ID: 947781782

View in Genome Browser
Species Human (GRCh38)
Location 2:232772823-232772845
Sequence CACTACAGACTTGTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947781775_947781782 11 Left 947781775 2:232772789-232772811 CCACTTCCTGCCTTTTAATGGGG 0: 1
1: 0
2: 3
3: 86
4: 775
Right 947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 138
947781771_947781782 30 Left 947781771 2:232772770-232772792 CCTTGAGAGTGCTGCATACCCAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 138
947781778_947781782 1 Left 947781778 2:232772799-232772821 CCTTTTAATGGGGCTTGAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 128
Right 947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 138
947781777_947781782 5 Left 947781777 2:232772795-232772817 CCTGCCTTTTAATGGGGCTTGAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 138
947781773_947781782 12 Left 947781773 2:232772788-232772810 CCCACTTCCTGCCTTTTAATGGG 0: 1
1: 0
2: 1
3: 21
4: 248
Right 947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947781782 Original CRISPR CACTACAGACTTGTGGAGCT AGG Intronic
902299599 1:15492611-15492633 CACTACTGACATGTGGGGCCAGG - Exonic
902703451 1:18188900-18188922 CACTCCTGACTTGCGGTGCTAGG + Intronic
903212694 1:21827708-21827730 GACCACAGCCATGTGGAGCTAGG - Intronic
905856202 1:41316361-41316383 CACTACAGCCTTGCAGAGATGGG - Intergenic
908654335 1:66372016-66372038 AACTAGTGACTGGTGGAGCTGGG - Intronic
912925988 1:113913261-113913283 GGGCACAGACTTGTGGAGCTGGG + Exonic
914402812 1:147339347-147339369 CATTCCAGACTTGTGCAGCTGGG + Intergenic
916097247 1:161362360-161362382 CACTCCAGACTGGTATAGCTGGG - Exonic
916618859 1:166473628-166473650 CCCTAGAGATTTGTGGAACTTGG - Intergenic
917458442 1:175205848-175205870 CACTCCACACATCTGGAGCTAGG - Intergenic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
922321923 1:224496085-224496107 GACAACAGACTCGTGCAGCTGGG - Intronic
1062997364 10:1879804-1879826 CACTGCAGCCTTGAGTAGCTGGG + Intergenic
1063602866 10:7497788-7497810 GACCACAGACTTGTGGTCCTCGG + Intergenic
1063858160 10:10278310-10278332 CACTACAGCCTGGGTGAGCTGGG + Intergenic
1065644450 10:27819689-27819711 CACTGCAGCCTTGAAGAGCTGGG - Intronic
1071228068 10:83554652-83554674 GAGTACAGACTGGTGGAGGTGGG - Intergenic
1072090120 10:92119091-92119113 CACTCCAGACTGGTATAGCTGGG - Intronic
1072545079 10:96431155-96431177 CACTACAGACTTTTGTTCCTTGG - Intronic
1074313978 10:112345592-112345614 CACCACAGACTTCTGAAGATGGG - Intergenic
1074507452 10:114084319-114084341 AACTTCAGACTTCTGGAGCAAGG + Intergenic
1075670623 10:124261792-124261814 AACTCCAGACTTCTGGGGCTTGG - Intergenic
1075678652 10:124316422-124316444 CTCTACATCCTTGTGGATCTTGG - Intergenic
1075833061 10:125427800-125427822 CACTACTGGCTTTTGGGGCTGGG - Intergenic
1079741247 11:24064134-24064156 CAATTCAGTCTTGTAGAGCTGGG - Intergenic
1080469438 11:32530691-32530713 CGCTCCAGAGGTGTGGAGCTAGG - Intergenic
1082832013 11:57625509-57625531 CTCTGGAGACTGGTGGAGCTAGG + Intergenic
1083492521 11:63023428-63023450 CACTGCATCCTTGTGCAGCTGGG - Intergenic
1083755718 11:64790574-64790596 CACAACAGCCCTGTGGGGCTGGG + Intronic
1084769844 11:71335458-71335480 CTCTACAGAGGTGTGGATCTAGG + Intergenic
1085574570 11:77590394-77590416 CACAAGCGCCTTGTGGAGCTTGG + Exonic
1090051681 11:123385596-123385618 CTCTCCAGGCTTGTGGGGCTGGG - Intergenic
1092229393 12:6768233-6768255 CCATACAGACTTTTGGTGCTGGG + Intronic
1096005700 12:48169269-48169291 CACCACTGACTTGAGGACCTTGG + Intronic
1096377458 12:51125021-51125043 CACCACTGACTTGAGGATCTCGG + Intronic
1098701705 12:73636755-73636777 TACTACAGACTAATGGAGTTTGG - Intergenic
1099588094 12:84546706-84546728 CACTACAGACTCCTGCATCTTGG - Intergenic
1100929198 12:99586259-99586281 CCCTAGAGATCTGTGGAGCTTGG - Intronic
1101753124 12:107599669-107599691 CACGACAGCCTTGTGAGGCTGGG + Intronic
1103053936 12:117803795-117803817 CACTACAAACTTGAGAGGCTGGG + Intronic
1105758783 13:23494218-23494240 CACTACAGATGTGTGGATGTTGG + Intergenic
1106346313 13:28882439-28882461 TAAAACAGACTTTTGGAGCTTGG + Intronic
1107525170 13:41223516-41223538 TACTACAGGTTTGTAGAGCTCGG + Intronic
1108675439 13:52733816-52733838 CACTGCAGACGTGTTCAGCTGGG - Intronic
1118803846 14:69217126-69217148 CACTACAGCCTTGAGGTCCTAGG + Intronic
1119136286 14:72223858-72223880 CACTCCAGACCTCTGGGGCTAGG + Intronic
1119422935 14:74518322-74518344 CACGCCAGGCTTGAGGAGCTGGG - Intronic
1119777743 14:77259014-77259036 CACTACAGGATGGTGGAGCAGGG + Exonic
1121827242 14:97020499-97020521 CACTCCTCACATGTGGAGCTGGG + Intergenic
1132310220 15:100852207-100852229 CACTACAGACGTGTAGAACCGGG - Intergenic
1134878504 16:17723952-17723974 CACAACTGACTTTTGGGGCTAGG + Intergenic
1136580497 16:31148538-31148560 AACTACAGCCAAGTGGAGCTGGG - Exonic
1137515658 16:49141231-49141253 GACTACTGACTAATGGAGCTGGG - Intergenic
1137561433 16:49504861-49504883 CTCAAGAGACTTGTGGAACTGGG + Intronic
1137966058 16:52935187-52935209 CACCACGGACTTGAGGATCTTGG - Intergenic
1141233434 16:82193047-82193069 TACTAGAGACGTGTAGAGCTAGG - Intergenic
1142731074 17:1858090-1858112 CACTCCAGACTGGTATAGCTGGG + Intronic
1143035960 17:3998542-3998564 CACCACAGACTTGATGTGCTGGG + Intergenic
1143518449 17:7431718-7431740 TACTACAGACTCCTGGATCTTGG - Intergenic
1146607946 17:34277878-34277900 CACTCCAGACTTGTTTACCTGGG - Intergenic
1147576431 17:41602495-41602517 CAGTAAAGACTTGTGGAGTCAGG - Intergenic
1150716272 17:67575110-67575132 GAGTACAGAGTTGTGGAGCGTGG - Intronic
1150722151 17:67622432-67622454 CACCACTGAATTGTGTAGCTGGG + Intronic
1154220328 18:12447360-12447382 CACTAAGAGCTTGTGGAGCTTGG - Exonic
1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG + Intergenic
1161732978 19:5973525-5973547 CACTACAGACATCTGGGGCCAGG - Intronic
1162658457 19:12150707-12150729 CATTCCAGACTTGTGAAGCAGGG - Intronic
1163755259 19:19102881-19102903 CACTTCAGACTTCTGGCCCTAGG - Intronic
927544958 2:23944281-23944303 CACTCCAGACTGGTATAGCTGGG - Intronic
928037412 2:27837810-27837832 CACTACAGAGTACTGGAGCAGGG + Intronic
931470113 2:62531355-62531377 CCCTACAGGCTTGTGCAGCGGGG - Intergenic
935266129 2:101395910-101395932 CACTTGGGACTTGTGGATCTGGG - Intergenic
939155956 2:138524654-138524676 CCCTAGAGATTTGTGGAACTTGG - Intronic
940292387 2:152089976-152089998 CTCTACAGACATGTGGAGAGTGG - Intronic
940611265 2:155994767-155994789 CAATATAGAATTGTGGAGCAGGG - Intergenic
942381231 2:175393370-175393392 CACTACAAAGTTGTTGACCTGGG + Intergenic
947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG + Intronic
947841870 2:233212911-233212933 CACTACTGACATGTGGGGCTGGG + Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1171116506 20:22529489-22529511 GACCACAGACTTGTGGGGGTGGG + Intergenic
1173444387 20:43104740-43104762 CTCTACTGAATTATGGAGCTGGG - Intronic
1175019148 20:55825989-55826011 CACTATTGACTTTTGGAGCTGGG - Intergenic
1177876665 21:26641380-26641402 CACCAAAGACTTGTGGAGCTGGG - Intergenic
1182341254 22:29623024-29623046 CACTACAGACTTGACCTGCTGGG + Intronic
1182935301 22:34216485-34216507 AACTAGAGAGTTGTGGAGCCAGG - Intergenic
951484635 3:23198428-23198450 GACTATAGAATTGTGGAGATGGG - Intergenic
953046581 3:39298403-39298425 CACTGCAGGCATATGGAGCTGGG - Intergenic
957821073 3:85374282-85374304 CCCTAGAGACCTGTGGAACTTGG - Intronic
960349119 3:116572427-116572449 GTCTACAGACTTGAGGAGCAAGG - Intronic
960840089 3:121948891-121948913 CACTACAGCCTTGAGCTGCTGGG - Intergenic
962273041 3:133992183-133992205 CACTACAGAATTATGCAGTTTGG - Intronic
964547387 3:157849253-157849275 CACTTCAGACTTGTGAATGTTGG - Intergenic
968186386 3:196635797-196635819 CACTACAAACTTTTGGAGGCAGG - Intergenic
971884347 4:32423918-32423940 CACTACAGACCTGAGTAGCAGGG + Intergenic
972083379 4:35182398-35182420 AAGTACAGACTTGGGGTGCTGGG - Intergenic
981073116 4:140565928-140565950 CACTACAGTCTTATGGGGCTGGG - Intronic
981612444 4:146609251-146609273 CCCTACAGATTTGTGGAGGAAGG - Intergenic
981626591 4:146763444-146763466 CACTACATTCTGGTAGAGCTGGG - Intronic
983001156 4:162416255-162416277 CACTAGAAACTTGTTGAGCCAGG + Intergenic
986129885 5:4919671-4919693 AACTACAGACTTCGGGAGCATGG + Intergenic
993464077 5:88223266-88223288 CACTTCAGAATTGTGCAGATGGG + Intronic
993530336 5:89016848-89016870 CACCACAGTCTCGTGGAACTGGG - Intergenic
994537862 5:101054544-101054566 CAGTACTGTCTTGTGGTGCTGGG + Intergenic
995347052 5:111133259-111133281 AACTCCAGAGTTGTGGGGCTAGG + Intergenic
996445735 5:123548161-123548183 AACTTGAGACTTGTGGTGCTTGG + Intronic
998480086 5:142455637-142455659 CATCACAGCCTTCTGGAGCTTGG - Intergenic
998753726 5:145352803-145352825 CACTAGAGATCTGTGGAACTAGG - Intergenic
999131464 5:149286745-149286767 CACAACAGGCCTGTGGAGGTAGG + Intronic
1000063655 5:157677258-157677280 CACTACTGACATTTTGAGCTAGG - Intronic
1001145952 5:169184919-169184941 CATTACAGAATTTTTGAGCTAGG - Intronic
1001376314 5:171262301-171262323 AAATACAGACTTGTTGAGCCTGG - Intronic
1001939000 5:175728038-175728060 CTCTTAAGATTTGTGGAGCTTGG - Intergenic
1002461933 5:179378228-179378250 CACTACTGAGCTATGGAGCTGGG - Intergenic
1002678876 5:180944148-180944170 TACCAGAGACTGGTGGAGCTGGG + Intronic
1003353569 6:5343796-5343818 CACTACAGACTTGGGCAGAGAGG - Intronic
1008152709 6:47974483-47974505 CAATACTGACATTTGGAGCTGGG + Intronic
1015070891 6:129091551-129091573 CAGTACACACTTGTGGGGGTAGG + Intronic
1017673287 6:156788134-156788156 CAGCACAGATTTTTGGAGCTGGG - Intronic
1019511804 7:1421480-1421502 CACTGAAGACTTGGGGAGGTCGG + Intergenic
1019602506 7:1892193-1892215 CACTGCACACTTTTGCAGCTTGG + Intronic
1020359893 7:7316565-7316587 AACTAAATACTTGTGGAGCTAGG + Intergenic
1022956840 7:35389037-35389059 CACCACAGAAAGGTGGAGCTGGG + Intergenic
1023297972 7:38736413-38736435 CACTTCAGCTTTCTGGAGCTTGG - Intronic
1028934550 7:96450659-96450681 CACTCTAGACATTTGGAGCTTGG - Intergenic
1029312243 7:99678150-99678172 CACTACAGACTCGGGCAGCCAGG - Intronic
1029314397 7:99698239-99698261 CACTACAGACTCGGGCAGCCAGG - Intronic
1029320034 7:99750735-99750757 CACTACAGACTCGGGCAGCTGGG - Intergenic
1029323091 7:99782492-99782514 CACTACAGACTCAGGCAGCTGGG - Intronic
1031167044 7:118241425-118241447 CACTATAGATTTGTGGGGATGGG - Intronic
1032304881 7:130723195-130723217 CAATGCAGACTTCTGGACCTTGG - Intergenic
1034763653 7:153696787-153696809 CCCTACAGATTTGAGCAGCTGGG + Intergenic
1040433569 8:47367440-47367462 GACTTCTGACTTCTGGAGCTGGG + Intronic
1041256502 8:55983569-55983591 CACTGCTGACTTGTGCTGCTGGG - Intronic
1041497442 8:58502657-58502679 CCCTAGAGATTTGTGGAACTTGG + Intergenic
1047268993 8:123336968-123336990 CACTGCAACCTTGTGGAGATAGG - Intronic
1051716736 9:19992756-19992778 AACCACATACTTGTGCAGCTGGG - Intergenic
1052245197 9:26325833-26325855 CAATAAAGACTTGAGAAGCTGGG + Intergenic
1055005899 9:71505915-71505937 CACTAAATACTTTTGGAGATAGG - Intergenic
1055196140 9:73596504-73596526 CTCTGCAGACTTGAGGAGCTTGG + Intergenic
1060926721 9:127460510-127460532 GACTACAGACTTGGGGATCTGGG - Intronic
1061615302 9:131775131-131775153 CACTGCAGACTTAGGGAGCCAGG + Intergenic
1062618543 9:137408875-137408897 CCCTGCAGACTTGTGGAGAGGGG - Intronic
1186201855 X:7163122-7163144 CACTGCAGACATTTGGGGCTGGG + Intergenic
1189439786 X:41024981-41025003 CACTACACACTGCAGGAGCTGGG - Intergenic
1190053451 X:47168977-47168999 CACTTCAGAGATGTGGAGCAGGG + Intronic
1193337267 X:80305965-80305987 CACCACAGGGTTATGGAGCTTGG - Intergenic
1195418602 X:104647608-104647630 CACCACCGACTTGAGGATCTTGG + Intronic
1197311652 X:124912553-124912575 CACTTCAGAGATGGGGAGCTGGG + Intronic