ID: 947755832

View in Genome Browser
Species Human (GRCh38)
Location 2:232564330-232564352
Sequence AGGAATTAAACCCATGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947755826_947755832 13 Left 947755826 2:232564294-232564316 CCTGACAGGCCACAGTGACTTCC 0: 1
1: 0
2: 2
3: 21
4: 229
Right 947755832 2:232564330-232564352 AGGAATTAAACCCATGTGGGAGG 0: 2
1: 0
2: 0
3: 11
4: 155
947755829_947755832 -8 Left 947755829 2:232564315-232564337 CCATCTCTTCAAAGAAGGAATTA 0: 1
1: 0
2: 1
3: 68
4: 759
Right 947755832 2:232564330-232564352 AGGAATTAAACCCATGTGGGAGG 0: 2
1: 0
2: 0
3: 11
4: 155
947755827_947755832 4 Left 947755827 2:232564303-232564325 CCACAGTGACTTCCATCTCTTCA 0: 1
1: 1
2: 2
3: 86
4: 455
Right 947755832 2:232564330-232564352 AGGAATTAAACCCATGTGGGAGG 0: 2
1: 0
2: 0
3: 11
4: 155
947755825_947755832 21 Left 947755825 2:232564286-232564308 CCTGGGGACCTGACAGGCCACAG 0: 1
1: 0
2: 2
3: 29
4: 284
Right 947755832 2:232564330-232564352 AGGAATTAAACCCATGTGGGAGG 0: 2
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947755832 Original CRISPR AGGAATTAAACCCATGTGGG AGG Exonic
902665018 1:17931394-17931416 AGGAATTACAGCCATGGAGGCGG - Intergenic
903734266 1:25520197-25520219 CGGAATTAAAACCCAGTGGGAGG + Intergenic
906016235 1:42582859-42582881 AGGAATTTTACACAAGTGGGAGG - Intronic
906066475 1:42984717-42984739 AGAAATAAAACCCTTGTGGGTGG + Intergenic
907171134 1:52466267-52466289 AGGAAGCCAACCAATGTGGGAGG + Intronic
909609795 1:77539965-77539987 AGGAATTAAAGCCACAGGGGGGG + Intronic
909893183 1:81033771-81033793 AGGTAATAAACCTATGTAGGGGG + Intergenic
911718632 1:101165617-101165639 AAGAATCAATCGCATGTGGGTGG + Intergenic
915145845 1:153795335-153795357 GGGAATCAAAGCCATGGGGGAGG + Intergenic
916851565 1:168709735-168709757 GGGAACTGGACCCATGTGGGTGG - Intronic
920706829 1:208257566-208257588 AGGAAGGAAACCCAAGGGGGTGG - Intergenic
923602375 1:235414154-235414176 AAGTATTAAATCCATGGGGGTGG - Intronic
1064265637 10:13823087-13823109 GGGACTGATACCCATGTGGGAGG + Intronic
1064542543 10:16419700-16419722 AGGCATTAATCCCATATGAGAGG + Intergenic
1066970647 10:42309632-42309654 AGGAATTCAATCGATGTGAGTGG - Intergenic
1067830235 10:49607495-49607517 TGGAATTAAACCCAGGCTGGGGG - Intergenic
1068535417 10:58236079-58236101 AAGAATTAACCCACTGTGGGTGG - Intronic
1069865541 10:71500583-71500605 AGCAACTAACCCCATGGGGGCGG - Intronic
1070944377 10:80376729-80376751 AGGAATTAAACCAATGTATAAGG + Intergenic
1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG + Intergenic
1083391439 11:62353936-62353958 AGGAATCAAATCCAGGTGTGTGG - Intronic
1084938148 11:72598259-72598281 AGGATTTGAACCCAGGTAGGTGG + Intronic
1089007494 11:115104810-115104832 AGGACTTGAACCCAGGTGTGGGG + Intergenic
1089194034 11:116681459-116681481 AGGAATTCAACCCAGGAGAGAGG + Intergenic
1089902836 11:122005988-122006010 AGGAATTAAAATAAGGTGGGAGG + Intergenic
1090082049 11:123620104-123620126 AGGATTTGATGCCATGTGGGCGG + Intronic
1094255003 12:28413378-28413400 AGAAATTAAACACATGAGGAGGG - Intronic
1095843626 12:46721824-46721846 AGGAATTAAACCACTTTGGATGG + Intergenic
1096797126 12:54084959-54084981 AGGAATTAAGGCGAGGTGGGAGG + Intergenic
1098073754 12:66703828-66703850 AGTAATGAAAACCATGTGTGTGG + Intronic
1100367742 12:93937037-93937059 AGGAATGAACTCCATTTGGGTGG + Intergenic
1102499782 12:113344005-113344027 AGGAATTAGGCCCATGTGGTGGG + Intronic
1102773469 12:115498893-115498915 AGGATTTAAACTCAGGTGGGCGG - Intergenic
1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG + Intergenic
1103098840 12:118154863-118154885 AGGATTTGAACCCATCTTGGGGG - Intronic
1104296983 12:127524954-127524976 AGGAATTTATTCCATGTGGAAGG + Intergenic
1106363149 13:29050893-29050915 AGGAATAAAGCCAGTGTGGGTGG + Intronic
1106775013 13:33000241-33000263 AGGCAGGAAAGCCATGTGGGAGG + Intergenic
1109281648 13:60363591-60363613 AAGAATTAAAACAAGGTGGGGGG + Intergenic
1112440015 13:99418377-99418399 AGGAATAAACCCCGTGTGGGTGG - Intergenic
1113562928 13:111298362-111298384 AGGAAGGAAACTGATGTGGGAGG - Intronic
1116795353 14:49384413-49384435 AGGAAGTAGACACATTTGGGTGG - Intergenic
1119178875 14:72590692-72590714 AGGAATTATAACCATTTGCGAGG + Intergenic
1121679692 14:95783141-95783163 AGAAATTAAACTCATGTGACTGG + Intergenic
1122412272 14:101531724-101531746 AGGAAGTAAAGCCAAGAGGGAGG + Intergenic
1125497019 15:40206195-40206217 AGGAATTGAACCCTTGAGCGAGG + Exonic
1126411266 15:48375362-48375384 AGGAAATAATACCATGTGGAGGG - Intergenic
1126600792 15:50425122-50425144 AAGAAATAAACCCAGGAGGGTGG - Intronic
1129503853 15:76064577-76064599 AGCAATTAAAGCCATCCGGGAGG - Intronic
1131389776 15:92037558-92037580 AGGAATTTAACTCATGCTGGGGG - Intronic
1131910645 15:97196525-97196547 AGCAATTAAACACATGCTGGGGG + Intergenic
1134819715 16:17236937-17236959 AGGAATTCAACCTATTTTGGGGG + Intronic
1137344343 16:47641089-47641111 AGGTATGAAATCCAAGTGGGTGG + Exonic
1138482440 16:57312476-57312498 AGGCATTAGTGCCATGTGGGTGG + Intergenic
1138657119 16:58498006-58498028 AGGACTTAAACCCACGTCTGTGG + Intronic
1139688169 16:68620588-68620610 AGTAATTAAATCCATGAGGCCGG - Intergenic
1142800865 17:2344701-2344723 AGGAAGAAAAAACATGTGGGAGG + Intronic
1144510353 17:15869596-15869618 AGAAATAAAACCCATGAGGAGGG + Intergenic
1147985397 17:44304331-44304353 AGAAATTACACCCTTGTGGCCGG + Intergenic
1148475439 17:47925567-47925589 AGGAATTTGACCTCTGTGGGTGG - Intronic
1149058292 17:52390681-52390703 TGGAATTAAACAGATGAGGGTGG + Intergenic
1149400123 17:56287410-56287432 AGGAACTAAACGCATGAGGTAGG - Intronic
1149557487 17:57584465-57584487 AGGAATGACCCCCCTGTGGGGGG + Intronic
1151233713 17:72703117-72703139 ATAAAATAAACCCAAGTGGGAGG - Intronic
1152865316 17:82719074-82719096 AGGTAATAAAGCCAGGTGGGGGG - Intronic
1155075082 18:22347494-22347516 AGGAATGTACCACATGTGGGTGG - Intergenic
1155528904 18:26745640-26745662 AGGAATAAAGACCATGTAGGAGG + Intergenic
1157786893 18:50491707-50491729 AGGCATTAAACCCACCTGTGAGG - Intergenic
1158293635 18:55969907-55969929 AGCAAATAAACACAGGTGGGAGG + Intergenic
1164894692 19:31862692-31862714 AGGAAACAAAACCAAGTGGGGGG + Intergenic
1165777193 19:38411509-38411531 TGGAATTAAAGGAATGTGGGTGG + Intronic
1167807200 19:51796270-51796292 AGGAATTAGAGCCCAGTGGGTGG + Intronic
925746359 2:7047188-7047210 AGGAATTAAACTCCTGTTGCTGG + Intronic
927037049 2:19188864-19188886 AAACCTTAAACCCATGTGGGTGG + Intergenic
928008365 2:27583319-27583341 AGGAATTAAATCCAAGGAGGTGG - Intronic
929772421 2:44903506-44903528 AAGAACTGAACCAATGTGGGTGG + Intergenic
930428572 2:51244041-51244063 AGGAATTCAACCCATCTGGAGGG + Intergenic
931386057 2:61798489-61798511 AGGAATTAAGGTCATGAGGGTGG + Intergenic
931869604 2:66444446-66444468 AGGAATTCAGCCCATGTCGCGGG - Intronic
935167830 2:100585120-100585142 AGGAATTTAAGTCATGGGGGTGG + Intergenic
936242100 2:110796645-110796667 AAAAATACAACCCATGTGGGTGG - Intronic
941507980 2:166371390-166371412 AGGAATGAAACCCTTCTGGGTGG - Intronic
941747599 2:169103575-169103597 AGGAATTAAACTCATATCAGAGG + Intergenic
942683772 2:178509199-178509221 AGGAAATAAATTCATGTGGTTGG + Exonic
945951300 2:216041459-216041481 AGTAATGAAATACATGTGGGAGG + Intronic
947755832 2:232564330-232564352 AGGAATTAAACCCATGTGGGAGG + Exonic
1169713599 20:8591314-8591336 ATTAAGTAAACCCATGTGGTAGG - Intronic
1174040127 20:47693776-47693798 AGGAATGAGACCCAGGAGGGTGG + Intronic
1175485041 20:59339679-59339701 AGAGATTCTACCCATGTGGGTGG + Intergenic
1175685102 20:61023209-61023231 AGGATTTAAACCTGTGTGGCTGG - Intergenic
1176668826 21:9712831-9712853 AGGACATGAACACATGTGGGTGG - Intergenic
1182837025 22:33350539-33350561 AGGAATTTGACCAAGGTGGGTGG + Intronic
954069169 3:48130509-48130531 AGGAAGTGACCCCATGTGCGTGG + Intergenic
954940448 3:54367542-54367564 AGGAATGAAACCCATCAGAGTGG + Intronic
959658303 3:108835717-108835739 AGGGACTAAACCAATTTGGGGGG - Intronic
959756090 3:109901048-109901070 AAGAACTAAGGCCATGTGGGAGG - Intergenic
960235677 3:115279477-115279499 AGGAATTAAACCCATGTGGGAGG + Intergenic
963173933 3:142279463-142279485 AGGACACAAACACATGTGGGTGG - Intergenic
963498757 3:146098557-146098579 ATGAATTAAAACCATATGGGAGG + Intronic
967660447 3:192102277-192102299 AGCAAATAAATCCATGTGTGTGG + Intergenic
969911876 4:10455001-10455023 AGGACTTAAACCCAAGTGTTTGG - Intronic
970662522 4:18302178-18302200 AGGCATCAAACACATTTGGGTGG - Intergenic
974165749 4:58199292-58199314 AGGAAAAAAAAACATGTGGGAGG + Intergenic
979087033 4:116426233-116426255 AGTAATGAAACTCATGTAGGTGG + Intergenic
979803912 4:124946920-124946942 AGGAAGTGAACCCGTCTGGGTGG + Intergenic
980516800 4:133874527-133874549 TGGAATTAAAGGCATGTGGTTGG - Intergenic
982009605 4:151093819-151093841 ATCACTTAAACCCAGGTGGGAGG + Intergenic
983485240 4:168324690-168324712 AGGAATTTAACCAAGGTGGCAGG + Intergenic
983684842 4:170396266-170396288 AGGCATAAAATACATGTGGGTGG + Intergenic
984413110 4:179421793-179421815 AGCAATTAAACACTTTTGGGGGG - Intergenic
984758190 4:183342924-183342946 AGGAATAAAAGCCACGTGCGAGG - Intergenic
985405958 4:189638694-189638716 AGGACATGAACACATGTGGGTGG + Intergenic
985655273 5:1128472-1128494 AGGAAGGAAACCCCTGTTGGGGG - Intergenic
986062487 5:4204732-4204754 AGGAATTAAAACAAGGAGGGGGG - Intergenic
989795821 5:45471141-45471163 AGAAATTAAACCTATGTTTGGGG - Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991035638 5:62124754-62124776 AGGAAGTGAACTCATGAGGGAGG + Intergenic
994189641 5:96855469-96855491 AGAAAAAAAACCCAGGTGGGTGG + Intronic
997817710 5:137034683-137034705 AGGAATGAAACCTAGGTGTGCGG + Intronic
999204990 5:149841438-149841460 AGGAAGAAAACCCAGGTGGCGGG - Intronic
1004003084 6:11613726-11613748 AGGAATCAAACCTAGGTGTGTGG + Intergenic
1008955030 6:57206244-57206266 AAGAAGTAAAGCCATGTGGAAGG + Intronic
1009657146 6:66561959-66561981 AGGACATAGACACATGTGGGTGG + Intergenic
1010181270 6:73089080-73089102 AGGAATGAAAGCCCTATGGGTGG - Intronic
1011419512 6:87156177-87156199 AGGAATCAAACCAGTGGGGGCGG - Intronic
1013958393 6:115867804-115867826 GGGAATTAGAACCATGTAGGAGG - Intergenic
1017757993 6:157545774-157545796 AGGATTCAAACCCATGTCTGAGG - Intronic
1017964739 6:159254332-159254354 ATGAATTAAAACCATGTGCATGG - Intronic
1019026803 6:168972650-168972672 AGGTACTAATCCCATGAGGGAGG + Intergenic
1019255245 7:45704-45726 AGAAAATAAAACCAGGTGGGAGG + Intergenic
1019862523 7:3673259-3673281 AGGAACAAATCCCATGGGGGCGG + Intronic
1023078489 7:36506133-36506155 AGGACATGAACACATGTGGGTGG - Intergenic
1023782295 7:43668289-43668311 AGGATACAAACCCATGTGGATGG + Intronic
1025073607 7:55923319-55923341 AGGAAATAAACCCACGTGAACGG - Intronic
1030917886 7:115339472-115339494 AGGAATTAAACAGTTGTAGGAGG - Intergenic
1034218553 7:149426647-149426669 AGAATTTAAACCTAAGTGGGTGG - Intergenic
1034289873 7:149921405-149921427 AGGAATTAAAAGCATGTTGGAGG - Intergenic
1034661192 7:152771422-152771444 AGGAATTAAAAGCATGTTGGAGG + Intronic
1036040432 8:5073881-5073903 AGGAAATAATCTCATGAGGGAGG - Intergenic
1038337893 8:26660160-26660182 AGTCATTAAAAACATGTGGGAGG - Intergenic
1041344731 8:56885194-56885216 ATGAATGAAACCCATGTGGAGGG + Intergenic
1042696927 8:71564673-71564695 AGGAAATAAAAACATGAGGGTGG - Intronic
1044006526 8:86943566-86943588 AGGCATTAAAATCATGGGGGTGG + Intronic
1046742616 8:117845175-117845197 AGGCATGAAACCCCTATGGGAGG + Intronic
1047050486 8:121106132-121106154 AGGAATTAAACCCATTTTCCTGG - Intergenic
1047794167 8:128236957-128236979 TGGAATTAAACTCATGTGAGAGG + Intergenic
1047803004 8:128329801-128329823 ATGAACTAAACCCTTTTGGGTGG - Intergenic
1048215245 8:132488049-132488071 AGGAATTAATCCCATCTGACTGG - Intergenic
1049219224 8:141421314-141421336 AGGCATGAACCCCTTGTGGGAGG + Intronic
1053786697 9:41657536-41657558 AGGAATTAAGGCGAGGTGGGAGG + Intergenic
1054450383 9:65400757-65400779 AGGAATTAAGGCGAGGTGGGAGG + Intergenic
1055702853 9:78964938-78964960 AGGAATTGAAACAGTGTGGGAGG - Intergenic
1055950380 9:81724625-81724647 AGTAACTAAACCCTTTTGGGTGG - Intergenic
1056277843 9:85010923-85010945 GAAAATGAAACCCATGTGGGAGG + Intronic
1058810382 9:108633477-108633499 AAAAATTAATCCTATGTGGGGGG - Intergenic
1061561280 9:131405552-131405574 AAGAACTAAACCAAAGTGGGGGG - Intronic
1203657040 Un_KI270753v1:8110-8132 AGGACATGAACACATGTGGGTGG + Intergenic
1187697189 X:21934342-21934364 AGGACTTGAACCCAAGCGGGTGG - Intergenic
1187895145 X:23973635-23973657 AGGAACTCAACCCATGTTGTCGG - Intergenic
1187913869 X:24134912-24134934 AGGAACTCAACCCATGTTGTCGG - Intergenic
1187982966 X:24778809-24778831 AGGATTTGAACCCAGGTGGTTGG + Intronic
1189306388 X:39989910-39989932 AGGAAGTAAACCCATAAAGGAGG - Intergenic
1189914300 X:45841687-45841709 TGCAATTAAACCCATGAGTGAGG + Intergenic
1195961617 X:110393163-110393185 AGGATTTGAACCCATGTAGTTGG - Intronic
1198835401 X:140799435-140799457 AGGAAGAAAAACCATGTGGATGG - Intergenic
1199230339 X:145430024-145430046 ATGAATGAAACCTTTGTGGGTGG + Intergenic
1200062273 X:153488902-153488924 TGGAATTAACCACCTGTGGGTGG - Intronic
1201665071 Y:16442362-16442384 AGGAAATTAAACCATGGGGGTGG + Intergenic