ID: 947754384

View in Genome Browser
Species Human (GRCh38)
Location 2:232550954-232550976
Sequence AGGGCGAAGAGCTGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947754368_947754384 12 Left 947754368 2:232550919-232550941 CCGGAGTCCCGGAGACCCCAGGG 0: 1
1: 0
2: 2
3: 27
4: 322
Right 947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 283
947754371_947754384 4 Left 947754371 2:232550927-232550949 CCGGAGACCCCAGGGCCGTCCGA 0: 1
1: 0
2: 0
3: 5
4: 151
Right 947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 283
947754376_947754384 -5 Left 947754376 2:232550936-232550958 CCAGGGCCGTCCGAACCGAGGGC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 283
947754370_947754384 5 Left 947754370 2:232550926-232550948 CCCGGAGACCCCAGGGCCGTCCG 0: 1
1: 0
2: 2
3: 19
4: 223
Right 947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 283
947754374_947754384 -4 Left 947754374 2:232550935-232550957 CCCAGGGCCGTCCGAACCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 283
947754372_947754384 -3 Left 947754372 2:232550934-232550956 CCCCAGGGCCGTCCGAACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 56
Right 947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947754384 Original CRISPR AGGGCGAAGAGCTGGGCCCG GGG Intronic
900480400 1:2895380-2895402 GGGGCGAGGGGCTGGGGCCGTGG + Intergenic
901154387 1:7125660-7125682 AGGAAGGAGAGCTGGCCCCGGGG + Intronic
901320681 1:8338261-8338283 AGGGCGAAGTGGGGGGCCCTGGG + Intronic
902289894 1:15429020-15429042 AGGGCCAGGAGCTGGGCCTGGGG - Exonic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902410059 1:16207131-16207153 AGCGCGAGGAGGAGGGCCCGGGG - Exonic
902509908 1:16960915-16960937 AGGCTGCAGAGCTGGGCCTGCGG + Exonic
903365741 1:22804656-22804678 ATGGGAAAGAGCTGGGCCAGTGG - Intronic
903659808 1:24970104-24970126 TCGGCCAAGAGCAGGGCCCGAGG - Intergenic
904483370 1:30807643-30807665 CGGGCCAAGCGCAGGGCCCGAGG - Intergenic
906086507 1:43139626-43139648 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
906525333 1:46490262-46490284 AGGACGAAGGCCTTGGCCCGCGG + Intergenic
907517822 1:55004428-55004450 AGGGAGAGGAGCTGTGCCTGTGG - Intronic
907952216 1:59194802-59194824 AGCGGGAAGAGCTGGGCCACAGG - Intergenic
908429341 1:64040781-64040803 AGGGTGAAGAGGTGGGGCCTTGG - Intronic
912449509 1:109760513-109760535 AGGGAGAAGAGCTGGGCCCTGGG - Intronic
913478336 1:119260587-119260609 TGGGCCAAGAGCTGGGCCGTTGG + Intergenic
915130131 1:153690042-153690064 AGGGCGAGGGGCTGGGCCAGGGG - Intronic
916525634 1:165606519-165606541 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
916912681 1:169367833-169367855 AGGACGAAGAGGTGGGGCGGTGG - Exonic
918040776 1:180912829-180912851 AGCGCGGAGAGGTGGGGCCGCGG - Intergenic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
921055239 1:211538237-211538259 AGGGCGTAGTGCTGGGCTTGGGG - Intergenic
922416326 1:225426748-225426770 AGGGCGCGGAGCAAGGCCCGGGG - Intronic
922565120 1:226596708-226596730 AGGGTGGACAGCTGGGCCCCAGG + Intronic
924343272 1:243054065-243054087 AGAGGACAGAGCTGGGCCCGGGG + Intergenic
924453615 1:244200427-244200449 AGGGGACAGAGCTGGGCCTGGGG + Intergenic
924940897 1:248811969-248811991 ACGGCCAAGAGCTGGGAACGCGG - Exonic
1063772655 10:9221999-9222021 AGGGAGAAGAACTGTGCCCTAGG + Intergenic
1064011958 10:11742640-11742662 CGGGCGGGGAGCTGGGCCCAGGG - Exonic
1067024968 10:42836880-42836902 AGGGCGCAGAGCTGGGAGAGCGG - Intergenic
1067284112 10:44894971-44894993 TGGGCACAGCGCTGGGCCCGCGG - Intergenic
1067730246 10:48805441-48805463 AGGGGGAAGAGCAGGGCCCCAGG + Intronic
1068429265 10:56911228-56911250 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1069799812 10:71075111-71075133 AGGTGGCAGAGCTGGGGCCGGGG + Intergenic
1072819058 10:98538192-98538214 AGAGAAAACAGCTGGGCCCGGGG - Intronic
1073044580 10:100629154-100629176 AGGGAGAAGAGTGGGGCCCAGGG - Intergenic
1073101437 10:101008700-101008722 AGGGCCGTGGGCTGGGCCCGGGG + Intronic
1073116306 10:101093741-101093763 AGGGCTGTGAGCTGGGCCCCGGG + Intronic
1073139367 10:101237299-101237321 AGGGCGGAGGTCTTGGCCCGAGG - Intergenic
1076005346 10:126944311-126944333 AGGGTGCAGGGCTGTGCCCGTGG + Intronic
1076354032 10:129839520-129839542 AGGGAGAAGGGCCGGCCCCGAGG - Intronic
1076414228 10:130273788-130273810 TGGGGAAAGAGCTGGGCCAGGGG - Intergenic
1076653154 10:132003812-132003834 AGGGCAAAGAGCATGCCCCGAGG - Intergenic
1077289274 11:1781427-1781449 AGGCCGCAGAGCTGGGGACGTGG - Intergenic
1077409180 11:2395539-2395561 AGGGCGGGGAGCAGGGCCCCGGG + Intronic
1082008959 11:47437813-47437835 AGGGAGGGGAGCTGGGCCCAGGG + Exonic
1083628156 11:64082479-64082501 GGGGCCAAGAGCTGGTCCCAGGG + Intronic
1083779428 11:64910272-64910294 TGGGAGAAGAGCTGGGGCAGGGG + Intronic
1084029246 11:66471413-66471435 AGGCCGAAGACCTGGGCCTTGGG - Intronic
1084031821 11:66485570-66485592 AGTGGGAAGTGCTGGGCCGGGGG + Intronic
1084603330 11:70159239-70159261 TGGGGGAAGAGATGGGCCAGGGG + Intronic
1084610878 11:70202356-70202378 GGGGGGAAGAGCTGGGCACACGG - Intergenic
1084637014 11:70399059-70399081 AGGGAGAGGGGCTGGGCCTGTGG + Intronic
1084948496 11:72651907-72651929 AGAGGGAAGAGCTGGGCCCTAGG + Intronic
1085866497 11:80300864-80300886 TGGGAGAAGTGCTGGGCCTGTGG - Intergenic
1089282302 11:117382852-117382874 AGGCCGAGGAGCTGGGCCCTGGG + Exonic
1092229225 12:6767456-6767478 AGGGCGAACGGATGGGGCCGGGG - Intronic
1095102988 12:38202439-38202461 AGGGAGCTGAGCTGGGGCCGTGG + Intergenic
1095966714 12:47872658-47872680 AGAGGGAAGGGCTGGGCCAGGGG - Intronic
1096072518 12:48783180-48783202 AGGGCAAGGAGCTGGGGCTGCGG - Exonic
1096122098 12:49094834-49094856 AGGGCGGAGGGCGGGGCCAGGGG - Intergenic
1099519427 12:83642247-83642269 AGGTAGAAGGGCTGGGCCCTTGG + Intergenic
1101381259 12:104215903-104215925 AGGGCGAAGGCCTGGTCCCCAGG + Intronic
1102101239 12:110280870-110280892 AGGCCGAGGAGCTGGGAGCGCGG - Intronic
1104176352 12:126336444-126336466 AGGGGGAAGAGCCTGGCCCCTGG + Intergenic
1104977771 12:132559958-132559980 CGGGCGCGGAGCTGGGCGCGCGG - Intronic
1105855545 13:24368772-24368794 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1106057828 13:26254605-26254627 AGGCCGGAGAGCTGGGTCGGGGG - Exonic
1106140560 13:27007343-27007365 AGGGCGAGGAGCTGGGACGGAGG + Intergenic
1107146876 13:37069697-37069719 AGGAGGCGGAGCTGGGCCCGGGG + Intergenic
1111215210 13:85132693-85132715 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1111950868 13:94708100-94708122 AGGGCGTAGAGAAAGGCCCGGGG - Intergenic
1112430899 13:99349430-99349452 AGAGAAAACAGCTGGGCCCGAGG + Intronic
1113614690 13:111671797-111671819 AGAGCACAGAGCTGGGCCAGTGG + Intronic
1113620159 13:111756711-111756733 AGAGCACAGAGCTGGGCCAGTGG + Intergenic
1114493760 14:23119007-23119029 AGGGGGCCGAGCTGGGCCCGGGG - Exonic
1117141141 14:52791759-52791781 AGGGCGAGGGGCGGGGCCTGAGG + Intergenic
1118869343 14:69728074-69728096 AGGCAGAAGAGATGGGCCAGGGG + Intronic
1119481908 14:74963261-74963283 AGGGAGAGGAGATGGGCCCCGGG + Intergenic
1121410971 14:93748174-93748196 AGGGGGAAGAGCTGAGCCCAAGG + Intronic
1121728905 14:96172784-96172806 AGGTTTAAGAGCTGGGCCCAAGG - Intergenic
1125597123 15:40894325-40894347 AGGGCTGAGGGCTGGGCGCGTGG - Intergenic
1126166582 15:45658954-45658976 CAGGCAAAGAGCTGGGCACGGGG - Exonic
1127899415 15:63330023-63330045 AGGGAGAAGAGCTGTCCCCAAGG + Intronic
1128737213 15:70060009-70060031 AGGGCTGAGAGCTGGGACAGAGG - Intronic
1129276082 15:74446159-74446181 AGGACGATGAGCTGAGCCTGCGG - Exonic
1129444897 15:75610107-75610129 AGGGCAGAGAGCCGGGCACGGGG + Intronic
1129468134 15:75735473-75735495 AGGGAAAACAGCTGGGCCCAGGG - Intergenic
1129799772 15:78405440-78405462 TGGACGCGGAGCTGGGCCCGGGG + Intergenic
1130011428 15:80155616-80155638 AGAGAGAACAGCTGGGCCCGGGG + Intronic
1131257295 15:90871309-90871331 GGGGCGAAGAGCCGAGCCCGGGG + Intronic
1132231477 15:100187724-100187746 TGTGTGAAGAGCTGGTCCCGTGG - Intronic
1132556640 16:575519-575541 GGGGCGAGGCCCTGGGCCCGTGG + Intronic
1132596329 16:752186-752208 AGGGAGAAAAGCAGGGGCCGAGG - Intronic
1132602284 16:778688-778710 AGGGCTGAGAGCTGGTCCCGGGG + Exonic
1133009971 16:2905431-2905453 AGCGGGAAGGGCGGGGCCCGTGG + Intergenic
1140869364 16:79092496-79092518 AGGGGAAAGAGCTGGGCTCCTGG - Intronic
1141630283 16:85283951-85283973 AAGGCAAAGAGATGGGCCTGAGG - Intergenic
1141643095 16:85352862-85352884 AGTGGGAAGAGCTAGGCCAGGGG + Intergenic
1141840011 16:86568183-86568205 CGGGCGGAGAGCTGAGCCCGGGG + Exonic
1142068066 16:88074056-88074078 AAGGCAGAGAGCTGGGCCCTTGG - Intronic
1142579605 17:933264-933286 TGGGAGAAGAGCTCGGCCAGAGG + Intronic
1143023958 17:3930173-3930195 AGGGCCTGGAGCTGGGGCCGAGG - Intronic
1143023989 17:3930265-3930287 AGGGCCTGGAGCTGGGGCCGAGG - Intronic
1143718808 17:8796106-8796128 AGGTCGAAGAATTGGGCCCTGGG + Intergenic
1143953743 17:10653404-10653426 AGGGGGAAGAGGTGGGCCGGGGG - Intronic
1144640592 17:16934456-16934478 AGGGCTAAGAGCATGGCCCAGGG + Intronic
1144707697 17:17380437-17380459 AGGGGGAAGGGCTGGGCCTGAGG - Intergenic
1145273933 17:21418917-21418939 AGGGCCAGGAGGTGGGCCTGGGG - Exonic
1145976570 17:28987346-28987368 AGAGGGCAGGGCTGGGCCCGTGG - Intronic
1146794165 17:35769693-35769715 TGGGGGAAGAGGTGGGCCCAAGG + Intronic
1146937995 17:36824425-36824447 ATGGCGAAGAGTTGTGCCCATGG + Intergenic
1148769027 17:50056379-50056401 AGGGCGCGGAGCTGGGCGTGAGG - Intronic
1148822484 17:50367626-50367648 AAGGCCAAGGGCTGGGCCCTGGG - Intergenic
1149263142 17:54900682-54900704 AGCGTGAGGAGCTGGGCGCGGGG - Exonic
1150247895 17:63689793-63689815 GGGGCAAACAGCTGGGCCCCTGG + Intronic
1152551327 17:81031891-81031913 AGGGCGCCGAGCGGGGCCGGAGG - Intergenic
1152745956 17:82039355-82039377 AGAGAGAACAGCTGGGCCCGGGG - Intergenic
1156327171 18:36085223-36085245 AGGTGGCAGAGCTGGGCCTGAGG + Intergenic
1156495454 18:37522737-37522759 AGGGAGAAGAGCTGTGGCCCAGG - Intronic
1157621534 18:49020155-49020177 AGCGTGAAGAGCTGGTCCCCAGG + Intergenic
1160412650 18:78685575-78685597 AGGAAGCAGAGCTGGGCCCCGGG - Intergenic
1160543501 18:79638232-79638254 CGGGCGGAGAGCAGGGCCCGAGG - Intergenic
1160904405 19:1445706-1445728 TGGGCGCCGAGCTGGGCGCGCGG - Intergenic
1161313977 19:3609308-3609330 AGGGAGCAGAGCTGGGGCCCTGG - Intergenic
1161342994 19:3752974-3752996 TGGGCGATGAGCTGGGCCTGCGG + Exonic
1162937089 19:13986758-13986780 ATGGGGAAGTGCGGGGCCCGGGG - Intronic
1163232521 19:16014139-16014161 AGAGAAAACAGCTGGGCCCGAGG + Intergenic
1163436806 19:17300959-17300981 GGGGCGCAGAGCTGGCCCCGTGG + Exonic
1163615992 19:18328667-18328689 AGGGAGAAGAGCTGGTTCCTGGG + Intergenic
1163701627 19:18789327-18789349 AGGGCTTCGAGCTGGGCCCTGGG + Intronic
1164524073 19:29000678-29000700 CAGGGGAAGAGCTGGGCCCGGGG - Intergenic
1165348005 19:35261088-35261110 TGGGTGCAGAGCTGGGCCTGTGG + Intronic
1165859563 19:38900139-38900161 TGGGCGCGGAGTTGGGCCCGGGG + Exonic
1167120670 19:47514659-47514681 AGGGCCAAGAGCCTGGGCCGGGG - Intronic
1167168814 19:47817606-47817628 GGGGTGAAGAGCGGGGCTCGGGG - Intronic
1167169917 19:47824164-47824186 GGGGTGAAGAGCGGGGCTCGGGG + Intronic
1167314065 19:48753616-48753638 AGAGAAAACAGCTGGGCCCGGGG + Intronic
1167633558 19:50640074-50640096 GGGGCGGAGAACTGGGCCCCCGG - Intronic
1167927689 19:52834824-52834846 AGAGAAAACAGCTGGGCCCGGGG + Intronic
1168191051 19:54739178-54739200 AGGGTGGAGATCTGGGCCTGGGG + Intronic
1168277982 19:55287535-55287557 AGGGCGAGGAGCTGGAGCTGGGG - Intronic
1168412185 19:56146994-56147016 TGGGCGACGCGCCGGGCCCGCGG + Exonic
1168694475 19:58396783-58396805 AGCGCCACGAGCTGGGGCCGCGG - Exonic
926541112 2:14182602-14182624 AGAGCGAGGGGCTGGGCCTGCGG + Intergenic
927141069 2:20131126-20131148 CTGGGGAAGAGCTGGGCCCCAGG - Intergenic
927714270 2:25342074-25342096 CGGGCGGAGGCCTGGGCCCGCGG - Intronic
927719273 2:25372634-25372656 AGTGGGAAGAGCTGGGCTCTGGG + Intergenic
927844294 2:26463452-26463474 AGGGAGTAGCGCTGGGCCCCAGG + Intronic
930728861 2:54709080-54709102 TGGAGGAGGAGCTGGGCCCGTGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
936976175 2:118224487-118224509 CGGGCGGAGAGCTCGGCCCGGGG + Intergenic
940265067 2:151828111-151828133 AGGGTGAGGAGCTCGGTCCGCGG - Exonic
941047769 2:160695724-160695746 AGGGTAAAGAGCTGGGAGCGAGG - Intergenic
941822034 2:169853227-169853249 ATGGAGAAGAGCTGGGCAGGAGG + Intronic
942650907 2:178166448-178166470 AGGGAGAAGAGCTGGACACCTGG + Intergenic
946436286 2:219658021-219658043 AGCGGGAAGAGATGGGCCTGTGG + Intergenic
947729502 2:232420161-232420183 AGGGGGAGGCGCTGGGCACGGGG + Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
948945621 2:241217727-241217749 AGGGCGAAGAGCGGCGCGAGCGG - Exonic
949043288 2:241859082-241859104 ATGGGGAGGAGGTGGGCCCGTGG + Intergenic
1169667590 20:8055257-8055279 AGGGCCAGGAGCTGGGTCAGAGG + Intergenic
1172586958 20:36092193-36092215 AGGTCGGCGAGCTGGGCGCGGGG + Intronic
1173057782 20:39632931-39632953 AGGGTGCAGAGCTGAGCCCAAGG + Intergenic
1174380803 20:50154101-50154123 AGGGCGCCGGGCTGGGGCCGAGG + Intergenic
1175312025 20:58018775-58018797 AGGGAGAAGAGCTGGACGTGAGG - Intergenic
1175440221 20:58985233-58985255 TGGGGCAAGAGCTGGGCCAGGGG - Intronic
1175445949 20:59019340-59019362 AGGGCGGGGAGCTGGGCCTCTGG + Exonic
1177173216 21:17676643-17676665 AGAGAAAAGAGCTGGACCCGGGG + Intergenic
1178512828 21:33220067-33220089 AGGGCTGAGGGCTGGGCCCTGGG + Intergenic
1179929399 21:44557524-44557546 AGGGGGAGGAGCTGAGCCCAGGG + Intronic
1180197516 21:46206586-46206608 AGGGGGAAAAGCTGGCCCCCAGG + Intronic
1180762927 22:18222963-18222985 AGGGCTGGGAGCTGGGCCCTGGG - Intergenic
1180772716 22:18401584-18401606 AGGGCTGGGAGCTGGGCCCTGGG + Intergenic
1180804096 22:18651200-18651222 AGGGCTGGGAGCTGGGCCCTGGG + Intergenic
1180806679 22:18718277-18718299 AGGGCTGGGAGCTGGGCCCTGGG - Intergenic
1181310786 22:21943707-21943729 AGGGCGCAGAGCAGGGTCCCAGG - Intronic
1181532132 22:23522776-23522798 GGGGCGAGGAGCAGGGCCCCGGG - Intergenic
1183172991 22:36201671-36201693 AGGGCAGAGAGCTGGGGCCTCGG + Intronic
1183257171 22:36770114-36770136 AGGGGCAAGGGCTGGGCCTGGGG + Intronic
1183264399 22:36816637-36816659 AGGGCGAAGACCAGGGTCGGAGG - Intronic
1183368950 22:37421630-37421652 AGGGAGAAATGCTGGGCCCCGGG - Intronic
1183492252 22:38122905-38122927 AAGGAGAAGGGCTGGGCCCATGG - Intronic
1183516636 22:38270659-38270681 AAGGCCAATAGCTGGGCCCCTGG - Intronic
1183627356 22:39012833-39012855 AGCGAAAACAGCTGGGCCCGGGG + Intergenic
1184133489 22:42531999-42532021 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
1184661703 22:45968426-45968448 AGAGGGAAGAGCTGGGCCTTGGG + Intronic
1185106091 22:48870705-48870727 AGGGCCAAGGGCTGTGCCAGGGG + Intergenic
1185386593 22:50534700-50534722 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
1185408619 22:50671655-50671677 AGGGGGTAGACCTGGGCCCAGGG + Intergenic
1203234554 22_KI270731v1_random:142572-142594 AGGGCTGGGAGCTGGGCCCTGGG + Intergenic
949534694 3:4986838-4986860 GGGGCGAAGCGCTGGCTCCGGGG + Intergenic
950207518 3:11092161-11092183 AGAGGGCAGAGCTGGGCCTGGGG + Intergenic
952912545 3:38203386-38203408 AGAGAAAACAGCTGGGCCCGGGG - Intronic
954223875 3:49170785-49170807 AGGGCCAAGGTCTGGGCCTGAGG + Intergenic
954294396 3:49666108-49666130 AGGGAGAAGAGGAGGGTCCGAGG - Intronic
954784596 3:53083608-53083630 AGGGCCAAGCGCCGGGCCCTGGG - Intronic
962853434 3:139324840-139324862 AGGGCTAAGGGATGGGCCCAGGG + Intronic
963077312 3:141359151-141359173 AGGTGGAAGAGCTGGGTCCTTGG - Intronic
963236859 3:142964077-142964099 AGGGCGGAGAGATGCGCCAGCGG + Intergenic
963326911 3:143873582-143873604 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
966886468 3:184380219-184380241 AGGGCGGAGGGCCGGGCCGGGGG - Exonic
966962687 3:184955578-184955600 AGAGACAATAGCTGGGCCCGGGG - Intronic
967216167 3:187212439-187212461 AGGCCAAAGAGCTGAGCCCAGGG + Intergenic
967820368 3:193834177-193834199 AGGCAGAAGAACTGGGGCCGAGG + Intergenic
968172465 3:196521617-196521639 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
968356676 3:198113639-198113661 CGGGCCGAGGGCTGGGCCCGCGG + Intergenic
968534376 4:1113889-1113911 AGGGCCGGGAGCTGGGCCGGAGG + Intergenic
968563792 4:1298678-1298700 AGGGCCAAGGACTGAGCCCGGGG - Intronic
968724802 4:2241871-2241893 TGGGCGAGGAGCTGGGGCGGGGG - Intronic
968779699 4:2571115-2571137 AGGAGGAAGGGCTGGGGCCGCGG - Intronic
968794581 4:2694065-2694087 AGAGGGAAGAGCAGGGGCCGTGG + Intronic
968904331 4:3444591-3444613 GGGCCGAGGAGCTGGGCCAGGGG - Intronic
969149234 4:5154609-5154631 AGGGAGAAGACCTGGGACTGAGG + Intronic
980450022 4:132958722-132958744 CTGGGGAAGAGCTGGGCCCAGGG + Intergenic
983904457 4:173169271-173169293 CGGGCGGAGAGCCGGGTCCGGGG + Intronic
984255231 4:177382216-177382238 AGGAGGCAGAGCTGGGCCTGGGG - Intergenic
984952286 4:185016733-185016755 AGGGCGCAGAGCCAGGCCTGGGG - Intergenic
985552466 5:540618-540640 AGGGCGAAGGGCTGGGAAGGAGG - Intergenic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
990541119 5:56773003-56773025 AGGGCCTACAGCTGGGCACGTGG - Intergenic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
999828077 5:155293067-155293089 AGAGCTCAGAGCTGGGCCTGGGG + Intergenic
1001279834 5:170378798-170378820 AGGGAGAAGAGGAGGGCCTGGGG + Exonic
1001559151 5:172658173-172658195 AGAGAAAACAGCTGGGCCCGGGG - Intronic
1001694693 5:173661276-173661298 GGGGAGAAGAACTGGGCACGTGG - Intergenic
1002294710 5:178223963-178223985 AGCGCTAAGACCTGGGGCCGGGG - Intronic
1002614048 5:180439323-180439345 ACTGTGAAGAGCTGGGACCGTGG + Intergenic
1002939162 6:1700762-1700784 AGGTCCCAGTGCTGGGCCCGAGG - Intronic
1003324893 6:5084471-5084493 AGGGCGGAGAGGGGGCCCCGTGG - Intergenic
1005411961 6:25558785-25558807 AGGGTGAGGAGCAGGGCCCTGGG + Intronic
1005736876 6:28756190-28756212 AGGAGGAAGAGCTGTTCCCGGGG - Intergenic
1005864923 6:29930065-29930087 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1006484416 6:34326984-34327006 AGAGAAAACAGCTGGGCCCGGGG + Intronic
1006665167 6:35688509-35688531 GGGGCGGAGAGCGGCGCCCGCGG + Intronic
1007104903 6:39276977-39276999 AGAGTGAGGAGCTGGGCCTGGGG - Intergenic
1011795385 6:90947295-90947317 AGGAGGCAGAGCTGGGCCCAGGG + Intergenic
1014569827 6:122995975-122995997 AGGGCGAAGAGAGGGGCGTGGGG + Exonic
1015758443 6:136631906-136631928 ATGGAGAAGAGCTAGGCCAGAGG + Intronic
1019423155 7:960769-960791 AGAGAAAACAGCTGGGCCCGGGG + Intronic
1019492306 7:1321228-1321250 AGGGACTAGAGCTGGGCCTGGGG + Intergenic
1019623675 7:2004521-2004543 AGGGCTGAGAGCTGTGCGCGAGG + Intronic
1022446577 7:30475653-30475675 ATGGCGAAGAGAAGGGCCGGTGG + Intronic
1024295065 7:47835152-47835174 AGGGACAAGAGCTGGGCCCCTGG + Exonic
1024532371 7:50404535-50404557 AGGGAGAAGAGATGGGCCTCAGG + Intronic
1025175850 7:56802102-56802124 AGAGGCAAGAGCTGGGCCCGGGG + Intergenic
1025695943 7:63774320-63774342 AGAGGCAAGAGCTGGGCCCGGGG - Intergenic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1025929162 7:65981054-65981076 ACTGCACAGAGCTGGGCCCGGGG - Intronic
1026045242 7:66902354-66902376 AGAGGCAAGAGCTGGGCCTGTGG - Intergenic
1026045678 7:66904100-66904122 AGAGGCAGGAGCTGGGCCCGCGG - Intergenic
1026433379 7:70370333-70370355 AGGGCTGAGAGCTGGGGCAGTGG - Intronic
1027202565 7:76072882-76072904 AGAGGCGAGAGCTGGGCCCGTGG + Intergenic
1027202671 7:76073290-76073312 TGAGGCAAGAGCTGGGCCCGGGG + Intergenic
1029365125 7:100111837-100111859 AGGGAGAAGTGCTGGGCATGGGG + Intronic
1032076581 7:128838865-128838887 AGGAGGAAGAGCTGGGGCGGGGG + Intronic
1032090991 7:128911483-128911505 AGGGGGCAGGGCTGGGCCCTGGG + Intergenic
1034456355 7:151173121-151173143 AGGGAGAGGTTCTGGGCCCGCGG + Intronic
1035156743 7:156920472-156920494 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1035375574 7:158404828-158404850 AGGCCGGGGAGCTGGGGCCGGGG - Intronic
1035431988 7:158829402-158829424 GGGGCGATGAGCGGCGCCCGGGG - Exonic
1035468787 7:159096806-159096828 CGGGACAAGAGCTGGGCCTGTGG - Intronic
1036784878 8:11679583-11679605 GGGGAGAGGAGCTGGGCGCGCGG + Intronic
1037025232 8:14027716-14027738 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1037668906 8:20997615-20997637 AGGGCCCAGAGCTGGGTCCCAGG + Intergenic
1041596970 8:59666253-59666275 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
1042933873 8:74039470-74039492 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1044700033 8:94957393-94957415 AGGGCTGAAAGCTGGGCCCAGGG + Intronic
1044712700 8:95072885-95072907 TGGGGGAAGAGCAAGGCCCGAGG + Intronic
1046413816 8:113884269-113884291 AGAGAAAACAGCTGGGCCCGCGG + Intergenic
1047502764 8:125454670-125454692 AGGGGGAAGAGCATGGCCAGAGG + Intergenic
1048042803 8:130747334-130747356 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
1048986745 8:139738815-139738837 TGGGCGCAGAGCTGGTCCTGGGG + Intronic
1049148485 8:141019432-141019454 GGGGAGAAAAGCTGGGCCTGGGG - Intergenic
1049154209 8:141056983-141057005 AGGGCTCAGTGCTGGGCACGAGG + Intergenic
1049432939 8:142573689-142573711 AGGGAGATGAGCTGGGCCTGGGG + Intergenic
1049547028 8:143237422-143237444 AAGCCGAGGAGCTGGGTCCGGGG - Intergenic
1049557798 8:143291700-143291722 AGCTCGATGAGCTGGGCCGGTGG - Exonic
1049664998 8:143839108-143839130 AGGGCGCAGAGCTGAGCGGGCGG + Intronic
1049761989 8:144335962-144335984 GGGGCGGAGGGCAGGGCCCGGGG - Intronic
1049768313 8:144366188-144366210 AGAGAAAACAGCTGGGCCCGGGG - Intergenic
1049996306 9:1037238-1037260 AGGGCAAAGAGTTGGGTCCAGGG + Intergenic
1050996554 9:12227061-12227083 AGGGCTAAGAGCTAGTCCTGAGG - Intergenic
1051038348 9:12776127-12776149 AGAGCGGAGCGCTGGGCGCGTGG + Intronic
1051591251 9:18778005-18778027 AGGGCTTAGAGCTGGCCTCGGGG + Intronic
1052348778 9:27436977-27436999 AGGGGGAAGAGCTGGGAGTGGGG + Intronic
1055513397 9:77016156-77016178 GGGGTGCAGAGCTGGGGCCGCGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1059305348 9:113349590-113349612 AGGGCGCGGAGCCGGGGCCGGGG + Exonic
1059848485 9:118308924-118308946 AGGGAGAGGAGCTGGGCGCTAGG - Intergenic
1060273453 9:122164488-122164510 AAGGCCAGGAGCTGGGCCCAGGG - Intronic
1060301922 9:122378926-122378948 GGGGTGAGGAGCTGGGCCTGGGG + Intronic
1061001744 9:127906490-127906512 AGGTCTGAGAGCTGAGCCCGAGG - Intergenic
1061193528 9:129095392-129095414 GGGGCTCAGAGCTTGGCCCGGGG + Exonic
1061248402 9:129413321-129413343 GGGGCGAGGAGCAGGGCCCCGGG + Intergenic
1062088825 9:134663356-134663378 AGGGTGAAGGGCTGGGGCTGGGG + Intronic
1062324603 9:136006033-136006055 GGTGGGCAGAGCTGGGCCCGCGG - Intergenic
1062377642 9:136270220-136270242 AGAGAAAACAGCTGGGCCCGGGG + Intergenic
1062435748 9:136545942-136545964 CGGGCGCGGAGCCGGGCCCGGGG - Intergenic
1062591805 9:137277796-137277818 AGGGCGAGGGGGTGGGCCAGGGG - Exonic
1062595188 9:137296091-137296113 AGGGCGGGGGGCTGGGGCCGGGG - Intergenic
1185504006 X:619061-619083 AGAGCGCAGAGCTGGGCTCCGGG + Intergenic
1185623024 X:1464994-1465016 AGGGAGAAGAGCTGGGAATGGGG + Exonic
1187443970 X:19344330-19344352 CTGGCGCACAGCTGGGCCCGGGG - Intronic
1190308421 X:49100087-49100109 AGGGCAATGAACTGGGCCCACGG + Intronic
1195216996 X:102712521-102712543 AGGCCGACGACCTGGGCCCTGGG + Exonic
1195221137 X:102746143-102746165 AGGTCGACGACCTGGGCCCTGGG + Exonic
1198099867 X:133414599-133414621 AGGGGGGAGCGCTGCGCCCGCGG + Intronic
1201759000 Y:17518143-17518165 AGGGAGCTGAGCTGGGGCCGTGG - Intergenic
1201842555 Y:18387847-18387869 AGGGAGCTGAGCTGGGGCCGTGG + Intergenic