ID: 947762973

View in Genome Browser
Species Human (GRCh38)
Location 2:232617158-232617180
Sequence GAACCCTGAACCACCGCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947762973_947762976 4 Left 947762973 2:232617158-232617180 CCATTCGCGGTGGTTCAGGGTTC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 947762976 2:232617185-232617207 ACAAGTGTCCCCAGCAGGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 120
947762973_947762975 -1 Left 947762973 2:232617158-232617180 CCATTCGCGGTGGTTCAGGGTTC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 947762975 2:232617180-232617202 CCAAAACAAGTGTCCCCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 115
947762973_947762978 12 Left 947762973 2:232617158-232617180 CCATTCGCGGTGGTTCAGGGTTC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 947762978 2:232617193-232617215 CCCCAGCAGGTAAGGCCATGTGG 0: 1
1: 0
2: 0
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947762973 Original CRISPR GAACCCTGAACCACCGCGAA TGG (reversed) Intronic
909438881 1:75675284-75675306 GAACTATGAACCACTGCTAAAGG - Intergenic
913224066 1:116683326-116683348 CAACCGTGAGCCACCGCGACCGG - Intergenic
917812901 1:178677467-178677489 GAACCATGAAAGACCCCGAATGG + Intergenic
918003059 1:180515921-180515943 GAATCCTGAACCACCCAGAGTGG - Intergenic
923309643 1:232723815-232723837 GAAACCTGGCCCACCACGAATGG - Intergenic
1075802453 10:125161317-125161339 GGACCCCGAGCCACCGCGACAGG - Intergenic
1085742504 11:79089156-79089178 GAAACCTGAACCACCTTCAAAGG + Intronic
1087755204 11:102047706-102047728 GAACCCCGAACCACCCGGGAAGG + Intronic
1090037074 11:123258471-123258493 GCACCCTGATCCACAGAGAAAGG - Intergenic
1098751382 12:74297234-74297256 GAACCCTGAACATCCCAGAAAGG - Intergenic
1100881857 12:99027637-99027659 GAACCATGACTCACCCCGAAGGG + Intronic
1107067980 13:36237322-36237344 GAACCCTGATACACAGCTAATGG + Intronic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1117715967 14:58581562-58581584 GAACTATGAACCACCGCTCAAGG - Intergenic
1119172497 14:72545768-72545790 GAACCCTGAACAACTGAGCAGGG - Intronic
1124167742 15:27343094-27343116 CATCCATGAGCCACCGCGAAGGG - Intronic
1128685779 15:69684491-69684513 GATCCCTGGACCACAGCTAAGGG + Intergenic
1131466222 15:92656537-92656559 GAACCCTGAAGCCCTGGGAATGG - Intronic
1136087425 16:27895520-27895542 GAACCCTGGACCATGGGGAAAGG - Intronic
1143998271 17:11027994-11028016 CAACCCAGAAACACCGTGAAGGG + Intergenic
1148212169 17:45815150-45815172 GAACCATGAACCAGCGCGTGTGG - Intronic
1162835224 19:13312474-13312496 GAACCCTCAACCACCGCCAGTGG - Intronic
1167571713 19:50292823-50292845 GAACCCTGAGCCAGGGCCAAGGG + Intronic
926788856 2:16549226-16549248 GAACCCTGAATAACAGCCAAAGG - Intergenic
934036556 2:88093246-88093268 GAACACTGAAACACAGGGAAGGG + Intronic
947762973 2:232617158-232617180 GAACCCTGAACCACCGCGAATGG - Intronic
948942400 2:241203036-241203058 GGACCCTGGACCACCGCCACTGG + Intronic
1172271635 20:33658630-33658652 GAACCCTGACCCACCCAGGATGG + Intronic
1184520440 22:44990935-44990957 GAGCCCTGAACCACCTTGGAAGG + Intronic
961432583 3:126893682-126893704 AAACACTGAACCCCCGCTAAGGG + Intronic
992054833 5:72978281-72978303 GAACTATGAACCACTGCTAAAGG - Intronic
1019681548 7:2353239-2353261 CAAGCGTGAACCACCGCGCAGGG - Intronic
1023543883 7:41296729-41296751 GAGCCCTGAACCAAGGCGAGGGG + Intergenic
1034278603 7:149836215-149836237 CAAGCCTGAACCACCGCGTCTGG - Intergenic
1036578208 8:10048214-10048236 GGACCCTGAACCCCAGGGAATGG + Intergenic
1041710455 8:60889570-60889592 GAACCCTGAACCCCCACTGACGG - Intergenic
1042664984 8:71194852-71194874 GAACCCTGAACAACCGGGGCTGG - Intergenic
1049635518 8:143686347-143686369 CAGGCGTGAACCACCGCGAATGG + Intronic
1049750391 8:144280399-144280421 GACCCCAGAACCACAGCGACAGG + Intronic
1052475189 9:28950713-28950735 GAACCCTAAACCACTGCTCAAGG + Intergenic
1057322826 9:94030483-94030505 GAGCCCTGGAGCACCGCGGACGG - Intergenic
1059576185 9:115491281-115491303 GAACCCTGACACCCCTCGAATGG + Intergenic
1061499666 9:130994600-130994622 GGCCCCTGCACCACCGAGAAGGG + Intergenic
1192960573 X:76126672-76126694 GAACCCTCAACCCCAGCCAAGGG + Intergenic