ID: 947765321

View in Genome Browser
Species Human (GRCh38)
Location 2:232633920-232633942
Sequence GGTTGAAGACCCTGCAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947765321_947765329 19 Left 947765321 2:232633920-232633942 CCGGCGCTGCAGGGTCTTCAACC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 947765329 2:232633962-232633984 GTTCAGCCGCCGCCTCATCAAGG 0: 1
1: 0
2: 0
3: 4
4: 80
947765321_947765331 25 Left 947765321 2:232633920-232633942 CCGGCGCTGCAGGGTCTTCAACC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 947765331 2:232633968-232633990 CCGCCGCCTCATCAAGGACCTGG 0: 1
1: 0
2: 0
3: 3
4: 86
947765321_947765323 -5 Left 947765321 2:232633920-232633942 CCGGCGCTGCAGGGTCTTCAACC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 947765323 2:232633938-232633960 CAACCCCTACACGGAGTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947765321 Original CRISPR GGTTGAAGACCCTGCAGCGC CGG (reversed) Exonic
901814863 1:11788242-11788264 GGAGGAAGTACCTGCAGCGCCGG + Exonic
917631220 1:176893313-176893335 GCTTAAAGACACTGCAGCTCTGG + Intronic
922975608 1:229781107-229781129 GGTTGAACATCCTGCATCACGGG - Intergenic
1063926339 10:10981430-10981452 GGTTGAAGAATCCGCAGCGACGG + Intergenic
1065535199 10:26709175-26709197 GGTGGATGGCCCTGCAGCGTGGG + Intronic
1070791975 10:79195063-79195085 GGCTGAAGGCCCGGCAGCCCCGG - Intronic
1073064480 10:100750080-100750102 GGCTGAAGACCCAGGAGCGAGGG + Intronic
1074145629 10:110714798-110714820 GGTTGGAGACCCAGCAGCTCAGG + Intronic
1074410833 10:113227216-113227238 GGTTAAGGACCCTGCACCGCAGG - Intergenic
1076452821 10:130568482-130568504 GGAGGAAGAACCTGCAGCCCGGG - Intergenic
1076470783 10:130716619-130716641 GGCTGCAGATCCTGCAGGGCAGG - Intergenic
1083007839 11:59365246-59365268 GCTTGAAGAACCTCCAGAGCTGG - Exonic
1083288366 11:61675563-61675585 GGTGGAAGACCCAGCATCGGAGG + Intergenic
1083630174 11:64091216-64091238 GGCTGCAGACCCTGCAGCGGAGG - Intronic
1083661003 11:64251702-64251724 TGGTGGAGACCCTGCGGCGCGGG + Exonic
1085698373 11:78724949-78724971 GGTCTCAGACCCTGCAGCCCTGG + Intronic
1085993273 11:81878174-81878196 TGTTGAAGACATTGCAGAGCAGG + Intergenic
1098426141 12:70366858-70366880 GCTTGCAGATCCTGCAGCGCGGG - Exonic
1102913552 12:116737109-116737131 AGTTGAGGACCCTTCAGCGGTGG - Intronic
1103725748 12:122996666-122996688 GATGGAAGACCCTGTAGGGCGGG - Intronic
1103813410 12:123633871-123633893 CGGTGAGGACCCTGCAGGGCGGG + Exonic
1104755903 12:131269250-131269272 GGTTGAAGTCCCTGCAGGAGTGG - Intergenic
1104777809 12:131401431-131401453 GGTTGAAGTCCCTGCAGGAGTGG + Intergenic
1111994828 13:95155311-95155333 GGTTGTAGTCCCAGCAGCTCGGG - Intronic
1113628304 13:111862937-111862959 CCTTGAAGACCCTGTAGCACCGG - Intergenic
1113639408 13:111946431-111946453 GGTTGTGGCCCCTGCAGTGCTGG - Intergenic
1116865370 14:50027439-50027461 GCTTAAGGACCCTGCAGCTCTGG - Intergenic
1119591514 14:75892667-75892689 GGTTGAAAACCCTGCACTGAAGG + Intronic
1120424473 14:84329661-84329683 GGCTGCAGACCCTGCAGTGATGG - Intergenic
1121000595 14:90449637-90449659 GGAGGAAGACCCTGCAGAACAGG + Intergenic
1122956627 14:105074390-105074412 GGAGGAAGACCCTGCAGCAGTGG + Intergenic
1123072122 14:105647018-105647040 GGGGGAAGACCCTGGAGCTCAGG - Intergenic
1123092126 14:105746536-105746558 GGGGGAAGACCCTGGAGCTCAGG - Intergenic
1123097703 14:105774233-105774255 GGAGGAAGACCCTGGAGCTCAGG - Intergenic
1129174193 15:73828293-73828315 TCTTGAAGATCCTGCAGCCCAGG + Intergenic
1131046668 15:89320975-89320997 GGTGGATGACACTGCAGGGCAGG - Exonic
1132518476 16:376802-376824 GGACAAAGACCCTGCAGCGAGGG + Exonic
1133745923 16:8686679-8686701 GCTTGAAGACTCTGGAGCCCTGG + Intronic
1134022804 16:10933070-10933092 GGTTGGAGAACCTGCTGCCCTGG - Intronic
1135325589 16:21523526-21523548 GGTAGAAGACCCTGAGCCGCTGG + Intergenic
1139524236 16:67503835-67503857 TGCTGAAGACTCTGCAGTGCTGG + Intergenic
1142038587 16:87878104-87878126 GGTAGAAGACCCTGAGCCGCTGG + Intergenic
1142155816 16:88532486-88532508 GTTTAAAGACCCTTCAGCACAGG + Intronic
1143779823 17:9223588-9223610 GGATGCAGTCCCTGCAGCTCCGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147915663 17:43883718-43883740 CCTTGAAGACCCTGAAGCCCAGG + Intronic
1149448097 17:56729405-56729427 GGGTGAAGAGCCTGCAGGGAAGG - Intergenic
1149497337 17:57127586-57127608 GGTCCAGGAACCTGCAGCGCTGG + Intergenic
1149523899 17:57339451-57339473 GGTTGAAGAACTGGCAGCGTTGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151365130 17:73612150-73612172 GCTTGAAGAGGCTGCAGCGGGGG - Intronic
1152476225 17:80520193-80520215 GGCTGAGGAGGCTGCAGCGCAGG + Intergenic
1159312405 18:66726194-66726216 GGCTGCAGACCCTACAGCACAGG - Intergenic
1160294690 18:77627380-77627402 GGGTGATGCCGCTGCAGCGCAGG + Intergenic
1162722322 19:12669840-12669862 GGTTGAAGACGCTGGACTGCGGG + Exonic
1162733424 19:12732521-12732543 TGTTGGAGCCCCTGGAGCGCAGG - Intronic
1162894385 19:13756361-13756383 GAATGAAGACCCTGCAGCACTGG - Intronic
1164272744 19:23687345-23687367 GGCTGAAAAGGCTGCAGCGCAGG - Intergenic
1166140106 19:40800848-40800870 GAGTGAAGGCGCTGCAGCGCTGG + Exonic
925723537 2:6851509-6851531 GGTTGCAGAGGCTGCAGGGCCGG - Exonic
927927484 2:27023979-27024001 GGTGGAGGACGCTGCAGCCCAGG + Intronic
929313539 2:40452049-40452071 GGCTGACTACCGTGCAGCGCCGG + Intronic
934637835 2:96007159-96007181 GGATGGAGCCCCTGCATCGCAGG + Intergenic
934649351 2:96082151-96082173 GGATGGAGCCCCTGCATCGCAGG + Intergenic
934795827 2:97098252-97098274 GGATGGAGCCCCTGCATCGCAGG - Intergenic
937462448 2:122101227-122101249 GATGGAAGGCCCTGCAGAGCTGG + Intergenic
947765321 2:232633920-232633942 GGTTGAAGACCCTGCAGCGCCGG - Exonic
1174518867 20:51114448-51114470 CGCTGGGGACCCTGCAGCGCAGG + Intergenic
1175982459 20:62745963-62745985 GCTTGAAGGCCATGCAGGGCCGG - Intronic
1178609984 21:34072504-34072526 GGTTGAGTACCCTGCAGCTGAGG - Intergenic
1179407251 21:41136344-41136366 GGTTGCACACTCTGCAGGGCTGG + Intergenic
1183393433 22:37559028-37559050 AGTGGAGGACCCTGCAGCGGAGG - Intergenic
1184251499 22:43262872-43262894 GGTTGAAGACCAGGCAGAGAGGG + Intronic
1184885459 22:47342406-47342428 GGTTGAAGGCTCTGCAGTGATGG - Intergenic
954801893 3:53192024-53192046 GGCTGGAGTCCCTGCAGGGCTGG - Intronic
957084998 3:75670113-75670135 GGTGGAAGAGCCTGCTCCGCTGG + Intergenic
962244251 3:133778343-133778365 GGTGGAGGACCCTGTAGGGCAGG + Intronic
975704897 4:77101919-77101941 GGCTGTAGACCCTGCTGCACTGG + Intergenic
982261071 4:153494891-153494913 GGGTGAACACCCGGCAGAGCAGG - Intronic
984833788 4:184000336-184000358 GGCTGAAGACCCTGCATCGGAGG - Intronic
987018741 5:13847942-13847964 TGTTGAAGAACCTCCAGAGCAGG + Intronic
989195503 5:38712590-38712612 GGGTGAAGAGTCTGCAGAGCAGG + Intergenic
992547639 5:77830187-77830209 GGCTGAAGACCTTGCAGTGGTGG - Intronic
995507123 5:112872215-112872237 GGTTGAAGGACCAGCAGCACTGG + Intronic
996397475 5:123027498-123027520 ATTGGAAAACCCTGCAGCGCTGG - Intronic
997883375 5:137610588-137610610 GGGTGAAGAAGCTGCAGCGGAGG - Intergenic
1002345724 5:178546493-178546515 GGGTGCAGACCCTGCAAAGCTGG + Intronic
1002496937 5:179622143-179622165 AGTTGAAGACACTGAAGCCCAGG - Intronic
1002576141 5:180175220-180175242 GGTTGGAGCCCCCCCAGCGCCGG + Intronic
1002912138 6:1498517-1498539 GGTTGAAGGCCCTGCAGCAGTGG - Intergenic
1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG + Intergenic
1003451769 6:6241173-6241195 GGTTGGAGACCCAGAAGCTCTGG + Intronic
1004714578 6:18204837-18204859 GGTCGCAGACCCTGCAGGGTAGG + Intronic
1005195449 6:23277937-23277959 GGTGGGAGACCCAGCAGCACTGG + Intergenic
1006132675 6:31878535-31878557 GGTTGCAGGCTCTGCAGCACAGG + Intronic
1012802668 6:103851933-103851955 AGCTGAAGACCCTGCAATGCTGG - Intergenic
1018029537 6:159831174-159831196 ACTGGAAGACCCTGGAGCGCAGG + Intergenic
1018541919 6:164890365-164890387 GGTTGAAGACCCTGAGGCTAAGG - Intergenic
1018632625 6:165834174-165834196 GGTTGAGGAGTCTGCAGGGCAGG - Intronic
1018916602 6:168136095-168136117 GGTTTATGACCCTGGAGAGCAGG + Intergenic
1019402269 7:862267-862289 GGCTGGAGAGCCTGCAGGGCAGG + Intronic
1019409556 7:900644-900666 GGCTGAGGAGGCTGCAGCGCTGG + Intronic
1022720356 7:32937020-32937042 GGTTGGAGACCCTGCATTGTGGG - Intergenic
1023791879 7:43758926-43758948 GGTCGGAGGCCCAGCAGCGCGGG + Intronic
1025021225 7:55481567-55481589 AGTGGAGGACCCTGCAGTGCTGG - Intronic
1025849769 7:65236470-65236492 GGTGGAGGACTCTGCAGGGCAGG - Intergenic
1026036295 7:66832719-66832741 GGTTCAAGAGCCTGCAGCCTGGG + Intergenic
1029367922 7:100128013-100128035 GAGTGAAGACCCCGCAGCCCAGG + Exonic
1033422553 7:141216791-141216813 GCTTGAAGTCCCAGCAGCCCTGG + Intronic
1035569554 8:663050-663072 GGTTGTAGGCCCTGGAGCACAGG - Intronic
1035600300 8:893318-893340 GGTGGAAGACCCTGAACTGCTGG + Intergenic
1041220682 8:55648343-55648365 GGTTGACCACCCTGCAGTCCAGG + Intergenic
1041903853 8:63010164-63010186 GGGTAAAGACCCAGCAGCTCAGG + Intergenic
1044348427 8:91134242-91134264 AGCTGAAGACCCTGGAGTGCTGG + Intronic
1048829171 8:138459380-138459402 AGTTGAGGATCCTGCAGCCCTGG - Intronic
1059215624 9:112559120-112559142 CGTAGAAGAACCTGCAGGGCTGG - Intronic
1060287458 9:122266455-122266477 GTTTGAAGACCCTGGAGCAGGGG + Intronic
1062594541 9:137293147-137293169 GGTTGCAGACCCGGCAGCTCCGG - Intergenic
1191735551 X:64384724-64384746 GGCCGAAGGCCCTGCAGCCCTGG - Intronic
1196888771 X:120272306-120272328 GCATGAGGACCCTGCAGCCCAGG + Intronic
1199715956 X:150507571-150507593 ACTTGAAGATCCTGCAGAGCTGG + Intronic