ID: 947771930

View in Genome Browser
Species Human (GRCh38)
Location 2:232676881-232676903
Sequence CTCAGCTTCCCAAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4063
Summary {0: 2, 1: 3, 2: 58, 3: 541, 4: 3459}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947771930_947771933 1 Left 947771930 2:232676881-232676903 CCTGGACACTTTGGGAAGCTGAG 0: 2
1: 3
2: 58
3: 541
4: 3459
Right 947771933 2:232676905-232676927 CAGGAGAACTCCTCAAACCCAGG 0: 1
1: 7
2: 260
3: 4840
4: 48150
947771930_947771934 10 Left 947771930 2:232676881-232676903 CCTGGACACTTTGGGAAGCTGAG 0: 2
1: 3
2: 58
3: 541
4: 3459
Right 947771934 2:232676914-232676936 TCCTCAAACCCAGGAGTTCAAGG 0: 1
1: 4
2: 67
3: 693
4: 4560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947771930 Original CRISPR CTCAGCTTCCCAAAGTGTCC AGG (reversed) Intronic
Too many off-targets to display for this crispr