ID: 947760414

View in Genome Browser
Species Human (GRCh38)
Location 2:232599956-232599978
Sequence GTGAAGAAGCAGAGCCCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947760407_947760414 23 Left 947760407 2:232599910-232599932 CCATTTGAGCTGTCTAAAAATGG No data
Right 947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG No data
947760406_947760414 28 Left 947760406 2:232599905-232599927 CCGGACCATTTGAGCTGTCTAAA No data
Right 947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG No data
947760405_947760414 29 Left 947760405 2:232599904-232599926 CCCGGACCATTTGAGCTGTCTAA No data
Right 947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947760414 Original CRISPR GTGAAGAAGCAGAGCCCGGA AGG Intergenic
No off target data available for this crispr