ID: 947770540

View in Genome Browser
Species Human (GRCh38)
Location 2:232666837-232666859
Sequence ACTAGGGCCTTAAGCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947770540_947770548 14 Left 947770540 2:232666837-232666859 CCACCTCTGCTTAAGGCCCTAGT 0: 1
1: 0
2: 0
3: 5
4: 133
Right 947770548 2:232666874-232666896 TTCACAGACTGAAAAGAGCATGG 0: 1
1: 0
2: 2
3: 29
4: 348
947770540_947770549 15 Left 947770540 2:232666837-232666859 CCACCTCTGCTTAAGGCCCTAGT 0: 1
1: 0
2: 0
3: 5
4: 133
Right 947770549 2:232666875-232666897 TCACAGACTGAAAAGAGCATGGG 0: 1
1: 0
2: 0
3: 27
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947770540 Original CRISPR ACTAGGGCCTTAAGCAGAGG TGG (reversed) Intronic
904702666 1:32367120-32367142 ACTGTGGCCAAAAGCAGAGGTGG + Intronic
914753081 1:150549117-150549139 ACTAGGGACTTAAGCAGCCCGGG - Intergenic
916678536 1:167084141-167084163 GGAAGGGCTTTAAGCAGAGGTGG + Intronic
917822292 1:178776117-178776139 ATAAGGGCCTTAAGCATCGGTGG + Intronic
921925283 1:220705979-220706001 AGCAGGGCCTTAAGAGGAGGAGG - Intergenic
922316574 1:224447782-224447804 AATAGTGCCTAAAGCAGAGCAGG - Intronic
1065715724 10:28565532-28565554 ACTAGAACATTAAGCAGAGCTGG - Intronic
1066060977 10:31723305-31723327 GCTAGGGCTGAAAGCAGAGGAGG - Intergenic
1066957721 10:42188790-42188812 ACAAGTGACTTCAGCAGAGGAGG + Intergenic
1069750271 10:70741002-70741024 ACATGGGCCCTAAGCACAGGCGG - Exonic
1071499293 10:86192010-86192032 ACTTGATCCTTAAGGAGAGGGGG + Intronic
1071752944 10:88502275-88502297 AGGAGGCCCTTTAGCAGAGGTGG + Intronic
1072271177 10:93778780-93778802 CCTAGGGCCTAGAGCAGAGCTGG - Intronic
1076076666 10:127538839-127538861 AAAAGGGCCGTAAGCAGGGGCGG - Intergenic
1078378589 11:10818536-10818558 ACTTGAGCCTTAAGCAGGGGAGG + Intronic
1079028343 11:16966557-16966579 ACTGGGAGCTTAAGCAGAAGGGG + Intronic
1079293387 11:19209446-19209468 ACTGGGGCAATAAGAAGAGGAGG - Intronic
1083551686 11:63594724-63594746 TGTAGGGCGTTAAGCAGAGAAGG + Intronic
1084041332 11:66544378-66544400 AGGAGGGTTTTAAGCAGAGGAGG - Intronic
1084334624 11:68449403-68449425 GCTGGGGCCTTGGGCAGAGGTGG + Intergenic
1085461593 11:76697193-76697215 AGTATGGCCTTGAGCAGATGGGG - Intergenic
1090442956 11:126739327-126739349 ACAAGGGTGTTATGCAGAGGAGG - Intronic
1090990171 11:131810168-131810190 ACAGAAGCCTTAAGCAGAGGAGG - Intronic
1094871472 12:34601451-34601473 ACCTGGGCCCTAAGCATAGGCGG - Intergenic
1095487397 12:42699306-42699328 TGTGGGGACTTAAGCAGAGGAGG + Intergenic
1100528991 12:95447064-95447086 ACTAGGGCCGAAAGAAGAGGAGG + Intergenic
1105422678 13:20266772-20266794 ACAAGCCCCTGAAGCAGAGGAGG - Intergenic
1107052607 13:36067648-36067670 ACTAAGGCCTTAAGCAGCCCTGG + Intronic
1107315114 13:39122747-39122769 ACTAGGGCCTGATGGAGAGTTGG + Intergenic
1107992577 13:45831373-45831395 ACTAAGGCTTTCAGCAGAAGGGG + Intronic
1108744064 13:53371749-53371771 ACTAGGTCCTGAAGCAGGTGTGG + Intergenic
1117022096 14:51581264-51581286 TCTAGGTCCTGAAGGAGAGGAGG - Intronic
1121550508 14:94796106-94796128 AGCAGGCCCTTGAGCAGAGGTGG + Intergenic
1123449146 15:20349485-20349507 ACCAGAGCCTTCGGCAGAGGAGG - Intergenic
1124644788 15:31430606-31430628 GGTGGGGCCTTAAGGAGAGGTGG - Intronic
1126069487 15:44853252-44853274 ACTAGTGCCTTTAGCAGGGAAGG - Intergenic
1126089320 15:45037508-45037530 ACTAGTGCCTTTAGCAGGGAGGG + Intronic
1128734967 15:70048311-70048333 GCTAGAGCCTTAACAAGAGGTGG + Exonic
1130847206 15:87758595-87758617 ACTTGGGGCCTAAGAAGAGGTGG - Intergenic
1131456548 15:92586520-92586542 CCTAGTGGCTTAGGCAGAGGTGG + Intergenic
1132479310 16:159206-159228 AGTAGGGGCTTAGACAGAGGAGG + Intronic
1137357931 16:47784504-47784526 ACTCAGGTCTTAAGAAGAGGAGG - Intergenic
1137713432 16:50583056-50583078 ACTTGGGTGTTAGGCAGAGGGGG + Intronic
1139557407 16:67721148-67721170 ACCAGGGTTTTATGCAGAGGAGG - Intergenic
1144486391 17:15668548-15668570 ACGAGGGCCTGAGGAAGAGGGGG - Intronic
1146193351 17:30789905-30789927 ACAAGGGACATAAGCAGAGAAGG + Intronic
1146678268 17:34788773-34788795 CCAATGTCCTTAAGCAGAGGAGG + Intergenic
1149161922 17:53704425-53704447 ACTAGAGCCAAAAGCAGAAGAGG + Intergenic
1152179275 17:78807691-78807713 ACTGTGGCCTTAAGAAGATGTGG - Intronic
1153026857 18:680245-680267 ACTAAGGCCTTCTGCAGATGAGG - Intronic
1157150670 18:45214305-45214327 ACTTGCCCCTTAAACAGAGGAGG - Intronic
1158918871 18:62166885-62166907 ACCAGGGCCTGTAGCAGGGGTGG + Intronic
1160623029 18:80184105-80184127 ACTAGGGCTTCAACCAGATGAGG + Intronic
925552372 2:5090347-5090369 ACTGGGGCCTTTAGAAAAGGAGG - Intergenic
925873630 2:8293103-8293125 ACAAGGGCCCTTAGAAGAGGAGG + Intergenic
929434907 2:41921087-41921109 ACTTGGGCCATGAGAAGAGGGGG + Intergenic
930956716 2:57211511-57211533 AATGGGGCCTTCAGAAGAGGTGG + Intergenic
933998080 2:87684582-87684604 CCTAGGGCCTAACGCATAGGAGG - Intergenic
934305838 2:91821304-91821326 ACAAGTGACTTCAGCAGAGGAGG + Intergenic
934327418 2:92031438-92031460 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
934465802 2:94262018-94262040 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
937388711 2:121463572-121463594 TGTAGGGCCTTATGCAAAGGAGG - Intronic
937600386 2:123724696-123724718 ATTGAGGCCTTAAGGAGAGGAGG + Intergenic
937929849 2:127195544-127195566 ACCAGGGACTGAAACAGAGGCGG + Intronic
937971327 2:127551642-127551664 GCAAGGCCCTAAAGCAGAGGCGG + Intronic
942619694 2:177833982-177834004 ATTCGGGCCTAATGCAGAGGAGG + Intronic
946158508 2:217822120-217822142 ACCAGGGCCTTGCTCAGAGGAGG + Intronic
946427104 2:219605175-219605197 GGTAGGGCCTTGAGCAGAGCTGG + Intronic
947770540 2:232666837-232666859 ACTAGGGCCTTAAGCAGAGGTGG - Intronic
1172276371 20:33681865-33681887 AGGAAGGCCTTAAGCAGGGGCGG - Intronic
1172964599 20:38825522-38825544 TCTAGGAACTCAAGCAGAGGAGG - Intronic
1176596804 21:8705222-8705244 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1179268315 21:39825586-39825608 ACTGGGTCCTGAAGCACAGGTGG - Intergenic
1179579790 21:42334498-42334520 ACTAGGACCTTGAGCTGAGCAGG + Intergenic
1180279724 22:10682664-10682686 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1180586943 22:16901194-16901216 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1181761026 22:25058956-25058978 GCCCGGGCCTTATGCAGAGGTGG - Intronic
1182347577 22:29677520-29677542 AGTAGGGCCTGAAGCAGGGGTGG - Intronic
1182474483 22:30569173-30569195 AGGAGGGTCTTCAGCAGAGGAGG + Intronic
1184297584 22:43534957-43534979 GCCAGGGCCTGAAGCAGAGAAGG - Intronic
1184408121 22:44311699-44311721 TCTAGGGCCTTCAGCAGGGTTGG - Intronic
1184760225 22:46539412-46539434 AATAAGGCTTTAAGCAGAGTGGG + Intergenic
1184923347 22:47620957-47620979 AATAGGGCTCTAAGCAGAAGAGG + Intergenic
949092178 3:41324-41346 ACTAGTGCCCTTAGAAGAGGAGG - Intergenic
954894775 3:53966023-53966045 ACTTGGGCCATGAGCAGAGTGGG - Intergenic
962206868 3:133441958-133441980 GCTAGGGCCTTGAGCAGGAGAGG + Intronic
963547761 3:146683280-146683302 ACTGGGAGCTTAAGCAAAGGAGG + Intergenic
968267722 3:197375608-197375630 ACCAGGGCCTGAAGTAGAGGCGG + Intergenic
969204691 4:5634746-5634768 ACTAAGCCCTAAAGCAGGGGAGG + Intronic
974455110 4:62120336-62120358 ACAAGCCCTTTAAGCAGAGGTGG - Intergenic
981838115 4:149079168-149079190 ACATGGGCCCTGAGCAGAGGAGG - Intergenic
986887439 5:12256958-12256980 ACTAAAGCCTTACTCAGAGGGGG - Intergenic
990061214 5:51651240-51651262 ACTGGGTCCTTAGGCTGAGGAGG + Intergenic
994050665 5:95358926-95358948 ACTAGTTCCATAGGCAGAGGAGG + Intergenic
995190362 5:109312909-109312931 ACTCGGGTCTCAAGCAGATGGGG + Intergenic
998767675 5:145506415-145506437 CCTATGGCCTGAAGCAGAGCTGG - Intronic
999586280 5:153093073-153093095 CATAGGGCTTTAAGCAGAAGAGG + Intergenic
1002932375 6:1643521-1643543 ACCAGGGCCTTAGGCAGTTGTGG + Intronic
1005105852 6:22223481-22223503 ACCAGGGAGTTAAGCACAGGAGG - Intergenic
1005969280 6:30748835-30748857 TCTAGGGCATTAGGCAGAGGAGG + Intergenic
1007708734 6:43807458-43807480 ACTAGGGGAGGAAGCAGAGGGGG - Intergenic
1008103959 6:47422872-47422894 AGTAAGGTCTTACGCAGAGGTGG + Intergenic
1017026733 6:150187455-150187477 ACTAGGGCCTTAAGGGTAGAGGG - Intronic
1018081592 6:160263517-160263539 ACCAGGGCCTTCAGAAGAGAAGG - Intronic
1019652335 7:2166831-2166853 ACAAGGGCCTCAAACAGAAGAGG + Intronic
1019666605 7:2255038-2255060 ACTAGCGCCTGAGGCTGAGGTGG - Exonic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1023108466 7:36786511-36786533 AGCAGGACCTCAAGCAGAGGCGG - Intergenic
1024354408 7:48399789-48399811 GCTGGGGGCTTCAGCAGAGGTGG + Intronic
1028869169 7:95748499-95748521 ACTACCGCCCTAAGAAGAGGGGG + Intergenic
1030372838 7:108719857-108719879 ACTAGGTCCTAAAGATGAGGAGG - Intergenic
1032894838 7:136238743-136238765 ATTAGGGACTTAAGCAGACATGG + Intergenic
1035160675 7:156948396-156948418 ACAAAGGCCATAAACAGAGGAGG + Intergenic
1035718092 8:1769373-1769395 ACTAGAGCCAGAAGCATAGGAGG - Intronic
1037617720 8:20534449-20534471 ACTAGAGCTTGAAGCTGAGGAGG - Intergenic
1041616128 8:59908131-59908153 CCTAGGGCCTTAAGCAAACATGG + Intergenic
1044633107 8:94298063-94298085 ACTAGGGCCTGATGCACAGATGG - Intergenic
1044740744 8:95323688-95323710 ATTTGGGCCTTATGCAGGGGAGG - Intergenic
1049925853 9:406526-406548 AGCAGGGCCTTAAACAAAGGGGG + Intronic
1051542703 9:18237941-18237963 ACTAGGGCATATGGCAGAGGAGG + Intergenic
1052345841 9:27408662-27408684 ACCAGGACCTTAAGCAGAATAGG - Intronic
1052826145 9:33176689-33176711 ACTGGGGACTCCAGCAGAGGTGG + Intergenic
1053695863 9:40638795-40638817 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1053942850 9:43269832-43269854 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1054307110 9:63438013-63438035 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1054405841 9:64762004-64762026 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1054439468 9:65247491-65247513 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1054490939 9:65774448-65774470 ACAAGTGACTTCAGCAGAGGAGG + Intergenic
1057759483 9:97860894-97860916 GCTGGGGCCGTGAGCAGAGGTGG - Intergenic
1061889189 9:133608845-133608867 ACGAGGGCCTAAGGGAGAGGTGG - Intergenic
1202778308 9_KI270717v1_random:12407-12429 ACAAGTGACTTCAGCAGAGGAGG - Intergenic
1189530338 X:41874331-41874353 ACTCGGGCCTGTAGCAGGGGAGG - Intronic
1189907618 X:45777733-45777755 ACAGAGGCCTTAAGCAGAGAAGG + Intergenic
1194122517 X:89977541-89977563 ATAAGGGCCTTAAGCTGAAGGGG + Intergenic
1195903740 X:109824376-109824398 ACCAGGGCCTTAACCAGAACAGG - Intergenic
1199029144 X:142975754-142975776 ACTAGGGCCTGTTGCAGAGTGGG + Intergenic
1200066344 X:153505848-153505870 ACGAGGGCCTGAAGCAGGGTGGG - Exonic
1200475376 Y:3634980-3635002 ATAAGGGCCTTAAGCTGAAGGGG + Intergenic
1201193623 Y:11470711-11470733 ACAAGTGACTTCAGCAGAGGAGG - Intergenic