ID: 947765924

View in Genome Browser
Species Human (GRCh38)
Location 2:232637288-232637310
Sequence GGGAGAGCACCAGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 3, 2: 4, 3: 58, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947765924_947765929 4 Left 947765924 2:232637288-232637310 CCCTGAGCACCTGGTGCTCTCCC 0: 1
1: 3
2: 4
3: 58
4: 250
Right 947765929 2:232637315-232637337 TGTGTTTCTGTGTCTTCACATGG 0: 3
1: 17
2: 77
3: 284
4: 1394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947765924 Original CRISPR GGGAGAGCACCAGGTGCTCA GGG (reversed) Intronic