ID: 947754438

View in Genome Browser
Species Human (GRCh38)
Location 2:232551158-232551180
Sequence TCTCATCTGCAGAGTGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 2, 2: 11, 3: 96, 4: 536}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947754425_947754438 21 Left 947754425 2:232551114-232551136 CCAGCTTTCCCCACACACTCCCT 0: 1
1: 0
2: 5
3: 72
4: 646
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754428_947754438 11 Left 947754428 2:232551124-232551146 CCACACACTCCCTCTCCCCTCTG 0: 1
1: 0
2: 15
3: 161
4: 1406
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754431_947754438 -4 Left 947754431 2:232551139-232551161 CCCCTCTGAGCCTCAGTTTTCTC 0: 81
1: 777
2: 2868
3: 6585
4: 11343
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754429_947754438 2 Left 947754429 2:232551133-232551155 CCCTCTCCCCTCTGAGCCTCAGT 0: 1
1: 9
2: 73
3: 410
4: 1462
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754430_947754438 1 Left 947754430 2:232551134-232551156 CCTCTCCCCTCTGAGCCTCAGTT 0: 2
1: 9
2: 86
3: 421
4: 1449
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754426_947754438 13 Left 947754426 2:232551122-232551144 CCCCACACACTCCCTCTCCCCTC 0: 1
1: 1
2: 22
3: 253
4: 2328
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754427_947754438 12 Left 947754427 2:232551123-232551145 CCCACACACTCCCTCTCCCCTCT 0: 1
1: 2
2: 5
3: 138
4: 1131
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754433_947754438 -6 Left 947754433 2:232551141-232551163 CCTCTGAGCCTCAGTTTTCTCAT 0: 23
1: 198
2: 706
3: 1734
4: 3362
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754424_947754438 30 Left 947754424 2:232551105-232551127 CCTCTGAATCCAGCTTTCCCCAC 0: 1
1: 0
2: 0
3: 27
4: 305
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536
947754432_947754438 -5 Left 947754432 2:232551140-232551162 CCCTCTGAGCCTCAGTTTTCTCA 0: 15
1: 127
2: 556
3: 1347
4: 2777
Right 947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG 0: 1
1: 2
2: 11
3: 96
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947754438 Original CRISPR TCTCATCTGCAGAGTGGGGA CGG Intronic
900469832 1:2848286-2848308 TCAGCTCTGCAGAGAGGGGAGGG - Intergenic
900555419 1:3278003-3278025 TCTCATCTGAAAAGGAGGGAGGG + Intronic
901021734 1:6259563-6259585 TCCCATCTGCAGTGTGGGGACGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901761705 1:11476233-11476255 TCTCATCTATAAAGTGGGGATGG - Intergenic
901836063 1:11925144-11925166 TCACCTCTGCAGACTTGGGAGGG + Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902818042 1:18927220-18927242 TCCCACCTCCAGAGTTGGGAGGG + Intronic
902873625 1:19328449-19328471 TCCCACCTGCAGCGTGGGGGTGG + Intronic
902892048 1:19451602-19451624 TCCCATCTGCAGGGTGGGGATGG - Intronic
903000900 1:20264992-20265014 TCTAACCTGTAAAGTGGGGATGG + Intergenic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903286909 1:22283028-22283050 TCACAACTTGAGAGTGGGGAGGG - Intergenic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903825214 1:26139885-26139907 TCTCATCTGCAAACTGGGAGAGG - Intergenic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905340963 1:37277234-37277256 TCCCATCTAAAGAGTTGGGATGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
906543356 1:46604787-46604809 TCGCAGCTGCAGACTTGGGAAGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907400193 1:54220470-54220492 GCTGATCTGCAAAGTGGGGCAGG + Intronic
907457744 1:54586216-54586238 TCTCATCTGCAGAATGGATGGGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
909378957 1:74974981-74975003 ACTCATCTCCAGATTTGGGATGG - Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911503427 1:98717777-98717799 TCTCATAAGCAGTGTGGGTAGGG + Intronic
912254862 1:108048303-108048325 TCTCCACTGGAGATTGGGGAGGG - Intergenic
912551540 1:110488391-110488413 CCTCATCTGAAGCGTGGGGTAGG + Intergenic
914521725 1:148423463-148423485 TGTCAACTGCAGAGCAGGGAAGG - Intergenic
915627453 1:157124100-157124122 TCTCAGCTGCATAGTTGGGACGG - Exonic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
917791651 1:178502987-178503009 GGTCATCTGCATAGTGTGGATGG - Intergenic
918292833 1:183125519-183125541 TACAATCTGCAGAGTGGGCAAGG + Exonic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920690679 1:208144277-208144299 TCTTATTGGCCGAGTGGGGAAGG + Intronic
922091584 1:222400589-222400611 TATTCTCTGCAGGGTGGGGAAGG - Intergenic
923622177 1:235588143-235588165 TCTCCTCTGCGGAGAGGGTAGGG - Intronic
924227632 1:241935005-241935027 TTTCAGCTGCAGAGTGGACATGG - Intergenic
924384758 1:243490590-243490612 TCTCCTCTGCACAGTGGGCATGG + Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
924740280 1:246790860-246790882 TCTCATGTGCACAGGAGGGAAGG + Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1063712084 10:8489417-8489439 TCTCATATGCAGTGTGAGGATGG + Intergenic
1064220096 10:13432932-13432954 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1066023847 10:31331634-31331656 TCTTATATGCATAGAGGGGATGG + Intronic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068698031 10:59989932-59989954 TCTTACCAGCAGAGAGGGGAAGG + Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069627290 10:69876187-69876209 TCTCATCGGAAGAGTAGGGGTGG - Intronic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070774490 10:79101844-79101866 TCACATCCTCAGAGAGGGGAGGG - Intronic
1070848348 10:79542108-79542130 TCTGATCTCCAGCCTGGGGAGGG + Intergenic
1070925437 10:80218061-80218083 TCTGATCTCCAGCCTGGGGAGGG - Intergenic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072916681 10:99541032-99541054 TCTCACCTGCAGAGTCGGCTAGG - Intergenic
1073029205 10:100511367-100511389 TTTCATTTGCAGAGTAGAGATGG - Intronic
1073131077 10:101189672-101189694 TCCCTTCTGCAGAGCAGGGATGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1076132037 10:128019849-128019871 TCTCATCTGGGCAGTGAGGATGG + Intronic
1076849383 10:133085746-133085768 TCTCATCTCCAGGGTGGTGCTGG - Intronic
1077494546 11:2880560-2880582 TCTCAGCTGCTGGGTGAGGAAGG - Intergenic
1077844251 11:6007377-6007399 TCTAATGTGAAGTGTGGGGATGG + Intergenic
1078131492 11:8617848-8617870 TATCCTCTTCAGAGTGTGGATGG - Exonic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080752587 11:35164693-35164715 TCTCCTCTGCAGAGTGAGCAAGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080913083 11:36625406-36625428 TCTTATCTGTAGAGTGGTGAGGG - Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081617059 11:44597336-44597358 TCCCATCTGGGGATTGGGGAAGG + Intronic
1081881518 11:46456911-46456933 TGTCATGTGCTGAGTGGGGGCGG - Intronic
1082088650 11:48070579-48070601 TCTCATCTCCATAGTGTGGGTGG + Intronic
1082641186 11:55663551-55663573 TCTCATCTGCAGTATAAGGATGG - Intergenic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1082890879 11:58137403-58137425 TCTTATCTGCAGGGATGGGAGGG - Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275542 11:61595078-61595100 TCTCATCTGTAAAGTAGGGGCGG + Intergenic
1083856683 11:65396502-65396524 CTTCCTTTGCAGAGTGGGGATGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084216238 11:67648390-67648412 TCTCAAGAGCAAAGTGGGGAAGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087151746 11:94866277-94866299 ACTCATCTGTGAAGTGGGGAGGG + Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087961025 11:104349407-104349429 TTTCATGTACAGAGAGGGGAGGG + Intergenic
1088824058 11:113478750-113478772 TCTCATCTGAAAGGTGGGGAAGG + Intergenic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1090491873 11:127171053-127171075 TCTCATTGGCAAAGTAGGGATGG - Intergenic
1090793799 11:130116585-130116607 TCTCAGCTGCAGGGTGGAAAGGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091374914 12:18853-18875 TCGCCTCTGCAGAGGGGGAATGG + Intergenic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1093652170 12:21657982-21658004 CCTCATCTGGAGGGTGGGGGAGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1096525897 12:52210162-52210184 TGTCATCTGTAAAGTGGGGCTGG + Intergenic
1096655218 12:53086059-53086081 TCTTATCTACAAAGTGGAGATGG + Intergenic
1097092588 12:56519045-56519067 TCCCAGCTACAGGGTGGGGAGGG + Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098890544 12:76006125-76006147 TCTCATCTTCAGAATAGGGATGG - Intergenic
1099541359 12:83912357-83912379 TTTCATCTGCAGAGTGCAGGTGG + Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG + Intergenic
1101593413 12:106141853-106141875 TCTAATCTGCAAAGTGGCGATGG + Intergenic
1101800340 12:108016384-108016406 GCTTATCAGCAGGGTGGGGATGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102569218 12:113817446-113817468 TCCCCTCTGCAGAGTGGGCCCGG + Exonic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103535458 12:121630639-121630661 TCTCATCTGCAGATCAGAGAGGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1106418212 13:29563757-29563779 TCTCATCCATAAAGTGGGGATGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1110466963 13:75813397-75813419 TCTCACCTGCTAAGTGAGGAAGG - Intronic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112776293 13:102846920-102846942 TCTCATCTGCAAAGTAGAGGTGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114634163 14:24178074-24178096 CCTCCTCTGTTGAGTGGGGAGGG - Exonic
1114710689 14:24774957-24774979 TCTATACTACAGAGTGGGGAGGG - Intergenic
1114738641 14:25070152-25070174 TCTCATCTGGAGTCTGGGGGTGG + Intergenic
1115482132 14:33870917-33870939 TCTCATCTGCCAATTGGGGGTGG - Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118032310 14:61830640-61830662 TCTCAACTAGAGAGTGAGGAAGG - Intergenic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118837927 14:69489702-69489724 TCTCATCTATAGAGTGGGAATGG + Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119473388 14:74912883-74912905 ACTCATCTGCATGGTGGGCAGGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124223179 15:27867050-27867072 TCTCAACTGCACACTGGGAATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125458402 15:39884830-39884852 ACTCTTGTGCAGAGTGGGGGTGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1125754399 15:42053121-42053143 TCTCACCTGCACAGTGGGGTGGG - Intergenic
1126230825 15:46321921-46321943 TCTCATCAGCTGAGAGGAGAAGG + Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128186227 15:65645418-65645440 TCTCATCTGCAGATAGGTCAGGG + Intronic
1128238206 15:66081677-66081699 TCTCATCTTTAAAGTGGGAAGGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129952169 15:79601499-79601521 TCTCCTCTGCAGCCTGGGGAGGG - Intergenic
1130081394 15:80737034-80737056 TCCCATATGCTGAGTGGGAATGG + Intronic
1130430854 15:83845550-83845572 TTTCATCTGCACAGTGAGCATGG + Intronic
1130862170 15:87900831-87900853 TCTCATCTGCATAATTGGTAGGG + Intronic
1131317191 15:91349738-91349760 TGCGATCTGCAAAGTGGGGATGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132307842 15:100830565-100830587 TCTCAGCTGGAGATCGGGGAGGG - Intergenic
1132343348 15:101091772-101091794 TCCCATGTGCACAATGGGGATGG - Intergenic
1132422533 15:101684660-101684682 ACTCATGAGCAGAGTGGGCAGGG - Intronic
1132435253 15:101795409-101795431 TGTCGGCTGCAGAGTGGAGATGG - Intergenic
1132464207 16:70299-70321 TCCCACCTGCAGCCTGGGGAGGG - Intronic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132833307 16:1940366-1940388 CCTCCTCTGCAGAGTGGCGGTGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1133985443 16:10664815-10664837 TCTCATCTGCTGATGTGGGAGGG - Intronic
1134050189 16:11131827-11131849 TGTCATCTGCAGAGAGCCGAGGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134100655 16:11449348-11449370 TCTCCTCTTCAGTTTGGGGAGGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134833989 16:17346285-17346307 TCTCACCTGCAAAGTGGACAAGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135797841 16:25462633-25462655 TGTCATCTGCACAGTGGGTAGGG + Intergenic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136928256 16:34395343-34395365 TCTCACCTGTGAAGTGGGGATGG - Intergenic
1136976318 16:35016461-35016483 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138272811 16:55708271-55708293 TCTCATCTGTCCAGTGGGCACGG - Intergenic
1138310632 16:56020542-56020564 TCCAATCTGTAGTGTGGGGATGG + Intergenic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139464258 16:67145758-67145780 CCTAATGTGCAGAGTGGGGCAGG - Intronic
1139662408 16:68430048-68430070 CCAAATCTGCAGAGTGGGGTTGG + Intronic
1139939215 16:70592372-70592394 TCTCATGGGCAGAGAGAGGAGGG - Intronic
1139967360 16:70753261-70753283 TCTCATTAGCAGTGGGGGGACGG + Intronic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1141993400 16:87622745-87622767 TCTCAGCGGCAGGGTGGGGCGGG - Intronic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142590602 17:1003944-1003966 TCCCACCCCCAGAGTGGGGAGGG - Exonic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143510220 17:7391308-7391330 TCTAATCTGCAAAGTAGGGGAGG + Intronic
1143960102 17:10709966-10709988 TTTCATCTGAAAAGTGGGTATGG + Intronic
1143995643 17:11004120-11004142 CCTCATCTGAAGTGTGGAGAAGG - Intergenic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145973421 17:28970285-28970307 TCTCATCTGTAAAGTAGGGATGG + Intronic
1145987247 17:29055251-29055273 TCCCTTCTGTAGAGTGGTGAGGG - Intronic
1146105717 17:30034289-30034311 ATTCATCTGCAGAGTGGCAAAGG - Exonic
1146558298 17:33846474-33846496 TCTGATCTGCAGAGTGGGATGGG + Intronic
1147551746 17:41448023-41448045 TCTCATCTGCAATGAGAGGAGGG + Intergenic
1147595624 17:41715415-41715437 TCTCGTCTGCAAAGGGGAGAAGG - Exonic
1147743580 17:42682215-42682237 TTTCATCTGCAAAGTGGAGTAGG + Intronic
1147817637 17:43221520-43221542 GCTCATCTGCATTTTGGGGATGG + Intergenic
1148591995 17:48823362-48823384 TCACATATGAAGAGTGGGGGAGG - Intergenic
1148988610 17:51646217-51646239 TCCCATCTGTAAACTGGGGATGG + Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149081314 17:52660991-52661013 TCTCATTTGGATATTGGGGATGG + Intergenic
1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG + Intergenic
1151224146 17:72636278-72636300 TCTCATCAGCACAGTGGGGCTGG - Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1151555870 17:74846430-74846452 CCTCCTCTGCAGAGTGGCCAGGG + Intronic
1152021810 17:77783757-77783779 TTTCATTTGCACAGTGGGCAGGG - Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1153791688 18:8584890-8584912 TTTCATCTGCAGAGCGGGACGGG - Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154486689 18:14877618-14877640 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1155311954 18:24532787-24532809 TCTCCTCTCCAAAGTGGAGAGGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156877815 18:42037347-42037369 TCTCTTCTGCAGAGTTGCTAAGG - Intronic
1157244331 18:46040204-46040226 TTTCATCTCCAGGGTGGGGGTGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157796766 18:50582043-50582065 TCTCATATGTAAAGTGGAGAGGG + Intronic
1160797895 19:954189-954211 ACCCAACTGCTGAGTGGGGAAGG + Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161487216 19:4542890-4542912 TTCCCTCTGCAGAGTGGGGGGGG + Exonic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1164247908 19:23449612-23449634 TCTTATCTGCATAGTGGTGGAGG - Intergenic
1164248932 19:23459878-23459900 TCTCATTTGCTAAGTTGGGATGG + Intergenic
1164790394 19:30972572-30972594 TGTCATCTGCAGAGGGGGCTAGG - Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1168124699 19:54277060-54277082 TTTCATCTGTAGAGTGGGTGGGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925635487 2:5937904-5937926 TCTCATCAGCACAGTGAGGGAGG + Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
925925384 2:8666399-8666421 TCTCATCTTCCGAGGGGGGCAGG + Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926363540 2:12112627-12112649 TCGCATTTGTAAAGTGGGGATGG + Intergenic
927695995 2:25240211-25240233 TCTCATCTGCATTGTGGAGCTGG - Intronic
928314969 2:30237913-30237935 GCTCACCAGCTGAGTGGGGAGGG + Intronic
928399989 2:30970881-30970903 GCTCATCTGTGGAGTGGGGGCGG - Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931821256 2:65954656-65954678 TCACATCTGTGGTGTGGGGAGGG - Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
933840277 2:86280969-86280991 CCTCATCTGAACAGTGGGGTGGG - Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935127146 2:100234671-100234693 TCTCATCTGCAACGTGTGGTTGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935925972 2:108068769-108068791 TCTCCTCTGCAAAGTGCGGGTGG + Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937129546 2:119497244-119497266 TGACACCTGCAGAGTGGGGGAGG - Intronic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
938509208 2:131922787-131922809 GCTCAATGGCAGAGTGGGGATGG - Intergenic
938628273 2:133135735-133135757 TTTCCTCTGCATACTGGGGACGG + Intronic
938768829 2:134482648-134482670 TCTCATCTGCTGGTTGGGGGTGG - Intronic
938786129 2:134631533-134631555 TCTCATCTGTAAAGTGGGCCTGG - Intronic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941014666 2:160341518-160341540 TCTCATCTTCACTGTGAGGAGGG + Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
944051551 2:195475720-195475742 CCTCAGCTTCACAGTGGGGAAGG - Intergenic
944399896 2:199313558-199313580 TCTCACCTGCATAGTTGGAAGGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945147155 2:206750334-206750356 TTTCATCTGCAAAGTGGAAATGG - Intronic
945147160 2:206750401-206750423 TTTCATCTGCAAAGTGGAAATGG + Intronic
945689536 2:213016232-213016254 TCTCATCTGTACAGTGAAGATGG - Intronic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
946009863 2:216555663-216555685 TTGCATCTGCAGCCTGGGGAGGG - Intronic
946414322 2:219531984-219532006 TCTCATCTGCACAGCAGAGATGG - Exonic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947917917 2:233846550-233846572 TATCCTCTGCTGAGTGGGGCTGG + Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169072554 20:2742249-2742271 TCTCATCCGTAAAGTGGGAATGG + Intronic
1169152962 20:3304976-3304998 TCTCAGCTGAAGACTGGTGAAGG + Intronic
1169782768 20:9327035-9327057 TCTCATCTGTAAGGTAGGGATGG + Intronic
1170159890 20:13300090-13300112 TCTCTTCTTCAGACTGGGTAGGG + Exonic
1170652713 20:18257364-18257386 TCAGATCTGGAGAGTGGGGAGGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1170876838 20:20257952-20257974 TATCTTCTGCAGTGTTGGGAAGG - Intronic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172886797 20:38236726-38236748 TCTCAGTGGCACAGTGGGGAAGG + Intronic
1172943741 20:38672594-38672616 TCTAAACTGCAGTTTGGGGAGGG + Intergenic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173175581 20:40762567-40762589 TCTCATCACTAAAGTGGGGAAGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174357980 20:50010677-50010699 TCTCATCTGTCAAGTGCGGATGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174411430 20:50339258-50339280 TCTAATTTGCAGAGTGGCCAGGG - Intergenic
1174412122 20:50343149-50343171 TCTCACCTTGAAAGTGGGGATGG - Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174993896 20:55544104-55544126 CCTCAACTGCAAGGTGGGGAAGG + Intergenic
1175147242 20:56906139-56906161 TCTCTCCTGGAAAGTGGGGATGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175803464 20:61814076-61814098 GCCCATGTGCAGCGTGGGGAGGG + Intronic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176265103 20:64205149-64205171 CTCCATCTGCAGAGTGGGCAGGG - Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176794613 21:13361781-13361803 TCTCATCTGTTCAGTGGGGATGG + Intergenic
1177026933 21:15932076-15932098 TGACACCTGCAGAGTGGGGTGGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177982326 21:27929614-27929636 GCTCAATGGCAGAGTGGGGATGG + Intergenic
1179246178 21:39636139-39636161 TCTCATCTTTAGAGCAGGGATGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180999599 22:19981856-19981878 TCCCACCTGCAGAGTGGACATGG - Intronic
1181055298 22:20258089-20258111 TCTCCTCTGTGGGGTGGGGATGG - Intronic
1181325925 22:22045868-22045890 TGTCATCTGAAGAGCCGGGAGGG - Intergenic
1181345177 22:22214836-22214858 TCTCACCTGCAGAGTGAGTGAGG - Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181833924 22:25586605-25586627 TCACCTCTGCAGAGTTGGGGAGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183139010 22:35918405-35918427 TCTCAGCTGTAGAGTTTGGAGGG - Intronic
1183430974 22:37765593-37765615 TCTCCTCTGGAGGCTGGGGAAGG + Intronic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183697022 22:39429223-39429245 TCTCATCAGCTGGGTGGGGACGG - Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184089341 22:42284080-42284102 TCACCTCTGCAGGGTGGAGATGG + Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184355945 22:43979660-43979682 ACACATCTGCAGTGTGGAGAAGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184911604 22:47539009-47539031 TGCCATCTGCAGAGAGGGAAAGG - Intergenic
1184964750 22:47963113-47963135 TTTCATCTGCAGAGGGGTAAGGG + Intergenic
949247846 3:1946449-1946471 TCTCATCTGTGGAGTGAGAATGG + Intergenic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950388015 3:12675137-12675159 TCTCTTCTGCACAGAGGGGCTGG + Intergenic
950438632 3:12994633-12994655 TCCCATCTGCGAACTGGGGACGG - Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
951194768 3:19811952-19811974 CCTCATGTGCACTGTGGGGAGGG + Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
952523157 3:34182851-34182873 TCACATCTCCAGAGTGAGAAAGG + Intergenic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
953549212 3:43887764-43887786 TCTCTTCTGCAGAGTTTGTAGGG - Intergenic
953642482 3:44722160-44722182 TCTCATATGCTGAGTGAGGCAGG - Exonic
953716606 3:45321382-45321404 TCTCATCAGCACGATGGGGAGGG + Intergenic
953800548 3:46019497-46019519 TCTAATTTGCAGATTAGGGAGGG + Exonic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953958139 3:47247076-47247098 CCTCACCTGCCTAGTGGGGAGGG - Intronic
954117423 3:48474899-48474921 CCTCTTCTGCATGGTGGGGAGGG - Intronic
954447620 3:50555182-50555204 TCAAATCTGCAGACAGGGGAGGG - Intergenic
954512571 3:51139242-51139264 ACTCAACTGCAGTGGGGGGAGGG + Intronic
954783390 3:53076098-53076120 TAACATCTGCAGTGTGGGGCAGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955772488 3:62399619-62399641 TCTCATCTCCATGATGGGGAGGG + Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956703029 3:71975591-71975613 TCTCATCTATACAGTGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957569180 3:81924488-81924510 TCTTATCTACAAATTGGGGAGGG - Intergenic
958440744 3:94153442-94153464 TGTCAGCTGCAGAGTGGCCAGGG + Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
961360619 3:126364965-126364987 TCTCATGAACAGAGTGGGGAGGG + Intergenic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
961814998 3:129544816-129544838 TCCCATCCGTACAGTGGGGACGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961931379 3:130537284-130537306 TCTCATCTGTAAAGTGGGTCTGG + Intergenic
964307446 3:155356498-155356520 TGTCTTCTGGGGAGTGGGGAAGG + Intergenic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966935351 3:184704503-184704525 TCTCATCTCCATTGTGGGGTGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968609093 4:1549066-1549088 TCTCACCCGCAGAGCGGGGAGGG - Intergenic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968629990 4:1645359-1645381 TCTCTTCTGCAGGGTTGGGAGGG - Intronic
969192160 4:5531067-5531089 GCTCCTCTGCAAAGTTGGGAGGG - Intergenic
969267088 4:6071584-6071606 TCCCATTTGCAGACTTGGGAAGG - Intronic
969295386 4:6267500-6267522 TCTGATTTGGTGAGTGGGGAAGG - Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
972397737 4:38672291-38672313 TCTCCTGTGGGGAGTGGGGAGGG + Intronic
972573755 4:40333418-40333440 GCCCAGCAGCAGAGTGGGGATGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
975743373 4:77452342-77452364 GCTCCTCTGCAGAGAGGGGGAGG + Intergenic
976380111 4:84389448-84389470 TCTCAGCTGGAGAGTTGGGCAGG - Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
979396031 4:120190307-120190329 TCTCATTTATAGAGTGGGTATGG + Intergenic
979866224 4:125757975-125757997 TCACATTTTCAGGGTGGGGAGGG + Intergenic
981576241 4:146208738-146208760 TCTCATCTGTAAAGTGGAAATGG + Intergenic
982097836 4:151939144-151939166 TCTCATCTGCGTAATGGGAAAGG - Intergenic
984526625 4:180866234-180866256 TGTCACCTGCAGAGTGGCAAGGG + Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
985119976 4:186630714-186630736 TCTCATCTACAAAGTGGGGGTGG - Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
986637704 5:9839187-9839209 GCACAGCTGCAGAGTGGGCAGGG + Intergenic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990970809 5:61503663-61503685 TCTCATCTTCAAAGTGGCGGGGG - Intronic
991127206 5:63082889-63082911 GCTCCTCTGCAGAGAGGGGGAGG - Intergenic
993177292 5:84503050-84503072 ACTCAGCTGCTAAGTGGGGAAGG - Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
996815103 5:127565805-127565827 TCTCATCTACAAAGTGGGTATGG - Intergenic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997384040 5:133458634-133458656 TCCCATCTGTGGACTGGGGATGG + Intronic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
997778995 5:136638348-136638370 TTTCATCTGTAGACTGGAGATGG - Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998078271 5:139253968-139253990 TCTCATGAGCAGACTGGGGTAGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998867141 5:146516708-146516730 TCATCTCTGCAGAGTGGGTAGGG - Intergenic
999079752 5:148831928-148831950 TCTCAGCTCCAAAGTTGGGAAGG + Intergenic
999143628 5:149378837-149378859 TCCCATCTGGAGAGTGAGGGAGG - Intronic
999185039 5:149700914-149700936 TGTCCTCTGCAGAGCGGAGATGG - Intergenic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000925652 5:167190741-167190763 TCTCATCTGCAGTGTTGAGGGGG + Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001206975 5:169773086-169773108 TCAGATCTCCAGAGTGTGGAAGG - Intronic
1001227456 5:169957485-169957507 TCTCATCTGTTCAGTGGGAATGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001680377 5:173552739-173552761 TCTCCTGTACAGAGTGGAGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1002337967 5:178493508-178493530 TGTCATGTGCAGAGTAGGGCAGG - Intronic
1003871384 6:10405409-10405431 TTTGAACTGCGGAGTGGGGAGGG + Intronic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1006301208 6:33194309-33194331 TCCCATCTGAAGAGTGGAAATGG - Exonic
1007403094 6:41615792-41615814 TCTCATCTGTAAAGTGGAGCTGG + Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013453684 6:110310447-110310469 TCTCATGTCTGGAGTGGGGAAGG - Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014550133 6:122780475-122780497 CTTCTTCTTCAGAGTGGGGATGG + Intronic
1014797534 6:125743854-125743876 GCTCAACTGCACAGTGGAGAAGG - Intergenic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017753918 6:157513812-157513834 CCTCATCTTCAGAGTCCGGAAGG - Intronic
1018792241 6:167157525-167157547 CCTCAGCCGCAGCGTGGGGATGG - Exonic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1019920914 7:4162936-4162958 TCCCAGCTGAAGAGTGGGGCGGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022237002 7:28471691-28471713 GATCATCTGCAGAGTGAGGCAGG + Intronic
1023225160 7:37961442-37961464 TTTCATGAGCAGAGTGGGGTAGG - Intronic
1023524966 7:41092662-41092684 TCCCAACTGCGGGGTGGGGAGGG - Intergenic
1024039074 7:45535517-45535539 TCTCAGGTGGAGAGTGGGGTGGG + Intergenic
1024089478 7:45923258-45923280 TATCATCTGGAGAGTGGACAGGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024336864 7:48217622-48217644 TCTCATCTTCAAACTGAGGAAGG + Intronic
1025625740 7:63219686-63219708 GATTAACTGCAGAGTGGGGAGGG + Intergenic
1025656379 7:63523487-63523509 GATTAACTGCAGAGTGGGGAGGG - Intergenic
1026631189 7:72039654-72039676 CCACAGCTGCACAGTGGGGAAGG - Intronic
1026849768 7:73717478-73717500 TCCCATCTGTGAAGTGGGGATGG - Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028367534 7:90050993-90051015 TCTCAACTTCAGATGGGGGAGGG + Intergenic
1028866845 7:95723313-95723335 TTTCATCTGGAAAGTGGTGAAGG + Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031945075 7:127831158-127831180 TCTCATCAGCAGAGTAGAAAAGG - Intronic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033516094 7:142108102-142108124 TCTCATGTGCAAATTTGGGAGGG - Intergenic
1035309371 7:157955422-157955444 TCTCATCAGCAGCCAGGGGAGGG + Intronic
1035344137 7:158187421-158187443 TTTCATCAGCTGAGAGGGGAGGG + Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036179709 8:6573749-6573771 TCTGCTCTGGAGAGTGGGGTGGG - Intronic
1036238804 8:7065413-7065435 TCTCATGTGCAGGGTGGGAGAGG - Intergenic
1036455025 8:8898981-8899003 GCTCATCAGCATGGTGGGGATGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037720407 8:21439019-21439041 TCTCACCTGTATAGTAGGGATGG + Intergenic
1037890025 8:22619133-22619155 TCTCCTCTGCAAGGTGGAGAAGG - Exonic
1037994621 8:23343341-23343363 TCTCATCTGTAAGGTGGGGATGG - Intronic
1038017810 8:23529639-23529661 TCTCAGCTCCAGCGTGGTGAGGG - Intronic
1038030444 8:23634353-23634375 TCTCTACTCCTGAGTGGGGATGG + Intergenic
1038214102 8:25545855-25545877 TCTGATCTTCAGCATGGGGAGGG - Intergenic
1038409294 8:27345616-27345638 TCATATCTGCAGGCTGGGGAAGG - Intronic
1038664676 8:29527983-29528005 TCTTATCTGTAAAGTGGGAAAGG + Intergenic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1039207168 8:35169998-35170020 ACTGATCTGAAGAGTGGGAATGG + Intergenic
1039387372 8:37148017-37148039 GATCATCAGCAGAGCGGGGACGG + Intergenic
1042224380 8:66504138-66504160 TCTTCTCTGCACAGTGGGGAGGG - Intronic
1042326226 8:67530786-67530808 CCTCAGCTAAAGAGTGGGGATGG + Intronic
1042470317 8:69179847-69179869 TCCCATCTGCAAAGCAGGGAAGG + Intergenic
1043804003 8:84647927-84647949 TCTCATCTGTAATTTGGGGAAGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044251308 8:90006549-90006571 TCTCATCTGTTGAGAGGTGATGG + Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045379879 8:101612449-101612471 TAGCATCTTCAGAGTGTGGATGG + Intronic
1046635317 8:116668988-116669010 TCTCATCTCCATATTGGCGACGG + Intronic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047599592 8:126412936-126412958 TCTCATCTGGAGAGAGCAGAGGG - Intergenic
1047939915 8:129819724-129819746 TCCCAAGAGCAGAGTGGGGAGGG + Intergenic
1048160286 8:132014224-132014246 TCTCATCTGTAAAGTGAGCATGG + Intergenic
1048925461 8:139267244-139267266 TCTCAGCAGCGGAGTTGGGATGG + Intergenic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1048992659 8:139770377-139770399 GCTCCTTTGCAGAGCGGGGAAGG + Intronic
1049098001 8:140560209-140560231 TCTCACCTGCAGTGTTGGGTGGG - Intronic
1049161100 8:141098458-141098480 TCTCATCTGTAAAGTGGGTGGGG - Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049359527 8:142205694-142205716 TCCCATCTGGAAAGTGGGGTTGG + Intergenic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049628799 8:143639839-143639861 CCTCATCAGCACTGTGGGGAGGG + Intronic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053854154 9:42320572-42320594 TCACTTCTCCAGAGTGGGCATGG - Intergenic
1053887620 9:42656395-42656417 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054226642 9:62463845-62463867 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1055982098 9:82014205-82014227 TGACATCTGGAGAGTGTGGAGGG + Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056273638 9:84971489-84971511 TTTCCTCTGCCCAGTGGGGAAGG - Intronic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1056829408 9:89902676-89902698 TCTTTCCTGCACAGTGGGGAGGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059049898 9:110912800-110912822 TCTCATCTGGAGGGTGAAGAAGG - Intronic
1059319923 9:113461594-113461616 TGTTAGCTGCAGAGTGGGGCAGG + Intronic
1059651475 9:116319679-116319701 TCTCATCTGCAGAATGGACTGGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1060801886 9:126550176-126550198 TCAAATCTGTAAAGTGGGGATGG - Intergenic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1060990595 9:127846654-127846676 TCTCGTCTGCGGGGTGGGGGCGG - Intronic
1061079174 9:128360100-128360122 TCCCATCTGCAAAGTAGGGGTGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062053335 9:134458333-134458355 GCCCACCTGCAGAGTGGGAAGGG - Intergenic
1062107438 9:134763681-134763703 TCTCCTCTGCAGGGTGACGACGG + Exonic
1062255358 9:135618239-135618261 CCACATCTGTAGAGTGGAGACGG - Intergenic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1185632299 X:1524128-1524150 TCTCATCTGCAATGTAGCGATGG + Intronic
1185704987 X:2260206-2260228 TCTTATATGTAGAGTGGGGTCGG + Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186805672 X:13138479-13138501 TTTCATCTGTACAGTGGGAATGG + Intergenic
1188001607 X:24987762-24987784 TCCCTTCTGCACACTGGGGAAGG - Intronic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190051825 X:47156270-47156292 TATCACCTTAAGAGTGGGGAAGG - Intronic
1190516611 X:51230204-51230226 CCTCATCTGTTGAGTGGGGCAGG - Intergenic
1190735923 X:53256053-53256075 TCTCATCCCCACAGTGTGGAGGG - Exonic
1191866354 X:65706848-65706870 TCTCATCTATGAAGTGGGGATGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192441645 X:71179026-71179048 TTTCATGTGGGGAGTGGGGAGGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193759964 X:85452617-85452639 TTAAATCTCCAGAGTGGGGAGGG + Intergenic
1195125214 X:101802223-101802245 TCTCTTCTGCAGAGAAGGCAAGG - Intergenic
1195179526 X:102343426-102343448 TCTCTTCTGCAGAGAAGGCAAGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198796130 X:140397140-140397162 TCTCCTCTCCAGAGAGGTGAGGG - Intergenic
1199246734 X:145613591-145613613 TGTCATTTTAAGAGTGGGGAAGG - Intergenic
1199853246 X:151740070-151740092 TCTCATCTCCACTGTGGGCAAGG + Intronic
1200909256 Y:8516185-8516207 TCTCAGCAGGAGAGTTGGGAAGG - Intergenic
1202196858 Y:22306367-22306389 TCTCAGCGGGAGAGTTGGGAAGG - Intergenic