ID: 947776558

View in Genome Browser
Species Human (GRCh38)
Location 2:232716493-232716515
Sequence CTCAGTCATCCCTACTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 0, 3: 53, 4: 576}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947776553_947776558 1 Left 947776553 2:232716469-232716491 CCCGCGTTCAAGCAATCCTCATG 0: 2
1: 62
2: 3404
3: 51770
4: 143683
Right 947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG 0: 1
1: 0
2: 0
3: 53
4: 576
947776552_947776558 4 Left 947776552 2:232716466-232716488 CCTCCCGCGTTCAAGCAATCCTC 0: 3
1: 383
2: 18774
3: 95415
4: 200844
Right 947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG 0: 1
1: 0
2: 0
3: 53
4: 576
947776551_947776558 7 Left 947776551 2:232716463-232716485 CCACCTCCCGCGTTCAAGCAATC 0: 3
1: 256
2: 12238
3: 59605
4: 128130
Right 947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG 0: 1
1: 0
2: 0
3: 53
4: 576
947776554_947776558 0 Left 947776554 2:232716470-232716492 CCGCGTTCAAGCAATCCTCATGC 0: 2
1: 54
2: 2922
3: 43746
4: 99907
Right 947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG 0: 1
1: 0
2: 0
3: 53
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947776558 Original CRISPR CTCAGTCATCCCTACTAGCT GGG Intronic
900002460 1:22141-22163 CTCACTCATCCCACCTGGCTTGG - Intergenic
900219447 1:1499708-1499730 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
901171401 1:7260567-7260589 CTCAGCCATCCCCACTAGACAGG - Intronic
902119799 1:14153659-14153681 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
902400524 1:16154637-16154659 CTCAAGCCTCCCTAGTAGCTGGG - Intronic
902438631 1:16414774-16414796 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
902716245 1:18274908-18274930 CTCAGCCTTCCCTAGTAGCTGGG - Intronic
902906037 1:19558010-19558032 CTCAGCCTTCCTTAGTAGCTGGG + Intergenic
903176294 1:21583508-21583530 CTCAGTCCTCACTACGTGCTGGG - Intergenic
903219101 1:21859162-21859184 CTCAGTTCTCCCGAGTAGCTGGG + Intronic
903483870 1:23675295-23675317 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
903855458 1:26335358-26335380 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
904017630 1:27435061-27435083 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
904163823 1:28540182-28540204 CTCAGTAATCCCGAGTAGCTGGG + Intergenic
904680349 1:32224785-32224807 CTCAGCCAGCCCCAGTAGCTGGG + Intronic
904729711 1:32580432-32580454 CTCAAGCTTCCCTAATAGCTGGG - Intronic
905185656 1:36194680-36194702 CTTAGTCCTCCCGAGTAGCTGGG - Intergenic
905542884 1:38774189-38774211 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
905696632 1:39979449-39979471 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
905735710 1:40324432-40324454 CTCAGACCTCCCAAGTAGCTGGG + Intergenic
906018436 1:42604626-42604648 CTGAGTCAACACTAATAGCTTGG - Intronic
906029295 1:42704976-42704998 CTCAGCCACCCCAAGTAGCTGGG - Intergenic
906151394 1:43589743-43589765 CTCAGCCCTCCCAAGTAGCTGGG - Intronic
907080636 1:51618132-51618154 CTCTGGCCTCCCTAGTAGCTGGG + Intronic
907183607 1:52591743-52591765 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
907350291 1:53824116-53824138 CTCAGTCCTCCTGAGTAGCTGGG - Intronic
907356043 1:53874648-53874670 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
907655904 1:56341619-56341641 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
907769512 1:57446479-57446501 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
908153453 1:61328535-61328557 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
908550465 1:65203686-65203708 CTCAGCCCTCCCAAGTAGCTGGG - Intronic
908842004 1:68289244-68289266 CTCAATCCTCCCAAGTAGCTAGG - Intergenic
908918948 1:69167065-69167087 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
910752194 1:90644002-90644024 CTCAGCCTTCCCGAATAGCTGGG + Intergenic
912583542 1:110741130-110741152 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
914424464 1:147562210-147562232 CTCAGCCTTCCCGAGTAGCTAGG - Intronic
914849019 1:151300488-151300510 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
915217126 1:154347822-154347844 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
916649713 1:166823383-166823405 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
916751966 1:167731318-167731340 CTCAGCCTTCCCGAATAGCTGGG - Intronic
918336351 1:183518062-183518084 CTCAGCCTTCCCCAGTAGCTGGG + Intronic
918789004 1:188801274-188801296 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
919107055 1:193166761-193166783 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
919291733 1:195642364-195642386 CTCAGCCTTCCCAAGTAGCTAGG + Intergenic
920295431 1:204953411-204953433 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
920518084 1:206601452-206601474 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
920757589 1:208749046-208749068 CTCTGTCTTCCCTCCTAGCCTGG - Intergenic
921870302 1:220132639-220132661 CTCATTCCTCCCAAGTAGCTGGG + Intronic
922301027 1:224300987-224301009 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
922317206 1:224453002-224453024 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
922495976 1:226058284-226058306 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
923703925 1:236327721-236327743 CTCAGTCCTCCTGAGTAGCTGGG + Intergenic
924256027 1:242183776-242183798 CTCAGACCTCCCCAGTAGCTGGG - Intronic
924290882 1:242535167-242535189 CTCAGTCCCCCCTGGTAGCTGGG + Intergenic
1062985748 10:1766813-1766835 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1063426067 10:5951023-5951045 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1065053998 10:21824888-21824910 CTCAGGCATTCCGAGTAGCTGGG + Intronic
1065664925 10:28048880-28048902 CTCAGTCATCCTTAGTACATTGG + Intergenic
1065718492 10:28599986-28600008 CTCTGCCATCCCTTCTAGATTGG + Intronic
1066067316 10:31771815-31771837 CTCAGTCCTCCCGAGTAGCTGGG - Intergenic
1066572713 10:36790939-36790961 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1067376263 10:45730228-45730250 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1067838713 10:49658399-49658421 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1067883962 10:50070913-50070935 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1068636223 10:59351214-59351236 CTCAGCCTCCCCTATTAGCTGGG - Intronic
1068711644 10:60141383-60141405 CTCAGTCCTGCCTCCTATCTGGG - Intronic
1070109438 10:73469423-73469445 CTCAGCCCTCCCTAATAGCTGGG - Intronic
1070233595 10:74598564-74598586 CTCAGCCCTCCCAAGTAGCTAGG + Intronic
1070843822 10:79506327-79506349 CTCAGCCACCCCTTCTACCTGGG - Intergenic
1070929844 10:80253297-80253319 CTCAGCCACCCCTTCTACCTGGG + Intergenic
1071244821 10:83751305-83751327 CTCAGTCAGTCCTCCTACCTCGG + Intergenic
1072145300 10:92630748-92630770 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1072462208 10:95630225-95630247 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1072596444 10:96876803-96876825 CTCAGGCCTCCCGAGTAGCTGGG + Intronic
1072889204 10:99306824-99306846 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1073213078 10:101820147-101820169 CTTAGCCATCCCGAGTAGCTGGG + Intergenic
1073263194 10:102206112-102206134 CTCAGGCTTCCCAAGTAGCTGGG - Intergenic
1073388613 10:103151346-103151368 CTCAGCCTTCCTTAGTAGCTGGG - Intronic
1073708508 10:106014266-106014288 CTCAGTCATCCCATCTGCCTAGG + Intergenic
1073797492 10:107004057-107004079 CTCAGCCTTCCAAACTAGCTGGG - Intronic
1074225706 10:111482086-111482108 CTCAGCCTCCCCTCCTAGCTGGG + Intergenic
1074338833 10:112606139-112606161 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1074380782 10:112978580-112978602 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
1074425288 10:113345474-113345496 CACAGTCATCTCTATTACCTGGG + Intergenic
1075004453 10:118820038-118820060 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1075181670 10:120216687-120216709 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1077877737 11:6321661-6321683 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1078152451 11:8770804-8770826 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1078574122 11:12484139-12484161 CTCAGTCATGCCTACTGCCTAGG - Intronic
1079349504 11:19680463-19680485 CTCATTCAGCCCTACTGGCCTGG - Intronic
1079383258 11:19957530-19957552 ATCAGTCATCCCTGATGGCTGGG + Intronic
1079609736 11:22417122-22417144 CTCAGTGACCCCAAGTAGCTAGG - Intergenic
1080139952 11:28904763-28904785 CTCAGCCTCCCCAACTAGCTGGG - Intergenic
1080515640 11:33016808-33016830 CTGAGTCACCCCTATTAACTGGG - Intronic
1080536548 11:33227265-33227287 CTCAGCCCTCCCAAGTAGCTGGG - Intergenic
1080789282 11:35507161-35507183 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1081460745 11:43270349-43270371 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
1083563494 11:63693365-63693387 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1083564082 11:63698238-63698260 CTCAGTCCCCCCAAGTAGCTGGG + Intronic
1083875105 11:65518872-65518894 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1084015141 11:66374385-66374407 CTCAGCCTCCCCTAGTAGCTGGG + Intergenic
1084113163 11:67026387-67026409 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1084140501 11:67224955-67224977 CCCAGGCATCCCGAGTAGCTGGG + Intronic
1084176848 11:67427209-67427231 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1085096803 11:73767929-73767951 CTCAATCTTCCCAAGTAGCTGGG - Intergenic
1085622487 11:78047896-78047918 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1087014955 11:93545469-93545491 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
1088348844 11:108861908-108861930 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1088581822 11:111324031-111324053 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1089403315 11:118177658-118177680 CTCAGTCCCCCCAAGTAGCTGGG - Intergenic
1089475912 11:118761498-118761520 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1089540556 11:119187021-119187043 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1089558648 11:119331697-119331719 CTCAGTCTCCCCCAGTAGCTGGG - Intergenic
1090922986 11:131223448-131223470 CTCAGTGCTCTCTACTAGCCAGG + Intergenic
1090966119 11:131599028-131599050 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
1091233868 11:134006430-134006452 CTCAGGCCTCCCAAGTAGCTAGG + Intergenic
1091961169 12:4695618-4695640 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1092354263 12:7781729-7781751 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
1092371336 12:7918847-7918869 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1092387834 12:8049863-8049885 CTCAGTAATCCCTACCGCCTGGG + Intronic
1092539404 12:9411358-9411380 CTCAGCCCTCCCTAGCAGCTGGG + Intergenic
1093245312 12:16729466-16729488 CTCAGTGTCCCCTAGTAGCTGGG + Intergenic
1093902991 12:24657734-24657756 CTGAGTAATCCCAAGTAGCTGGG + Intergenic
1094159634 12:27376882-27376904 CTCAGTCCCCCCGAGTAGCTGGG - Intronic
1094524064 12:31220114-31220136 CTCACTCATCCCACCTGGCTTGG - Intergenic
1095428809 12:42110664-42110686 CTCAGGCCTCCCAAGTAGCTGGG + Intronic
1095972405 12:47911490-47911512 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
1096202160 12:49692235-49692257 ATCAGTCCTCCCAAGTAGCTGGG - Intronic
1096626282 12:52898046-52898068 CTCAGGCCTCCCAAGTAGCTGGG - Intronic
1097111193 12:56659511-56659533 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1097866771 12:64565595-64565617 CTCAGAAACCCCTAGTAGCTGGG - Intergenic
1099094326 12:78354077-78354099 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1099554555 12:84095026-84095048 CTCAGCCATCCCGAGTAGCTGGG - Intergenic
1100541498 12:95561642-95561664 CTCAGCCCTCCCAAGTAGCTGGG + Intergenic
1101687436 12:107039006-107039028 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1102664182 12:114555876-114555898 CTCAGATCTCCCTAGTAGCTGGG - Intergenic
1102951556 12:117034813-117034835 CTCAGTCAGCCCCACCATCTGGG - Intergenic
1103250394 12:119494862-119494884 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1103300464 12:119922406-119922428 CTCAGCCCTCCCAAGTAGCTGGG - Intergenic
1103433464 12:120906530-120906552 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
1103525515 12:121565431-121565453 CTCAGCCTTCCCGAGTAGCTAGG + Intronic
1103667463 12:122581313-122581335 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1103759902 12:123241452-123241474 CTCAGTCCTCCCAAGTAGCTGGG + Intronic
1104430908 12:128715175-128715197 CTCAGACCTCCCTAGTAGCTGGG - Intergenic
1104703449 12:130924824-130924846 CTCAAGCCTCCCTAGTAGCTGGG + Intergenic
1105877797 13:24574607-24574629 CTGAGTAATCCCGAGTAGCTGGG + Intergenic
1106260419 13:28061652-28061674 CCCAGTCCTCCCAAGTAGCTGGG - Intronic
1106716915 13:32399899-32399921 CTCAAGCCTCCCTAGTAGCTGGG + Exonic
1106776146 13:33011797-33011819 CTCAGTCTCCCCAAGTAGCTGGG - Intergenic
1106837315 13:33648906-33648928 TTCAGCCTTCCCTAGTAGCTGGG + Intergenic
1106884792 13:34173056-34173078 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1111377610 13:87401235-87401257 CTCAGGCTTCCCAAGTAGCTAGG + Intergenic
1111852246 13:93590686-93590708 ATCAGTCATACCTACTTTCTGGG - Intronic
1112526387 13:100151473-100151495 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1114318888 14:21530402-21530424 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1114929249 14:27447185-27447207 CTCAGGCCTCCCGAGTAGCTGGG + Intergenic
1115218466 14:31035844-31035866 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1115241969 14:31258912-31258934 CTCAGTCTCCCGTAGTAGCTGGG - Intergenic
1115449241 14:33527180-33527202 CTCCGTCTTCCCTAGTAGCTGGG + Intronic
1115621361 14:35143762-35143784 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1115682622 14:35758620-35758642 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1115740803 14:36385787-36385809 CTCAGGCATCCCTATTCCCTGGG + Intergenic
1115988694 14:39128998-39129020 CTCAGCCCTCCCTAGTAGTTGGG - Intronic
1116345246 14:43784851-43784873 CTCAGACTTCCCTAGTAGCTGGG - Intergenic
1116602061 14:46938421-46938443 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1117154566 14:52925440-52925462 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1117352001 14:54890379-54890401 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1117531323 14:56663010-56663032 CTCAGTCTTCCTGAGTAGCTGGG - Intronic
1118171533 14:63394196-63394218 CTCAGGCCTCCCAAGTAGCTGGG + Intronic
1118196841 14:63634751-63634773 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1118420131 14:65593690-65593712 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1119274083 14:73337383-73337405 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1119375270 14:74186173-74186195 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1119578759 14:75755146-75755168 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1119814172 14:77550456-77550478 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1120986941 14:90343286-90343308 CTCAATCCTCCCAAGTAGCTGGG - Intergenic
1122102769 14:99426681-99426703 GTCAGTGATCACTACTAGATGGG - Intronic
1123917600 15:25048435-25048457 CTCAGTCTCCCCGAGTAGCTGGG + Intergenic
1124551177 15:30682636-30682658 AGCAGTCCTTCCTACTAGCTAGG - Intronic
1124680067 15:31723018-31723040 AGCAGTCCTTCCTACTAGCTAGG + Intronic
1124912401 15:33934612-33934634 CTTAGTCATCCTTCCTAGCAAGG - Intronic
1125706550 15:41742270-41742292 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1125907027 15:43402161-43402183 CTCAGGCCTCCCAAGTAGCTGGG - Intronic
1125963680 15:43854451-43854473 CTCAGGCCTCCCAAGTAGCTGGG - Intronic
1126018501 15:44376115-44376137 CTCAGCCGTCCCAAGTAGCTGGG - Intronic
1126079688 15:44947561-44947583 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1126853692 15:52816558-52816580 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1127425361 15:58850698-58850720 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
1128111724 15:65080397-65080419 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1128289276 15:66464639-66464661 CTCAGCCATCCTGAGTAGCTGGG + Intronic
1128310115 15:66625303-66625325 CTCAGCCTCCCCAACTAGCTGGG - Intronic
1128699683 15:69795129-69795151 CTCAGACCTCACTACTAGCTAGG - Intergenic
1129595557 15:76961218-76961240 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1129652338 15:77499944-77499966 CTCAGCCCTCCCTAATAGCTGGG + Intergenic
1129930064 15:79403104-79403126 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1130342031 15:83007773-83007795 CTCAGGCCTCCCAAGTAGCTGGG - Intronic
1131088273 15:89597406-89597428 CTCAGTAACCCCAAGTAGCTGGG - Intronic
1132038148 15:98503391-98503413 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1132512437 16:351013-351035 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1132713036 16:1277726-1277748 CTCAGCTCTCCCAACTAGCTGGG + Intergenic
1132845320 16:1998605-1998627 CTCAGTCATCCCCTCTGGCCCGG + Intronic
1132898672 16:2241410-2241432 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1132902301 16:2263826-2263848 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1133174705 16:4005460-4005482 CTCAGGCATCCCTCCCACCTCGG + Intronic
1133721694 16:8500163-8500185 CTCACTCCTCCCGAGTAGCTGGG - Intergenic
1133884663 16:9814902-9814924 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1134144116 16:11746377-11746399 CTCAGTCTCCCCGAGTAGCTGGG + Intergenic
1134372554 16:13638878-13638900 CTCAGTCTTCCCAAGTAGCTGGG + Intergenic
1135291419 16:21242301-21242323 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1135733771 16:24915043-24915065 CTCAATCATCCCTACTTCCTGGG + Intergenic
1136241219 16:28945489-28945511 CTCAAGCATTCCTAGTAGCTGGG + Intergenic
1137399104 16:48138850-48138872 CTCAGTCCTGCCAACTAGCTGGG - Intronic
1137591258 16:49695407-49695429 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1137762516 16:50952109-50952131 CTCAGGCAACCCTACTTGTTAGG + Intergenic
1138653053 16:58472698-58472720 CTCCCTCATTCCTACTAGTTTGG + Intronic
1139391193 16:66606875-66606897 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1139501952 16:67373894-67373916 CTCAGTCAACCCAAGTAGCTGGG - Intronic
1139510610 16:67426349-67426371 CTCAGGCCTCCGTAGTAGCTGGG - Intergenic
1139621493 16:68148130-68148152 CTCAGTCTTCCTGAGTAGCTGGG + Intronic
1139693018 16:68653351-68653373 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1139813761 16:69648057-69648079 CTCAGTTCTCCCAAGTAGCTGGG - Intronic
1139904480 16:70354260-70354282 CTCAGCCTTCCCGAATAGCTGGG + Intronic
1140471366 16:75217080-75217102 CTCAGTCCCCCCAAGTAGCTGGG - Intergenic
1140829102 16:78734980-78735002 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1140900300 16:79360814-79360836 CTGAGTCATCCCTGCTGGGTGGG - Intergenic
1141502569 16:84453955-84453977 CTCAGTCTCCCCAAGTAGCTGGG + Intronic
1142333913 16:89474381-89474403 CTCAGTCATTCCTTCCACCTTGG - Intronic
1142523618 17:522136-522158 CTCAGTCTTCCTCAGTAGCTGGG - Intronic
1142615656 17:1133123-1133145 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1142814192 17:2412481-2412503 CTCAGTCTCCCCAAGTAGCTGGG - Intronic
1142846153 17:2678283-2678305 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1143083562 17:4399045-4399067 CTCAGCCCTCCCGAGTAGCTGGG + Intergenic
1143144459 17:4765249-4765271 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1143218912 17:5245222-5245244 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1143815400 17:9508441-9508463 CTCAGTCCTCCTGAGTAGCTGGG + Intronic
1143870047 17:9951638-9951660 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1144271020 17:13616076-13616098 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1144295471 17:13871151-13871173 CTCAGCCTCCCCTAGTAGCTGGG + Intergenic
1144512804 17:15891962-15891984 CTCAGCCTTCCCCAGTAGCTGGG + Intergenic
1144569802 17:16390022-16390044 CTCAGCCTTCCCAAGTAGCTAGG + Intergenic
1145054432 17:19691004-19691026 CTCAGCCTTCCCGAGTAGCTAGG - Intronic
1145085243 17:19932334-19932356 CTCAGGCCTCCCGAGTAGCTGGG - Intronic
1145867218 17:28248978-28249000 CTCAGTCATCCTGAATAGGTGGG + Intergenic
1146992887 17:37291290-37291312 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1147053315 17:37814545-37814567 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1147069773 17:37945266-37945288 CTCAGTCTCCCCAAGTAGCTGGG - Intergenic
1147081303 17:38024804-38024826 CTCAGTCTCCCCAAGTAGCTGGG - Intronic
1147097245 17:38148761-38148783 CTCAGTCTCCCCAAGTAGCTGGG - Intergenic
1147113379 17:38280324-38280346 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1147330698 17:39697470-39697492 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1147332640 17:39707880-39707902 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1147676069 17:42206689-42206711 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1147752202 17:42743284-42743306 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
1147752849 17:42747382-42747404 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1147885091 17:43678967-43678989 CTCAGTCATAGCCACTGGCTGGG - Intergenic
1148416239 17:47508866-47508888 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1148461717 17:47842820-47842842 CTCAGTCTTCCCAAGTAGCTGGG - Intergenic
1148643212 17:49203785-49203807 CTCAGTCTTCCCAAGTAGCTGGG - Intronic
1149509626 17:57229414-57229436 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1149573560 17:57695302-57695324 CTGAGTCATACTCACTAGCTAGG - Intergenic
1149889636 17:60375718-60375740 CTCAGTCTCCCCAAGTAGCTGGG + Intronic
1151317662 17:73333516-73333538 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1151455269 17:74222110-74222132 CACAGCCCTCCCTGCTAGCTGGG + Intronic
1151566813 17:74902988-74903010 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1151846844 17:76662333-76662355 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1152193385 17:78902221-78902243 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1152848619 17:82618043-82618065 CTCAGCCCTGCCTAGTAGCTGGG + Intronic
1153019808 18:617476-617498 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1153172520 18:2332517-2332539 CTCACTCTTCCATACTAGGTGGG - Intergenic
1153889535 18:9499937-9499959 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
1154112443 18:11581824-11581846 CTCAGTCTCCCCGAGTAGCTGGG - Intergenic
1155011386 18:21782237-21782259 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1155157012 18:23166316-23166338 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1159021868 18:63149994-63150016 CTCAGTCTTCCCGAATGGCTGGG + Intronic
1160634212 19:63749-63771 CTCACTCATCCCACCTGGCTTGG - Intergenic
1160776160 19:856911-856933 CTCAGGCTTCCCGAGTAGCTGGG - Intergenic
1161011484 19:1961369-1961391 CTCAGGTATCCCTCCTGGCTGGG + Intronic
1161465015 19:4424578-4424600 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1161478014 19:4496988-4497010 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
1161664970 19:5569950-5569972 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1161687454 19:5710198-5710220 CTCAGTAATCCCGAGTAGCTGGG + Intronic
1161996137 19:7712779-7712801 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
1162068134 19:8137986-8138008 CACTGTCATCCCTACTAGCCAGG + Intronic
1162690467 19:12425855-12425877 CTCAGGCCTCCCAAGTAGCTGGG - Intronic
1163403534 19:17108827-17108849 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
1163531203 19:17849950-17849972 CTCAGCCTCCCCTAGTAGCTGGG - Intergenic
1163925164 19:20334251-20334273 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
1163997345 19:21063522-21063544 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1164660309 19:29959239-29959261 CTCAGTCTCCCCGAGTAGCTGGG + Intronic
1165000191 19:32754791-32754813 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1165407321 19:35638790-35638812 CTCAGCCCTCCCAAGTAGCTGGG - Intergenic
1165990151 19:39806379-39806401 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1166066304 19:40361225-40361247 CTCAGCAATCCCGAGTAGCTGGG + Intronic
1166371548 19:42304162-42304184 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1166574344 19:43823460-43823482 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1166643462 19:44513551-44513573 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
1166970304 19:46562713-46562735 CTCAGGCCTCCCGAGTAGCTGGG - Intronic
1167071189 19:47222847-47222869 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1167083726 19:47294866-47294888 CTCAGGCATTCCTCCTATCTTGG + Intronic
1167159671 19:47758972-47758994 CTCCGTCCTCCCAAGTAGCTGGG + Intergenic
1167478032 19:49712225-49712247 CTCAGCCCTCCCAAGTAGCTGGG - Intronic
1168006124 19:53489121-53489143 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1168020051 19:53602648-53602670 CTCAGTCTCCCCGAGTAGCTGGG + Intronic
1168608912 19:57783189-57783211 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
925313286 2:2903072-2903094 GTCTGTCTTCCCTACTGGCTGGG + Intergenic
926106399 2:10154810-10154832 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
926115993 2:10213827-10213849 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
926199149 2:10780858-10780880 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
927508652 2:23630598-23630620 CTCAGTCTCCCCAAGTAGCTAGG + Intronic
927618054 2:24620486-24620508 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
927650212 2:24908204-24908226 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
927677577 2:25117527-25117549 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
927710253 2:25321014-25321036 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
927771968 2:25870405-25870427 CTCAGTCCTCCCGAGTAGCTGGG - Intronic
928604771 2:32935503-32935525 CTCAGGCCTCCCGAGTAGCTGGG - Intergenic
928671365 2:33606826-33606848 CTCAGGCCTCCCGAGTAGCTGGG + Intergenic
928700823 2:33896757-33896779 CTCCCTCTTCCCTAGTAGCTAGG - Intergenic
929913317 2:46112633-46112655 CTCAGCCACCCCAAGTAGCTGGG + Intronic
929999424 2:46850863-46850885 CTCAGTCAGCCATGCTATCTTGG + Intronic
930062264 2:47299973-47299995 CTCAGCCTTCCCAAATAGCTGGG - Intergenic
930642964 2:53873122-53873144 CTCAGCCATCCCAAGTAGCTGGG - Intronic
930668666 2:54124816-54124838 CTCTATCCTCCCTAATAGCTGGG + Intronic
930825885 2:55696358-55696380 CTCAGCCCTCCCAAATAGCTGGG + Intergenic
931097946 2:58963166-58963188 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
931352802 2:61507128-61507150 CTCAGTCTCCCCAAGTAGCTGGG - Intronic
931729390 2:65139577-65139599 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
932530939 2:72531866-72531888 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
932536724 2:72605165-72605187 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
932726385 2:74183199-74183221 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
932755442 2:74405135-74405157 CTCAGTAATCCCGAGTAGCTGGG - Intergenic
932798737 2:74720656-74720678 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
932803834 2:74766315-74766337 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
933476744 2:82801228-82801250 CTCAGCCATTCATATTAGCTAGG - Intergenic
933661331 2:84929363-84929385 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
935300222 2:101687202-101687224 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
936104256 2:109611642-109611664 CTCAGCCACCCCAAGTAGCTAGG - Intronic
938232053 2:129669596-129669618 CTCAGTCTTCCCTAGGACCTGGG + Intergenic
938817003 2:134915214-134915236 CTCAGCCACCCCAAGTAGCTGGG + Intergenic
938912046 2:135895018-135895040 CTCAGTCCTCCATAGTAGCTGGG + Intergenic
938965857 2:136387883-136387905 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
939274299 2:139980373-139980395 CTCAGTCCTCCCTATTTCCTGGG - Intergenic
940036015 2:149312682-149312704 CTCAGTCTCCCCAAGTAGCTGGG + Intergenic
941795622 2:169595918-169595940 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
941817659 2:169813744-169813766 CTCAGTCTCCCCAACTAGCTGGG - Intronic
942036362 2:172014225-172014247 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
942185252 2:173419128-173419150 CTCAGTCATGCACACTAGCATGG - Intergenic
943654984 2:190499030-190499052 CTCAGCCTTCCATAGTAGCTGGG - Intronic
944069583 2:195654053-195654075 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
944282926 2:197918822-197918844 CTCAGGCTCCCCTAGTAGCTGGG - Intronic
944416151 2:199481776-199481798 CTCAGCCTCCCCGACTAGCTGGG + Intergenic
945259950 2:207834244-207834266 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
945433131 2:209788298-209788320 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
946295463 2:218780591-218780613 CTCAGTCTCCCCAAGTAGCTGGG + Intergenic
947631654 2:231657361-231657383 CTCAGCCTTCCCTAGTAGCAGGG - Intergenic
947769236 2:232657693-232657715 CTCAGGCCTCCCGAGTAGCTGGG - Intronic
947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG + Intronic
948621223 2:239235921-239235943 CTCAGTCTCCCCAAGTAGCTGGG - Intronic
949016238 2:241712909-241712931 CTCAGCTTTCCCTAGTAGCTGGG - Intronic
1168782537 20:505989-506011 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
1169429588 20:5524794-5524816 CTCAGGCCTCCCGAGTAGCTGGG - Intergenic
1170181157 20:13531605-13531627 CTCAGTCTCCCCAAGTAGCTGGG + Intronic
1172069005 20:32242521-32242543 CTCAGCCTTCCCAAATAGCTGGG - Intergenic
1172451979 20:35032586-35032608 CTCAGGCCTCCCCAGTAGCTGGG + Intronic
1172456893 20:35083491-35083513 CTCAGCCTCCCCTAGTAGCTGGG - Intronic
1172582607 20:36060181-36060203 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1172986271 20:38993474-38993496 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1173196114 20:40913990-40914012 CTCACACAGCCCTGCTAGCTTGG + Intergenic
1173437538 20:43046450-43046472 CTCAGCCTCCCCTAGTAGCTGGG - Intronic
1173592119 20:44232881-44232903 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1174059747 20:47824395-47824417 CTCAGTCTCCCCGAGTAGCTGGG - Intergenic
1174226216 20:49002758-49002780 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1174587445 20:51619750-51619772 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1174674532 20:52340858-52340880 CTCAGCCTCCCCTAGTAGCTGGG + Intergenic
1174818948 20:53711000-53711022 CTCAGTCCTCCCGAGTAGCTGGG - Intergenic
1174906963 20:54561770-54561792 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1177036223 21:16046417-16046439 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1177055374 21:16295041-16295063 CTCTGTCATCTTAACTAGCTTGG + Intergenic
1177148759 21:17433442-17433464 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1178816107 21:35930946-35930968 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1178839705 21:36129015-36129037 CTCAGCCCTCCCGAGTAGCTGGG + Intergenic
1178918226 21:36721554-36721576 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1179212130 21:39333825-39333847 CTCTTTCATCCCCAGTAGCTAGG - Intergenic
1180639610 22:17287828-17287850 CTCAAGCCTCCCAACTAGCTGGG + Intergenic
1180943228 22:19674058-19674080 CTTCATCATCCCTAGTAGCTGGG + Intergenic
1181087028 22:20445321-20445343 CTCAGTCTTCCCAAGTAACTGGG + Intronic
1181279909 22:21712056-21712078 CTCAGCTATCCCAAGTAGCTGGG - Intronic
1181302183 22:21888690-21888712 CTCAGCAATCCCAAGTAGCTGGG + Intergenic
1181384969 22:22537975-22537997 CTCAGACTTCCCAAGTAGCTGGG - Intergenic
1182231669 22:28841996-28842018 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1182309873 22:29397021-29397043 CTCAGTCCTCCCGAATGGCTGGG + Intronic
1182337594 22:29594799-29594821 CTCAGCCCTCCCTTGTAGCTGGG - Intergenic
1182632866 22:31701102-31701124 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1183464435 22:37972642-37972664 CTCAGTCAGCCCCACTCCCTGGG - Exonic
1183836555 22:40458956-40458978 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1183988365 22:41581866-41581888 CTCAGCCTTCCCAAGTAGCTAGG - Intronic
1183989255 22:41587151-41587173 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1184074321 22:42166490-42166512 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1184980301 22:48090842-48090864 CTCTCTCATCCCCACCAGCTGGG - Intergenic
1185322277 22:50207237-50207259 CTCAGTCCCCCCAAATAGCTGGG + Intronic
949769814 3:7567629-7567651 CTCAGCCTTCCCCAGTAGCTGGG - Intronic
949812468 3:8020738-8020760 CTCCTTCTTCCCTACTGGCTGGG - Intergenic
950065931 3:10111702-10111724 CTCAGCCTTCCCAAATAGCTGGG - Intergenic
950376076 3:12573415-12573437 CTCAGTCCTGCCGAGTAGCTGGG - Intronic
950439517 3:13001065-13001087 CTCAGGCCTCCCAAGTAGCTGGG + Intronic
953012079 3:39036258-39036280 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
953366424 3:42349482-42349504 CTCAAGCATCCCTACCACCTTGG + Intergenic
953654565 3:44839254-44839276 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
954262235 3:49447800-49447822 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
954451725 3:50575304-50575326 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
955271092 3:57500154-57500176 CTCAGCCCCCCCTAGTAGCTGGG + Intronic
955299350 3:57762250-57762272 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
955357774 3:58245661-58245683 CTCAGTCTCCCCAAGTAGCTGGG - Intronic
956108047 3:65842475-65842497 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
956501829 3:69895044-69895066 CTCAGACTTCCCTCCTAGCCTGG + Intronic
956999345 3:74867264-74867286 CTTAGTCATCCCGGGTAGCTGGG + Intergenic
960094034 3:113670855-113670877 CTCAGGCCTCCCGAATAGCTGGG + Intronic
960667480 3:120124278-120124300 CTCAGCCTCCCCGACTAGCTGGG + Intergenic
960676592 3:120201305-120201327 CTCAGCCACCCCAAGTAGCTGGG + Intronic
961690263 3:128664409-128664431 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
962014361 3:131424910-131424932 CTCAGGCTTCCCAAGTAGCTGGG - Intergenic
963083975 3:141419868-141419890 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
963856493 3:150258951-150258973 CTCAGCCTTCCCCAGTAGCTGGG + Intergenic
964279110 3:155043446-155043468 CTCAGTCTTCCCAAGTAGCTGGG + Intronic
965429827 3:168572794-168572816 CTCAGTCTACCCAAGTAGCTGGG - Intergenic
965566470 3:170123961-170123983 CTCAGCCACCCCGAGTAGCTGGG + Intronic
966156065 3:176917919-176917941 CTCAATCAGCCCTTCAAGCTCGG - Intergenic
966898141 3:184461208-184461230 CTCAGTCTTCCTCAGTAGCTGGG + Intronic
967027372 3:185576705-185576727 CTCAGTGCCCCCTAGTAGCTGGG - Intergenic
968026594 3:195447707-195447729 CTCAGCCCTCCCAAGTAGCTGGG - Intergenic
968723830 4:2229704-2229726 CTCAGGCCTCCCGAGTAGCTGGG - Exonic
968828313 4:2915705-2915727 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
969012829 4:4080983-4081005 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
971549922 4:27940217-27940239 CTCAGGCCTCCCGAGTAGCTGGG - Intergenic
972363415 4:38350197-38350219 CTCACTCATGCCTACTTCCTGGG + Intergenic
972528150 4:39936549-39936571 CTCAGCCTGCCCTAATAGCTGGG + Intronic
972611770 4:40662380-40662402 CTCAGTCCCCACTAGTAGCTGGG + Intergenic
975745164 4:77468171-77468193 CTCCATCTCCCCTACTAGCTTGG + Intergenic
975848127 4:78546857-78546879 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
976314912 4:83648854-83648876 CTCAGTGATCCCAAGTAGCTGGG - Intergenic
976614557 4:87063354-87063376 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
976930890 4:90565971-90565993 CTGCCTCATCCCTAGTAGCTGGG + Intronic
978791658 4:112669253-112669275 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
979676527 4:123415388-123415410 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
980116912 4:128687934-128687956 CTCAGCCTTCCCTAGTAGCTGGG - Intergenic
981018521 4:140000909-140000931 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
981478470 4:145211705-145211727 CTCAGCCTCCCCTAGTAGCTGGG + Intergenic
981660939 4:147166019-147166041 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
982266149 4:153539992-153540014 CTCAGCCTTCCCCAGTAGCTGGG - Intronic
982746650 4:159110459-159110481 CTCAGTCTCCCCGAGTAGCTGGG - Intronic
983538472 4:168882972-168882994 CTCAGCCCTCCCAAGTAGCTGGG - Intronic
984996180 4:185432627-185432649 CTCAAGCATTCCTCCTAGCTCGG - Intronic
985075034 4:186205811-186205833 CCCAGCCATCCCTACCATCTTGG + Intronic
985100203 4:186451046-186451068 CTCAGCCCTCCCAAGTAGCTGGG - Intronic
985765165 5:1774243-1774265 CTCAGCCCTCCCAAATAGCTGGG - Intergenic
985877754 5:2613208-2613230 CTAAGTCACCCCTACCACCTTGG + Intergenic
986390075 5:7277271-7277293 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
986480078 5:8177634-8177656 CTCAGTCAACCCTAGCTGCTGGG - Intergenic
987250556 5:16096171-16096193 CTCAGTCATACCTACTTGAAAGG + Intronic
987339339 5:16925525-16925547 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
987582337 5:19810212-19810234 CTCAGTCCTCCCGAGTAGCTGGG - Intronic
989373821 5:40738296-40738318 CTCAGCACTCCCGACTAGCTGGG - Intronic
990960954 5:61393154-61393176 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
991368622 5:65895076-65895098 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
991675579 5:69087199-69087221 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
991693491 5:69248502-69248524 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
991714309 5:69437263-69437285 CTCAGACTTCCCGAGTAGCTGGG - Intronic
991725935 5:69535998-69536020 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
992009768 5:72514661-72514683 CTCAGCCACCACTAGTAGCTGGG + Intergenic
993302752 5:86232316-86232338 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
993667820 5:90722596-90722618 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
994096633 5:95853305-95853327 CTCACACCTCCCTAGTAGCTGGG + Intronic
994857709 5:105145375-105145397 CTCAAGCCTCCCTAGTAGCTAGG - Intergenic
996079667 5:119243320-119243342 CTCAGGCAACCCTATTAGGTAGG + Intronic
996880333 5:128289470-128289492 CTCAGTCTCCCCAAGTAGCTGGG - Intronic
997819677 5:137053640-137053662 CTCAGTCATCCTTAATGGGTGGG + Intronic
998226004 5:140326772-140326794 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
998472525 5:142394224-142394246 CTCAGCCTTCCCAAATAGCTGGG + Intergenic
998509695 5:142701416-142701438 CTCAGCCTTCCCCAGTAGCTGGG + Intergenic
998531585 5:142890017-142890039 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
999696990 5:154196037-154196059 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1000724047 5:164746410-164746432 CTCAGGCCTCCCGAGTAGCTGGG + Intergenic
1000789669 5:165590192-165590214 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1001376119 5:171260182-171260204 CTCAGCCTCCCCGACTAGCTGGG - Intronic
1004675034 6:17833377-17833399 CTCAGTCCCCCCAAGTAGCTGGG - Intronic
1004692001 6:18000310-18000332 CTCAGCCCTCCCAAGTAGCTGGG - Intergenic
1004718899 6:18247786-18247808 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1005054605 6:21717713-21717735 CTCAGCCTCCCCTAGTAGCTGGG - Intergenic
1005448239 6:25947547-25947569 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
1005487768 6:26317481-26317503 CTCAGGCCTCCCGAGTAGCTGGG + Intergenic
1005976317 6:30802546-30802568 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1006476133 6:34255380-34255402 CTCAGTCTCCCCGAGTAGCTGGG - Intergenic
1007166765 6:39833896-39833918 CTCAGTCCTCACCACTACCTTGG + Intronic
1007412406 6:41672705-41672727 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1007448560 6:41925800-41925822 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1008514264 6:52304593-52304615 CTCAGCCCTCCCTAGTAGCTGGG - Intergenic
1008536644 6:52511218-52511240 CTCAGTCCTCCTGAGTAGCTGGG + Intronic
1008728622 6:54452721-54452743 CTCAGGCCTCCCAAGTAGCTAGG - Intergenic
1008803705 6:55402091-55402113 CTCAGCCTTCCCGAGTAGCTGGG + Exonic
1009541878 6:64970311-64970333 CTCATACATCCCGAGTAGCTGGG + Intronic
1009617700 6:66031889-66031911 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1010225036 6:73481067-73481089 CTCAGCCCTCCCTAGTAGCTGGG + Exonic
1010545340 6:77148511-77148533 CTCAGACATCCTCAGTAGCTGGG - Intergenic
1010947841 6:81999018-81999040 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1013201367 6:107899601-107899623 CTCAGCCCTCCCAAGTAGCTGGG - Intronic
1013498644 6:110724236-110724258 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1014537161 6:122628151-122628173 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1014674894 6:124351736-124351758 CTCAAGCCTCCCTAGTAGCTGGG + Intronic
1015016220 6:128416529-128416551 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1015047529 6:128794216-128794238 CTCAGCCCTCCCGAATAGCTGGG - Intergenic
1015535637 6:134264757-134264779 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1016410633 6:143779463-143779485 CTCAGTCGTCCCGAGTAGCTGGG + Intronic
1016885518 6:148956173-148956195 CTCAGTCATCCCTACCATATAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020333023 7:7039562-7039584 CTCAGCCATCCCGAGTAGCTGGG + Intergenic
1020776151 7:12456694-12456716 CTAAGTCAGCCCTACTTACTGGG - Intergenic
1021029682 7:15716209-15716231 CTCAGTCTCCCCTAGTAGCTGGG + Intergenic
1022597535 7:31726917-31726939 CTCAGGCCTCCCGAATAGCTGGG - Intergenic
1022718862 7:32924475-32924497 CTCAGTCTTCCCAAGTAGCTGGG - Intergenic
1022815907 7:33914076-33914098 CTCAGCCCTCCCGAGTAGCTGGG + Intronic
1023012084 7:35933284-35933306 CTCAGCCTTCCCTAGTAGCTGGG - Intergenic
1023034067 7:36115640-36115662 ATCAGCCATCCCTCCTAGCCTGG - Intergenic
1023850640 7:44148071-44148093 CTCAGTCCTCCCAACCACCTAGG - Intronic
1023973375 7:45008476-45008498 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1024079036 7:45840579-45840601 CTCAGCCTTCCCTAGTAGCTGGG + Intergenic
1025125741 7:56343367-56343389 CTCAGCCTTCCCTAGTAGCTGGG - Intergenic
1025929784 7:65984233-65984255 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1026129619 7:67609481-67609503 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1026957658 7:74387853-74387875 CTCAGTTGTCCCTACAAGCCAGG - Intronic
1027694191 7:81388328-81388350 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1028873677 7:95796424-95796446 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1029050999 7:97687313-97687335 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1029071476 7:97902602-97902624 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1029268525 7:99361386-99361408 CTCACTCCTCCCAAGTAGCTGGG - Intronic
1029910122 7:104137217-104137239 CTCAGTCTTCCCAAGTGGCTGGG + Intronic
1029987855 7:104937993-104938015 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1030416871 7:109255971-109255993 CTCAGTCTTTCCTACCACCTAGG + Intergenic
1031043882 7:116865691-116865713 CTCAGTCTCCCCAAGTAGCTGGG + Intronic
1031544534 7:123035173-123035195 CTCAATCCTCCCGAGTAGCTGGG - Intergenic
1032009314 7:128332468-128332490 CTCAGGCCTCCCGAGTAGCTGGG + Intronic
1032143830 7:129360230-129360252 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1032765194 7:134985039-134985061 CTCATGCATCCTGACTAGCTGGG - Intergenic
1032832091 7:135638296-135638318 CTCAGCCACCCCAAGTAGCTGGG - Intronic
1032887112 7:136152456-136152478 CTCAGTACTCCCAAGTAGCTAGG - Intergenic
1033063081 7:138126493-138126515 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1033140822 7:138824883-138824905 CTCAGCCACCCCGAGTAGCTGGG + Intronic
1033524850 7:142201184-142201206 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1034410065 7:150936083-150936105 CTCAGCCCTCCCGAGTAGCTGGG - Intergenic
1035697120 8:1606797-1606819 CTCAGTGACCCCAAGTAGCTGGG + Intronic
1036169499 8:6469079-6469101 CTCAAGCCTCCCTAGTAGCTTGG - Intronic
1036473150 8:9068931-9068953 CTCAGCCCTCCCTAGTAGCTGGG + Intronic
1036524051 8:9518799-9518821 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1036888036 8:12574634-12574656 CTCAGCCCTCCCTAGTAGCTGGG - Intergenic
1037341005 8:17844945-17844967 CTCATTCATCCATCCGAGCTGGG + Intergenic
1037869895 8:22483955-22483977 CTCAGCCACCCCAATTAGCTAGG + Intronic
1038209171 8:25499418-25499440 CTCAGGCTTCCCTAGTAGCTGGG + Intronic
1038291386 8:26252802-26252824 CTCAGCCACCCCAAGTAGCTGGG - Intergenic
1038518335 8:28206293-28206315 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1039017997 8:33174213-33174235 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1039307263 8:36276195-36276217 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1041779481 8:61561670-61561692 CTCAGGCCTCCCAAATAGCTGGG - Intronic
1043382227 8:79715238-79715260 CTCACTCTTTCTTACTAGCTAGG + Intergenic
1044301207 8:90585508-90585530 CTCAGCCTTCCATAGTAGCTGGG - Intergenic
1045138060 8:99245655-99245677 CTCAGTAATCCCAAGTAGCTGGG + Intronic
1045456552 8:102385665-102385687 CTCAGCCTTCCCTAGTAGCTGGG + Intronic
1045487921 8:102647283-102647305 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1045704588 8:104906934-104906956 CTCAGTCTTTCCTACTACATAGG + Intronic
1047111049 8:121789980-121790002 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1047478310 8:125256807-125256829 CTCAGCCTCCCCTAGTAGCTGGG - Intronic
1047853227 8:128881494-128881516 CTCAGTCTTCCCGAGTAGCTGGG - Intergenic
1049087946 8:140492713-140492735 CTCAGCCACCCCAACTAGCTGGG + Intergenic
1049114805 8:140676820-140676842 CTCAGGCCTCCCAAGTAGCTGGG - Intronic
1049878434 8:145043834-145043856 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
1050325548 9:4493667-4493689 CTCACTCATTCCTCCTACCTTGG - Intronic
1050692166 9:8240456-8240478 CTCAGGCCTCCCAAGTAGCTGGG - Intergenic
1051275835 9:15397219-15397241 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1051429820 9:16970312-16970334 CTCAGGCCTCCCGAGTAGCTTGG - Intergenic
1052754638 9:32527956-32527978 CTCAGCCATCCAGAGTAGCTGGG + Intergenic
1052777928 9:32752126-32752148 CTCAGTCTTCCCGAGTAGCTGGG - Intergenic
1052993230 9:34534772-34534794 CTCAGCCCTCCCAAGTAGCTGGG + Intergenic
1053202158 9:36160137-36160159 CTCAGCCTTCCCGATTAGCTGGG + Intronic
1053207860 9:36202945-36202967 CCCAGTAATCCCCAGTAGCTGGG + Intronic
1053232172 9:36419704-36419726 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1054796860 9:69310394-69310416 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1055412179 9:76042537-76042559 CTCAGCCCCCCCTAGTAGCTGGG - Intronic
1055610332 9:78016563-78016585 CTCAGCCCTCCCGAGTAGCTGGG - Intronic
1055946923 9:81700098-81700120 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1056178300 9:84057333-84057355 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1057072316 9:92109854-92109876 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1058390117 9:104486702-104486724 CTCAGCCCTCCCAAGTAGCTGGG + Intergenic
1058821903 9:108739957-108739979 CTCAGCCCTCCCTAGTAGCTGGG + Intergenic
1058855584 9:109058727-109058749 CTCAGTCTCCCCGAGTAGCTAGG + Intronic
1058948352 9:109879811-109879833 CTCAGCCTTCCCAAGTAGCTGGG + Intronic
1059702996 9:116794212-116794234 CTCAGCCTTCCCGAGTAGCTGGG + Intronic
1059878916 9:118668083-118668105 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1060067823 9:120519057-120519079 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1060162705 9:121380619-121380641 CTCAGTCCCCCCAAGTAGCTGGG - Intergenic
1062515284 9:136930844-136930866 CTCAAGCATCCCAAGTAGCTGGG + Intronic
1186201112 X:7156033-7156055 CTCAGTCCCCCCAAGTAGCTGGG - Intergenic
1186451098 X:9674374-9674396 CTCAGTCTCCCCAAGTAGCTGGG + Intronic
1186470763 X:9820479-9820501 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1186554895 X:10547454-10547476 CTCAGCCTTCCCGAGTAGCTAGG - Intronic
1186827138 X:13351711-13351733 AACAGTCTTCCCTAGTAGCTGGG + Intergenic
1187555817 X:20350123-20350145 CTCCCTCATCCCTACTTCCTGGG - Intergenic
1188829799 X:34882214-34882236 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1188921127 X:35979092-35979114 CTCAATCCTCCCGAGTAGCTGGG + Intronic
1189826342 X:44922157-44922179 CTCAGCCTCCCCTAGTAGCTGGG + Intronic
1190079206 X:47342183-47342205 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1190289990 X:48986123-48986145 CTCAGCCCTCCCAAATAGCTGGG - Intronic
1190851679 X:54250097-54250119 CTCAGTCATCCCCAGTTGGTCGG - Exonic
1190874187 X:54448300-54448322 CTCAGCCCTCCCAAGTAGCTGGG + Intronic
1194260447 X:91687869-91687891 CTCAGGCCTCCCAAGTAGCTGGG + Intergenic
1194525572 X:94973112-94973134 CTCAGCCCTCCCTAGTAGTTGGG + Intergenic
1194988633 X:100520412-100520434 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1195008955 X:100716331-100716353 CTCAGCCTTCCCGAGTAGCTGGG - Intronic
1195047355 X:101066368-101066390 CTCAGGCCTCCCGAGTAGCTGGG + Intergenic
1195047588 X:101067970-101067992 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic
1195805547 X:108761494-108761516 CTCAGCCCTCCCAATTAGCTGGG + Intergenic
1197270227 X:124417324-124417346 CTCAGGCCTCCCAAGTAGCTCGG + Intronic
1198023367 X:132680881-132680903 CTCAGCCTTCCCAAGTAGCTGGG - Intronic
1198110558 X:133499195-133499217 CTCAGTCCTCCCAAGTAGCTGGG + Intergenic
1198244294 X:134814580-134814602 CTCAGCCTCCCCTAGTAGCTGGG - Intronic
1198284521 X:135176662-135176684 CTCAGCCACCCCGAGTAGCTGGG + Intergenic
1198286921 X:135200133-135200155 CTCAGCCTTCCCGAGTAGCTGGG + Intergenic
1198557054 X:137806479-137806501 CTCAGCCTTCCCAAGTAGCTGGG + Intergenic
1198853390 X:140990068-140990090 CTCAGGCCTCCCGAGTAGCTGGG + Intergenic
1200226897 X:154422707-154422729 CTCAGCCTTCCCAAGTAGCTGGG - Intergenic
1201319770 Y:12685270-12685292 CTCAGCCTTCCCGAGTAGCTGGG - Intergenic