTCCATAAGGAGCACCTTCAGG + Intergenic
1022211961 7:28219685-28219707 ATGCCCAAAGGAGCACTAACAGG + Intergenic
1024628920 7:51231571-51231593 GTGTCCTAAGGAGCGCCAGAGGG + Intronic
1026019137 7:66694580-66694602 GCTCCCTATGGAGAACCAGCTGG + Intronic
1026881241 7:73908065-73908087 GCTCCCTATGGAGAACCAGCCGG - Intergenic
1033452835 7:141477017-141477039 GTTCCTTAAGGAGCAACACCTGG - Exonic
1034893836 7:154862624-154862646 GTGCCTCGAGGAGCACCTGCAGG + Intronic
1035557191 8:576246-576268 GTGCTATAAGGAGCACAAGGAGG + Intergenic
1037254780 8:16941458-16941480 GTTCCCTTAGCTGCACCAGCTGG - Intergenic
1038477005 8:27875605-27875627 GTGCCCCGAGAACCACCAGCAGG + Intronic
1038943835 8:32335467-32335489 GTGGCCTAAGGAGGAAAAGCTGG - Intronic
1039984969 8:42439382-42439404 GTTCCCTGGGGAGGACCAGCTGG - Intronic
1041407598 8:57517383-57517405 GAGCCCTAAGGAGCCCCACGTGG + Intergenic
1042229875 8:66544640-66544662 ATTCTCTCAGGAGCACCAGCAGG - Intergenic
1046817142 8:118597192-118597214 GAGCCCTAAGGAGCCCCCGTTGG - Intronic
1053239716 9:36486733-36486755 GTGCCCTGGGGAGCCGCAGCGGG - Intronic
1058513880 9:105750304-105750326 GTGCCCTTAGAAGCACAAACTGG + Intronic
1062637361 9:137498607-137498629 GTGCCGTGAAGGGCACCAGCAGG + Intronic
1186636360 X:11409374-11409396 GTTCACTCAGGAGCACAAGCAGG + Intronic
1189215555 X:39320116-39320138 GTGCCATAGGGAGCAGCAGAGGG - Intergenic
1192194011 X:69016634-69016656 GTGCCCTAAGGGGCAGCTGGGGG + Intergenic
1195850343 X:109275990-109276012 GGGTCCTAAGGAACACCAGCTGG + Intergenic
1196911175 X:120485940-120485962 GTGCCTGAAGGCGCGCCAGCCGG - Intergenic
1200690978 Y:6306236-6306258 GTGGCAGAAGGAGGACCAGCGGG + Intergenic
1201044294 Y:9868480-9868502 GTGGCAGAAGGAGGACCAGCGGG - Intergenic
1202165055 Y:21978968-21978990 GTGACCCAAGGAGCACCACTGGG + Intergenic
1202226301 Y:22607406-22607428 GTGACCCAAGGAGCACCACTGGG - Intergenic
1202316814 Y:23588259-23588281 GTGACCCAAGGAGCACCACTGGG + Intergenic
1202553951 Y:26081799-26081821 GTGACCCAAGGAGCACCACTGGG - Intergenic