ID: 947765929

View in Genome Browser
Species Human (GRCh38)
Location 2:232637315-232637337
Sequence TGTGTTTCTGTGTCTTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1775
Summary {0: 3, 1: 17, 2: 77, 3: 284, 4: 1394}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947765921_947765929 19 Left 947765921 2:232637273-232637295 CCGTAATCTCTGCCACCCTGAGC 0: 1
1: 0
2: 3
3: 19
4: 270
Right 947765929 2:232637315-232637337 TGTGTTTCTGTGTCTTCACATGG 0: 3
1: 17
2: 77
3: 284
4: 1394
947765926_947765929 -5 Left 947765926 2:232637297-232637319 CCTGGTGCTCTCCCTGTGTGTGT 0: 1
1: 0
2: 10
3: 44
4: 351
Right 947765929 2:232637315-232637337 TGTGTTTCTGTGTCTTCACATGG 0: 3
1: 17
2: 77
3: 284
4: 1394
947765923_947765929 7 Left 947765923 2:232637285-232637307 CCACCCTGAGCACCTGGTGCTCT 0: 1
1: 0
2: 1
3: 33
4: 341
Right 947765929 2:232637315-232637337 TGTGTTTCTGTGTCTTCACATGG 0: 3
1: 17
2: 77
3: 284
4: 1394
947765925_947765929 3 Left 947765925 2:232637289-232637311 CCTGAGCACCTGGTGCTCTCCCT 0: 1
1: 0
2: 5
3: 29
4: 331
Right 947765929 2:232637315-232637337 TGTGTTTCTGTGTCTTCACATGG 0: 3
1: 17
2: 77
3: 284
4: 1394
947765924_947765929 4 Left 947765924 2:232637288-232637310 CCCTGAGCACCTGGTGCTCTCCC 0: 1
1: 3
2: 4
3: 58
4: 250
Right 947765929 2:232637315-232637337 TGTGTTTCTGTGTCTTCACATGG 0: 3
1: 17
2: 77
3: 284
4: 1394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947765929 Original CRISPR TGTGTTTCTGTGTCTTCACA TGG Intronic