ID: 947779642

View in Genome Browser
Species Human (GRCh38)
Location 2:232746635-232746657
Sequence CCCCAAGTTCTGTTCTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947779637_947779642 23 Left 947779637 2:232746589-232746611 CCCATAAAAATATATTATTTTAA 0: 2
1: 1
2: 37
3: 308
4: 2528
Right 947779642 2:232746635-232746657 CCCCAAGTTCTGTTCTTTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 157
947779638_947779642 22 Left 947779638 2:232746590-232746612 CCATAAAAATATATTATTTTAAA 0: 1
1: 3
2: 43
3: 394
4: 3036
Right 947779642 2:232746635-232746657 CCCCAAGTTCTGTTCTTTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 157
947779636_947779642 24 Left 947779636 2:232746588-232746610 CCCCATAAAAATATATTATTTTA 0: 1
1: 1
2: 16
3: 230
4: 1824
Right 947779642 2:232746635-232746657 CCCCAAGTTCTGTTCTTTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947779642 Original CRISPR CCCCAAGTTCTGTTCTTTAG AGG Intronic
901350114 1:8587901-8587923 CCCCAAGCTCTGTTCTCTGCAGG + Intronic
902267552 1:15278762-15278784 CTCCAAGTTCTGTTTTAAAGAGG - Intronic
902306143 1:15540914-15540936 CCCCAGGTTCTGAACATTAGAGG - Intronic
902704931 1:18198236-18198258 CCCCAAGTTCTGATCTCCAGTGG - Intronic
903378353 1:22880342-22880364 CCCCAAGTCCTGCTCTGCAGGGG - Intronic
906013498 1:42552062-42552084 AGCCAAATTCTGTTCTTTTGGGG + Intronic
906999267 1:50833493-50833515 CTCCAAATCCTGTTGTTTAGGGG + Intronic
907655204 1:56335112-56335134 GCCCAAATTTTGTCCTTTAGTGG + Intergenic
908087411 1:60650965-60650987 CCCCAGGTTCCTTTATTTAGGGG + Intergenic
908406448 1:63818678-63818700 CCCCTAGGTCTGTTGTTTAAAGG + Intronic
909345863 1:74586069-74586091 CCTCAAATTTTGTTCTTTTGTGG + Intronic
914868603 1:151454608-151454630 CAACAAGTTCTCTTCTTTAAAGG + Intronic
917170870 1:172172561-172172583 CCCCAAGTTTTACTCTTTTGTGG - Intronic
917332643 1:173898096-173898118 CCCCAACTTCTTTTTTTTTGGGG + Exonic
919804051 1:201370221-201370243 CCCCACTCTCTGCTCTTTAGGGG - Intronic
920432057 1:205925091-205925113 CCCCAAATTTTGTTCTTTAATGG + Intronic
920792634 1:209107330-209107352 CCCCAGGTTCTGTTCCTGGGTGG - Intergenic
922096371 1:222446296-222446318 CCCCAAGTTCTGACCTGCAGAGG + Intergenic
922689337 1:227675381-227675403 CACCAAGTTATGGTCTTTTGTGG + Intronic
922755461 1:228094183-228094205 TCCCAAGTGCTGTGCTTCAGTGG + Intronic
923016203 1:230128409-230128431 CCCGAAGCTCTGTTCTGTGGAGG + Intronic
923979150 1:239301498-239301520 TCCCAAGTTCTGTGCTTGTGAGG - Intergenic
1062846434 10:710672-710694 CTAGAAGTTCTGTTCTTAAGTGG + Intergenic
1063596122 10:7437277-7437299 CCCCAAGTTTTGGTCTGTGGTGG - Intergenic
1063606529 10:7527344-7527366 CCCCACTTTCTGCTATTTAGGGG + Intergenic
1067658814 10:48218242-48218264 CTCCAAGTACTGTTAATTAGGGG + Intronic
1069421446 10:68250103-68250125 CCCCAAGTTCTGTTTCTGATGGG + Intergenic
1070320963 10:75354209-75354231 CCCCATGTTCTCTTGTCTAGTGG - Intergenic
1072159615 10:92753986-92754008 CCCTGACTTCTGTTCTTCAGAGG + Intergenic
1074653504 10:115554791-115554813 CCCAAAGTTTTTTTGTTTAGGGG - Intronic
1076197542 10:128530509-128530531 CCCCATCTGCTGTTCATTAGTGG + Intergenic
1076929108 10:133516708-133516730 CCCCAAGTGCTGATATTTAACGG - Intergenic
1079524912 11:21374534-21374556 GGCCACGTTCTGTTCCTTAGAGG + Intronic
1080397118 11:31900394-31900416 CCCCATGTTCTGCTCTGAAGAGG - Intronic
1082210855 11:49499112-49499134 CCCCAAGCACTACTCTTTAGAGG - Intergenic
1083146985 11:60767393-60767415 ACTCAGATTCTGTTCTTTAGAGG - Intronic
1083286341 11:61661580-61661602 CCCCAAAATCTGTTTTTTGGGGG - Intergenic
1084592490 11:70098647-70098669 CACCCAGGTCTGATCTTTAGGGG + Intronic
1086202961 11:84225656-84225678 CCCCAATGTATGTTCTTTAGAGG + Intronic
1088571069 11:111223304-111223326 TCCCATGTTGTGTTCTTTAAAGG + Intergenic
1088615948 11:111628380-111628402 CCCCATTTTCTCCTCTTTAGAGG + Intronic
1095200417 12:39378124-39378146 CCTCAAGTACAGTTCTGTAGTGG + Intronic
1099111830 12:78571764-78571786 CCTCAACTTCTGCTGTTTAGAGG + Intergenic
1104125520 12:125842177-125842199 CCCCAATTTCTGTTTTTAATAGG + Intergenic
1104581184 12:130011962-130011984 ACCCAATTTCTTTTCTTTAATGG - Intergenic
1104667941 12:130660682-130660704 CCCCAGGTTCGGCTCTTTGGTGG + Intronic
1108015203 13:46067553-46067575 CCCTAAGTTCAGTTCTTTTGAGG - Intronic
1108415241 13:50191937-50191959 TCCCAAGGTTTGTTCATTAGAGG + Intronic
1108535782 13:51375838-51375860 CCCCAAATTCTCTTCCCTAGAGG - Intronic
1110205067 13:72902326-72902348 ACACAAGTTAAGTTCTTTAGCGG - Intronic
1118476699 14:66124158-66124180 CCTCAAGTCCAGTTCTTGAGAGG - Intergenic
1118579475 14:67280028-67280050 CCCCAAATTCTGTTCTGTGGGGG + Intronic
1123440950 15:20290997-20291019 CCCCAAGTCTTGGTCTTTTGCGG - Intergenic
1123724769 15:23090961-23090983 CCTCAAGTTCTGGTCTTTTGTGG + Intergenic
1126825340 15:52542636-52542658 CACCAAGTTTAGCTCTTTAGAGG - Intergenic
1129289512 15:74553445-74553467 CCACAAGTTCTGATGTGTAGTGG + Intronic
1132123859 15:99202559-99202581 CCCCAAACACTTTTCTTTAGTGG - Intronic
1136645943 16:31615015-31615037 CCCCACCTTCTTTTTTTTAGAGG + Intergenic
1136725907 16:32357393-32357415 CCCCAAGTCTTGGTCTTTTGCGG + Intergenic
1136844239 16:33563444-33563466 CCCCAAGTCTTGGTCTTTTGCGG + Intergenic
1138057592 16:53851869-53851891 CCCCAAGTTCCATCCCTTAGAGG + Intronic
1140344362 16:74198124-74198146 CATCAAGTTCTGATCTTTACAGG - Intergenic
1140833841 16:78775408-78775430 CCCAAAGTGATGTTCTTTTGTGG + Intronic
1203000524 16_KI270728v1_random:160362-160384 CCCCAAGTCTTGGTCTTTTGCGG - Intergenic
1203132126 16_KI270728v1_random:1696766-1696788 CCCCAAGTCTTGGTCTTTTGCGG - Intergenic
1203154405 16_KI270728v1_random:1863743-1863765 CCCCAAGTCTTGGTCTTTTGCGG + Intergenic
1142479791 17:211946-211968 CTCCAAGTTCTGTGCATTTGGGG + Intergenic
1143518432 17:7431537-7431559 CCCAAACTTCTGATCTTCAGAGG + Intergenic
1148066339 17:44873246-44873268 CCCCAAGTTATGCTCCCTAGAGG + Intronic
1148175270 17:45558460-45558482 CCTGAAGTTCTGTGCTTTAGAGG - Intergenic
1148296101 17:46504534-46504556 CCTGAAGTTCTGTGCTTTAGAGG + Intergenic
1148833505 17:50452321-50452343 CCCCAACTTCTATTCTTAAAGGG - Intronic
1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG + Intronic
1150120924 17:62601677-62601699 CCCCAAGTGCTGTTCTAAACAGG + Intronic
1150406487 17:64905404-64905426 GCTGAAGTTCTGTGCTTTAGAGG - Intronic
1150662852 17:67100152-67100174 CCCCAATTTCTCTTTTTTAGAGG - Intronic
1150785356 17:68158415-68158437 CCTGAAGTTCTGTGCTTTAGAGG - Intergenic
1151432364 17:74072184-74072206 GACCAAGTTCTGTTATTTAAAGG - Intergenic
1155141205 18:23046347-23046369 CCCCAATTTCTGTGCTTTCTGGG - Intergenic
1155358072 18:24972985-24973007 GCCCCAGTTCTGCTCCTTAGGGG - Intergenic
1157940361 18:51921787-51921809 CCCCAAGTTCTTTGCATCAGTGG - Intergenic
1163263114 19:16203315-16203337 CCTCAAGTCCTGCTCTTTTGCGG + Intronic
1165363436 19:35350541-35350563 CCCCAAGCCCTGCTCTTGAGAGG + Intergenic
1165365589 19:35362989-35363011 CCCCAAGCCCTGCTCTTGAGAGG + Intergenic
1165989881 19:39804423-39804445 GCCCACTTTCTGCTCTTTAGAGG - Intergenic
1168583471 19:57574661-57574683 CCCCATTTTGTGATCTTTAGAGG - Intronic
1168648337 19:58076175-58076197 CCCCAAGTTCTGTTTATTTTAGG + Intronic
926348108 2:11968089-11968111 CTCCTAGTTCTTTTCTTTACGGG + Intergenic
927072051 2:19540987-19541009 CCCTAAGCTCTGTTCATTGGAGG - Intergenic
928212636 2:29334885-29334907 TCTCAAGTTCTGTTTTTTATGGG + Intronic
928328670 2:30340001-30340023 CCTCAAGTTCAGTTTTGTAGGGG + Intergenic
928790207 2:34940913-34940935 GCCCAAGTTCTGATCATTTGGGG + Intergenic
928910027 2:36410571-36410593 GCCCATGTTCTGTTATTAAGAGG + Intronic
931359344 2:61564948-61564970 CCCCAAGTTCTTTTTTTAATAGG + Intergenic
934319977 2:91963179-91963201 CCCCAAGTCTTGGTCTTTTGTGG - Intergenic
940408357 2:153331526-153331548 CCCCAAGTTCTTCACTTTTGGGG - Intergenic
941207168 2:162588450-162588472 ACCCAAGTTTTGTTTTTGAGGGG - Intronic
942494040 2:176520145-176520167 CCGCAACTTCTGTTTTTAAGTGG + Intergenic
944689512 2:202147038-202147060 CTCCAAGTTCTGTTTTATAATGG - Intronic
944945677 2:204682023-204682045 CCCCAAATTCTTTGCTTAAGTGG - Intronic
946672194 2:222116834-222116856 CACCAATTTTTGATCTTTAGTGG + Intergenic
947779642 2:232746635-232746657 CCCCAAGTTCTGTTCTTTAGAGG + Intronic
1170056588 20:12211641-12211663 CACCAAGCTCTGTTCTTTTCAGG - Intergenic
1170267885 20:14487767-14487789 CCCCAAGTCCTTTTCATTTGAGG + Intronic
1172675750 20:36670344-36670366 CCCCATATTCTGCTTTTTAGTGG - Intronic
1173621181 20:44437195-44437217 CCCCAAAGTCTGTCCTTTACAGG - Intergenic
1180171184 21:46059228-46059250 CCCCGAGCCCTATTCTTTAGTGG + Intergenic
1180308224 22:11147233-11147255 CCCCAAGTCTTGGTCTTTTGCGG - Intergenic
1180546700 22:16509046-16509068 CCCCAAGTCTTGGTCTTTTGCGG - Intergenic
1181426243 22:22842353-22842375 AGCCAAGTTTTGTTTTTTAGAGG + Intronic
1181481857 22:23204988-23205010 CCCCTATTTCTGTGCTATAGTGG + Intronic
1182086773 22:27566357-27566379 CCCCAAGCCTTGTTCTCTAGGGG + Intergenic
1182212479 22:28688312-28688334 CCCCAAGTCTTGGTCTTTTGCGG + Intronic
1182415907 22:30221350-30221372 TCACAAGTTCTCTTCTCTAGAGG - Intergenic
1183229207 22:36570423-36570445 CCCCAAGCTCTGGCCTTTCGTGG + Intronic
953776208 3:45819558-45819580 GTCCAGGTTCTGTTCTTTTGGGG - Intergenic
955710729 3:61776337-61776359 CCCCAAGTTCTCATTTTTATTGG + Intronic
955855395 3:63267355-63267377 CCTCAGGTTCTCTTCTTTTGAGG - Intronic
957402179 3:79730687-79730709 CCAAAAGTTCTGTTCTTTGAAGG + Intronic
959853729 3:111122402-111122424 CCCTCAGTTCTGATCTTTAGAGG + Intronic
960500706 3:118434575-118434597 CCCCAAATTCTTTTGTTTATAGG + Intergenic
962773760 3:138638988-138639010 CCTTAAGTACTGTTCTTTGGGGG - Intergenic
963115555 3:141726269-141726291 CCCCAAGTTCTCTTCTGCAGAGG - Intergenic
965375070 3:167912672-167912694 CCCCAAGTTGTGATATCTAGTGG + Intergenic
968360954 3:198146457-198146479 CCCCGAGTTCTGATGTTTGGGGG + Intergenic
974051226 4:56944065-56944087 CCCAAAGTTCTGTTTTTGAGGGG - Intergenic
975299936 4:72778079-72778101 CCCCAATTCCTGTTCTTTGTAGG + Intergenic
975946603 4:79713879-79713901 CCCTATGTTCTGTTCTGTAGAGG - Intergenic
981887191 4:149690516-149690538 CTACAAGTTAAGTTCTTTAGTGG - Intergenic
985374549 4:189321490-189321512 CCCAAAGCTATGTTCTTTATTGG + Intergenic
987758099 5:22123179-22123201 CTCCAAGTTCTCTTCTATAAGGG - Intronic
988615270 5:32769076-32769098 CCCCAATTCCTGTTCTATAGTGG - Intronic
990460886 5:56029843-56029865 CACCAAGGCCTGCTCTTTAGAGG - Intergenic
994605827 5:101964984-101965006 CTCCAAGTTCTCTTTTTTAAGGG - Intergenic
995439092 5:112170356-112170378 CCACAAGTTCTTTTCTGTAAAGG + Exonic
998143609 5:139713188-139713210 CTCCAAGTCTTGTCCTTTAGGGG + Intergenic
999074135 5:148779052-148779074 CCACAAGCTCTGCTCTTTATGGG - Intergenic
1000191135 5:158912000-158912022 CTCCAAGTTCATTTCTTTAGTGG + Intronic
1006239030 6:32661455-32661477 CACTCAGTTCTGCTCTTTAGGGG - Exonic
1007022836 6:38539357-38539379 CCCCAGGTTCATTTGTTTAGAGG - Intronic
1008552662 6:52647747-52647769 CCCAAAGTTCTGGGCTTTACAGG - Intergenic
1018246153 6:161826040-161826062 CCCCAAGCTCTGCTCTCTAGAGG + Intronic
1019259056 7:70197-70219 CCCCGAGTTCTGATGTTTGGGGG - Intergenic
1019921497 7:4166229-4166251 CCCCAAGATGTGTTCTGAAGCGG - Intronic
1021280561 7:18711750-18711772 GCACAAGTGCTGTTCTTTTGTGG - Intronic
1022421922 7:30231317-30231339 GTCAAAGTTCTGTTCTTCAGTGG - Intergenic
1023531582 7:41162262-41162284 GCCTAAGTTCTGTTATTTTGAGG + Intergenic
1024274280 7:47665259-47665281 GCTCAAGTTCTGTTCTTTGCTGG + Intergenic
1024299430 7:47875709-47875731 CCCCACATTTTGTTCCTTAGGGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1036754586 8:11463903-11463925 CCCCAAGTTGTCATCTATAGTGG - Intronic
1038523592 8:28254486-28254508 CTCCAAGTCCTCTTCTTTTGTGG + Intergenic
1042966149 8:74354911-74354933 CACTACATTCTGTTCTTTAGAGG - Intronic
1043150483 8:76708296-76708318 CCCCAAATTCTTTTATTTTGGGG - Intronic
1043981207 8:86641670-86641692 TCTCTATTTCTGTTCTTTAGTGG + Intronic
1044193632 8:89349076-89349098 CCTCCAGTTTTGTTCTTTTGAGG + Intergenic
1044376772 8:91483626-91483648 CCACAACTTCTGTTCTTCAGGGG + Intergenic
1047371341 8:124258373-124258395 CCAGAAGTTCTGTTCCTCAGTGG + Intergenic
1047680786 8:127252241-127252263 CCCCAGGTCCTGTTCTCAAGAGG - Intergenic
1047811468 8:128414472-128414494 CCCCATCTCCTGTGCTTTAGAGG + Intergenic
1052230740 9:26148624-26148646 CTCCAAGTGCTGTTCTTGATAGG - Intergenic
1052848956 9:33364289-33364311 CCCCAAGTTCAGTTCTTTAAGGG - Intronic
1055221310 9:73935603-73935625 CCCAAAGTTCTGGGCTTTACAGG + Intergenic
1056662971 9:88558271-88558293 CCCCAAACTCTGCTCTTTTGGGG - Intronic
1057457175 9:95225137-95225159 CCACATGTTCATTTCTTTAGGGG - Intronic
1058419453 9:104820356-104820378 CCCCAAGATGTGGTCTTTAATGG + Intronic
1061762978 9:132863215-132863237 CCCCATGTTCTGTACCTTAGAGG - Intronic
1062745662 9:138210288-138210310 CCCCGAGTTCTGATGTTTGGGGG + Intergenic
1186943130 X:14534441-14534463 CCCAAAGTTCTCTTCATTTGGGG + Intronic
1189297164 X:39927005-39927027 CCCCAAGCTCCCTTCTTTACAGG + Intergenic
1189510650 X:41658042-41658064 CCCCAAATCCTGTCCTTTTGGGG - Intronic
1190790458 X:53695186-53695208 TCCCAAATTCTGTTCTTGTGTGG - Intergenic
1193099657 X:77594281-77594303 CCCCAAGGTCTTTTCTCTCGTGG - Intronic
1193578457 X:83232455-83232477 ACCCAAGCCCTTTTCTTTAGCGG + Intergenic
1194243755 X:91483725-91483747 CCCAAAGTTATGTTCCTAAGAGG - Intergenic
1199096399 X:143745997-143746019 CCCCACATTTTTTTCTTTAGAGG + Intergenic
1200562735 Y:4725088-4725110 CCCAAAGTTATGTTCCTAAGAGG - Intergenic
1201187504 Y:11418283-11418305 CCCCAAGTCTTGGTCTTTTGCGG - Intergenic
1202034152 Y:20614453-20614475 CCACAAGTTCAGTTCCTTAAGGG - Intergenic