ID: 947762939

View in Genome Browser
Species Human (GRCh38)
Location 2:232616983-232617005
Sequence CCTTCCAGCCCTACTCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947762939_947762946 30 Left 947762939 2:232616983-232617005 CCCTAGTGAGTAGGGCTGGAAGG 0: 1
1: 0
2: 3
3: 21
4: 120
Right 947762946 2:232617036-232617058 ATGCGTTTACTCACACGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 31
947762939_947762945 29 Left 947762939 2:232616983-232617005 CCCTAGTGAGTAGGGCTGGAAGG 0: 1
1: 0
2: 3
3: 21
4: 120
Right 947762945 2:232617035-232617057 CATGCGTTTACTCACACGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947762939 Original CRISPR CCTTCCAGCCCTACTCACTA GGG (reversed) Intronic
900115115 1:1025022-1025044 CCTCCCAGCCCACCTCACAAAGG + Intronic
901840698 1:11952296-11952318 CCTCCCAGCCCTGCTCTCCAGGG + Intronic
902489007 1:16766890-16766912 CCTTCCTGCCCTCCTCCCTGAGG + Intronic
909683624 1:78320881-78320903 TCTTCCAGGCCTCCTCAATATGG + Intronic
913613376 1:120530515-120530537 CTTTCCAGCCCTGCTGGCTAGGG - Intergenic
914577810 1:148991732-148991754 CTTTCCAGCCCTGCTGGCTAGGG + Intronic
915954851 1:160213150-160213172 CCGTCCTGACCTACTCACTATGG + Exonic
917981428 1:180272002-180272024 CCCTCCAGCCCTGCTCACCTCGG - Exonic
918379087 1:183936860-183936882 CCTTCCTTCCCGACTCACTGTGG - Exonic
920371460 1:205481798-205481820 CCCTCCAGCACTGCTCACTGTGG - Intergenic
923531429 1:234815634-234815656 CCTTCCTGCCCTCCTCCCTGAGG - Intergenic
1065974258 10:30828851-30828873 CCTTCCAGCACTCCTCATTCTGG - Intronic
1066106491 10:32161604-32161626 CCTTCCCACCCAACTCACTCTGG + Intergenic
1067777239 10:49172508-49172530 CCAGCCAACCCTACTCACTGGGG + Intronic
1067905097 10:50282312-50282334 CCTTCCAGCTATCCTCACCAAGG + Intergenic
1069719024 10:70538404-70538426 ACTGCCAGTCATACTCACTAGGG - Exonic
1072530295 10:96312503-96312525 CTTTCCAGCCATCCTCACCAAGG + Intronic
1074135163 10:110619572-110619594 CCTTCTTGTCCTACTCACTAGGG - Intergenic
1075632706 10:124010841-124010863 CCTCCCAGCCCTCCTCCCTATGG - Intronic
1076310022 10:129498855-129498877 TCTTCCTGCCCTTCTCAGTAGGG + Intronic
1077023025 11:428046-428068 CCCTCCAACCCAACTCACGAGGG - Intronic
1078092581 11:8276335-8276357 CCTTCCATTCCTACTCGCTAAGG - Intergenic
1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG + Intronic
1080239158 11:30106483-30106505 CCTGCCAGTCCTACTCACACTGG + Intergenic
1085174248 11:74472886-74472908 CTCTCCAGCCCAACTCACGAGGG - Intergenic
1088358843 11:108970324-108970346 CCTTCCAGCCATCCCCACCATGG + Intergenic
1089007327 11:115103216-115103238 GTTTCCAGCCCTACTTGCTAAGG + Intergenic
1092040542 12:5380105-5380127 CCTTCTAGCCCTGCTCCCCAGGG - Intergenic
1092092458 12:5814006-5814028 CCTTCCAGATATACTCTCTACGG + Intronic
1092499974 12:9035705-9035727 CCTTGCAGCACTATTCACAATGG + Intergenic
1093322651 12:17732998-17733020 CCATCCAGCTCCACTCACCATGG - Intergenic
1094131937 12:27083911-27083933 TCTTCCAGCCCTACTTACTCTGG - Intergenic
1096399289 12:51291784-51291806 CCTTCCAGCCCTACAGCCTCTGG - Exonic
1099574136 12:84360126-84360148 CATTGCAGCACTACTCACAATGG + Intergenic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1102001640 12:109561256-109561278 CCTCCCAGCCCTGCCCACTCTGG - Intronic
1106764237 13:32897850-32897872 TCTTCCAGCCTTACTCTCTGGGG + Intergenic
1116365668 14:44059827-44059849 CTTTCCAGCCCTTTGCACTAAGG - Intergenic
1117749877 14:58910367-58910389 CCCTCCCGCCCTTCTCACCAAGG - Intergenic
1118040236 14:61908603-61908625 CCTTCCATCCCTGCTCAGTTTGG - Intergenic
1118172666 14:63403681-63403703 CCATACAGCCCTTCTCAGTATGG - Intronic
1119153664 14:72388738-72388760 AATCCCAGCTCTACTCACTATGG + Intronic
1119652148 14:76391589-76391611 CCTTCCTTCCCACCTCACTATGG + Intronic
1120821461 14:88915332-88915354 CCTTCCACCCCTGCACCCTAAGG - Intergenic
1120955710 14:90080069-90080091 CCCTCCAGCCGTCCTCACTTTGG - Intronic
1122532336 14:102437098-102437120 CAATCCAGCCCTGCTCACCATGG - Intronic
1123020264 14:105394665-105394687 CCTTCTAGCCCCACCCACCAGGG + Exonic
1125627397 15:41119924-41119946 CCTTACAGACCTACACACCAAGG + Intergenic
1129152322 15:73696855-73696877 CCTGCCAGCCCCATTCTCTAAGG - Intronic
1129206904 15:74042745-74042767 CCTTCCTCCCCTACTCATGAGGG + Intronic
1133113240 16:3562077-3562099 CCTTTCCTCCCTACTCACTAAGG + Intronic
1134174503 16:11994852-11994874 CCTTCCAGCTCTACAGTCTATGG - Intronic
1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG + Intergenic
1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271939 16:29153661-29153683 CTTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1141544467 16:84755497-84755519 CCTTCCAGCCCTGCACTCTGGGG + Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1143048345 17:4101003-4101025 CCTCCCAGCCCCACCCACTTTGG + Intronic
1143215673 17:5223081-5223103 CCTTCCAGCCCTAATCATCTGGG - Intronic
1143833947 17:9675018-9675040 ACTTCCATCCTTACTCATTACGG + Intronic
1149220026 17:54406281-54406303 CCTTGCTGCCCTAACCACTAAGG - Intergenic
1149665900 17:58364611-58364633 CCCTCCAGCCTTCCTCCCTAGGG + Intronic
1151785088 17:76271535-76271557 GCTTCCAGCTCTTCTCACTAGGG - Intergenic
1151858281 17:76737994-76738016 CCTCCCAGCCTGACTCACTGCGG - Exonic
1151877754 17:76876940-76876962 CCTTCCAGCCCTTCTCGCCTAGG + Intronic
1152303818 17:79509907-79509929 CCTTCCAATCCTACTTACTTGGG + Intronic
1153342235 18:3987276-3987298 TCTTCCAGGCCTACTCACTGAGG + Intronic
1156603470 18:38638448-38638470 CCTTGCAGCACTATTCACAATGG + Intergenic
1157592614 18:48844585-48844607 GCTGCCAGCCCTCCTAACTAAGG - Intronic
1157762353 18:50274168-50274190 CCTTCCTGCCCCACCCACCATGG + Exonic
1157920462 18:51708509-51708531 CCTTAAAGCCCAACTCACCAAGG + Intergenic
1158470447 18:57731430-57731452 TCTCCCAGCCCTTCTTACTAAGG + Intronic
1161435739 19:4261863-4261885 CCTCCCACCCCTGCTCACTGAGG + Intronic
1162823229 19:13235976-13235998 CCTGCCAGCCCCACCCACAATGG + Intronic
1166735609 19:45082429-45082451 CATTCCAGCCCTACTCACTTTGG + Intronic
925878523 2:8331807-8331829 CCTCCAAGCCCTGCTCACTAAGG + Intergenic
926514562 2:13825634-13825656 CATTGCAGCACTAGTCACTATGG + Intergenic
926706937 2:15843679-15843701 CCCTCCAGCCCTGCCCACTGTGG - Intergenic
927672301 2:25078980-25079002 CCTCCCAACCCTTCTCACTGTGG + Intronic
933977069 2:87520215-87520237 ATTTCCAGCCATATTCACTATGG - Intergenic
935850345 2:107212135-107212157 CTGTCCAGCCCTATTCTCTAGGG + Intergenic
936316748 2:111430590-111430612 ATTTCCAGCCATATTCACTATGG + Intergenic
944881557 2:204018022-204018044 CCTTGCAGTCCTGCTCCCTAAGG + Intergenic
947291467 2:228580054-228580076 CATTCCATCCCTTCTCACTGAGG - Intergenic
947762939 2:232616983-232617005 CCTTCCAGCCCTACTCACTAGGG - Intronic
1172978589 20:38924585-38924607 CCTTCCAGCCCTCTTCAATCAGG - Intergenic
1173475993 20:43360148-43360170 TCTCCCAGACCTACTCACTCAGG - Intergenic
1174289491 20:49497635-49497657 CCTTCCAGCCATACCTACCAAGG + Intergenic
1174679305 20:52389811-52389833 CCTGCCAGCACTTCTCTCTATGG - Intergenic
1174967563 20:55235026-55235048 CCTTGCAGCATTACTCACAATGG - Intergenic
1181004833 22:20008346-20008368 CCCGCCAGCCCTTCTCACTCAGG + Intronic
1181906390 22:26200555-26200577 CCTTCCACCCCTTCTCACATAGG - Intronic
1185172179 22:49300459-49300481 CCTTCCAGCCCTTCTCTCGGGGG - Intergenic
952849953 3:37719647-37719669 ACTTCCAGCCCTCCTGACTCGGG - Intronic
953148594 3:40303304-40303326 CATTACAGCCCTAGTCACTTTGG - Intergenic
954359985 3:50116616-50116638 CCTTCCTGCCCTACTATCTATGG + Intronic
956786292 3:72645075-72645097 CCTTCCAGCAGTCCTCACAAAGG - Intergenic
960151092 3:114249686-114249708 CCTTCCAGCCATCCCCACCAAGG + Intergenic
960584382 3:119307327-119307349 CCTTCCATACCTATTAACTATGG + Intronic
961087807 3:124084198-124084220 CCTTTCAGGCCTACTCCCTCGGG - Intronic
962123565 3:132590130-132590152 CATTGCAGCACTACTCACAATGG - Intronic
963036224 3:141031508-141031530 CCTTCCAGCCATCCTCAGCAAGG - Intergenic
971192737 4:24443296-24443318 CCTTCCTTCCCTACTCTTTACGG - Intergenic
971445485 4:26742047-26742069 CCCTCCAGCCTCACTCACTAGGG - Intronic
973761258 4:54117710-54117732 GCTTCCAGCCATACTCAATAGGG - Intronic
996243444 5:121229940-121229962 CCTTCCAGCAATAATCACAAAGG - Intergenic
998400220 5:141844855-141844877 GCTCCCAGGGCTACTCACTATGG - Intergenic
1001208885 5:169791631-169791653 TATTCCAGCCCCACTCACTCCGG - Intronic
1001884918 5:175280828-175280850 CCTTCCAGTTTTACTCACTTGGG + Intergenic
1002194437 5:177494589-177494611 GCTTCCTGCCCTCCTCACTCTGG - Intronic
1003278619 6:4673625-4673647 CCTGCCAGCCCTATTCAGGAGGG - Intergenic
1005640876 6:27794892-27794914 CCTTCCAGACCTTCTTACTGAGG - Intergenic
1006990106 6:38208084-38208106 CCTTCCAGCCCTGCTCCCAAAGG - Intronic
1007777694 6:44233002-44233024 CCTGCCAGCCCTACTCACTTGGG - Exonic
1012183496 6:96185055-96185077 CCTTCCTTCCCCACTCCCTAGGG + Intronic
1013082305 6:106823376-106823398 CTTTCTAGCCCACCTCACTAGGG + Intergenic
1022072436 7:26930410-26930432 CCTTCTTGGCTTACTCACTAAGG - Intronic
1023045458 7:36206548-36206570 CTTTCCAGCCCCACTCTGTAAGG - Intronic
1029446380 7:100615144-100615166 CCCTCCAGGCCTCCTCACCATGG + Exonic
1030766034 7:113410905-113410927 GCTTCCAACCCTCCTCACTAAGG + Intergenic
1032473410 7:132194500-132194522 TCTGCCAGCCCTATTCCCTAAGG - Intronic
1034439018 7:151077157-151077179 CCTTCCTGCCATACCCACCAAGG - Exonic
1036167606 8:6451171-6451193 CCTGCCAGCCTAACTCACTGGGG + Intronic
1036398394 8:8387024-8387046 ACTTCCAGCCCTGCTCCCTCCGG - Intergenic
1039023194 8:33229752-33229774 CCATCCAGCCCTTCTGACCAGGG + Intergenic
1039854360 8:41399578-41399600 CCTTTCACCCCTACTTCCTACGG + Intergenic
1048208692 8:132436826-132436848 CCTTCCAGCCCTACCTTCTGAGG - Intronic
1048986293 8:139736901-139736923 CCTTGCAGCCCTGCTCAGCAGGG - Intronic
1049911863 9:276602-276624 CCTTCTAGCCCTGGTCACAAAGG - Intronic
1050986134 9:12085343-12085365 CCTTCTAGCCATACCCACCAAGG - Intergenic
1053600319 9:39603351-39603373 CATCACAGCCCTAATCACTAGGG + Intergenic
1053857969 9:42357207-42357229 CATCACAGCCCTAATCACTAGGG + Intergenic
1054253209 9:62739033-62739055 CATCACAGCCCTAATCACTAGGG - Intergenic
1054567325 9:66773532-66773554 CATCACAGCCCTAATCACTAGGG - Intergenic
1056729033 9:89148043-89148065 CTTTCCAGTCCTACTCACTAGGG - Intronic
1059633519 9:116150730-116150752 CCTTCCAGCCCTCCTCCCCAGGG - Intergenic
1188670379 X:32874879-32874901 CCTTTCAGCCATTCTCACAATGG + Intronic
1189712444 X:43827391-43827413 CCTTCCAACCCTCCTTACAAAGG - Intronic
1193825953 X:86227452-86227474 TCTTTCAGCCATACTCTCTATGG + Intronic
1199605316 X:149573551-149573573 CCTTGGAGACCTGCTCACTATGG + Intergenic
1199633805 X:149795817-149795839 CCTTGGAGACCTGCTCACTATGG - Intergenic