ID: 947783171

View in Genome Browser
Species Human (GRCh38)
Location 2:232789100-232789122
Sequence CCCTACATCTAAACTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947783171 Original CRISPR CCCTACATCTAAACTAAAGT TGG (reversed) Intronic
904644421 1:31955182-31955204 CCCTTTATCTAAGCTGAAGTGGG + Intergenic
906698545 1:47841211-47841233 CCCTACAGCAAAACCAAAATGGG - Intronic
911350440 1:96746942-96746964 CCCTGAATCTAAAGTAAAGTAGG - Intronic
912443514 1:109716189-109716211 CCCCAAATCTGTACTAAAGTAGG - Intronic
916047692 1:161013085-161013107 CCCATCCTCTAAACTCAAGTAGG + Intronic
918867900 1:189926660-189926682 CCCTGAACCTAAAATAAAGTGGG + Intergenic
923419965 1:233803278-233803300 CACTTCATCTAAATTAAAATTGG - Intergenic
1066517234 10:36176604-36176626 ACCTACATTAAAAATAAAGTAGG + Intergenic
1069285992 10:66716130-66716152 CCCTACATATAGACAAATGTAGG + Intronic
1069622311 10:69845529-69845551 CCCTGCAGCTACACCAAAGTAGG + Intronic
1073793682 10:106964784-106964806 CCCTATATCTAAAAAAAATTAGG - Intronic
1088496600 11:110437649-110437671 CCCTGAATCTAAATAAAAGTTGG - Intronic
1090888216 11:130898107-130898129 CCCTCCTTCTAAGCCAAAGTTGG - Intronic
1093194052 12:16109374-16109396 ACCTACACCCAAACTAAGGTTGG + Intergenic
1095444454 12:42270259-42270281 CCCTAAATCAAACATAAAGTTGG + Intronic
1101847982 12:108378729-108378751 CCCTAAATCTAAAATAAAAGTGG + Intergenic
1106748794 13:32734913-32734935 CCCTACCTCTAAACTGAATTGGG + Intronic
1109415699 13:62036694-62036716 CCCTACAACAAAACTGAACTTGG - Intergenic
1109858457 13:68165309-68165331 GTATACATCTAAATTAAAGTTGG + Intergenic
1111673701 13:91360532-91360554 CTCTACCTCTAAACAAAATTTGG - Intergenic
1114200683 14:20517214-20517236 CCCTAAATCCAAACTTAACTGGG - Intergenic
1118821248 14:69347518-69347540 ACCCACATCGAAACTAAAGCAGG + Intronic
1120896089 14:89533823-89533845 CCCCACATCTCAACTTAAGTGGG - Intronic
1125857593 15:42965335-42965357 CTCTAAATCTAGACCAAAGTAGG - Intronic
1129317469 15:74753868-74753890 CCCTACCTATACACTAAAGTGGG - Intronic
1130814526 15:87417293-87417315 CTCTAGATCTGAACTAGAGTGGG + Intergenic
1133548495 16:6831070-6831092 ACCTCCATCTAAAGTAAAGCTGG + Intronic
1133764290 16:8825658-8825680 CCCTACAGTCAAACTAAAATCGG - Intronic
1136469962 16:30473555-30473577 CCCTTCATCTAAACAAATGAAGG + Intronic
1138662057 16:58526863-58526885 GACTACATCTAAACTATAGCTGG + Intronic
1140587650 16:76312465-76312487 CTCTACATATAAATTAAATTTGG - Intronic
1150565570 17:66336495-66336517 CTCAAGATGTAAACTAAAGTTGG + Intronic
1157733381 18:50024233-50024255 CCATACATTTAAACTAAATGTGG + Intronic
1162348205 19:10133687-10133709 CCCTTCAGCTAAAATAAAGGAGG - Exonic
1166110627 19:40620818-40620840 CCCTGAATCTAAAGTAAAGATGG - Intronic
925133514 2:1511032-1511054 ATCTACATCTAAACTTATGTAGG - Intronic
926448682 2:12975432-12975454 TCATACATTTAAACTACAGTTGG - Intergenic
933517828 2:83328598-83328620 CTCTTCATCTATACTGAAGTAGG - Intergenic
937615349 2:123915440-123915462 TCCTACACCTAAACCAAAGATGG - Intergenic
940122674 2:150284469-150284491 CCCCACATATAGACTGAAGTAGG + Intergenic
941886093 2:170529195-170529217 CCCGACCTCTAACCTCAAGTAGG - Intronic
943287552 2:186022733-186022755 ACCTTTAGCTAAACTAAAGTGGG - Intergenic
944799295 2:203221887-203221909 GCCTAGATTTAAACTAAAGAAGG - Intronic
946969102 2:225072242-225072264 CCCTACATCTAATACACAGTTGG - Intergenic
947646897 2:231748905-231748927 CCATACATCTAAACTCCAGGCGG - Intronic
947783171 2:232789100-232789122 CCCTACATCTAAACTAAAGTTGG - Intronic
1171284951 20:23929325-23929347 CACTTCATCGAAACTAAAGGTGG + Intergenic
1173436546 20:43037520-43037542 CCCTACTACCAAGCTAAAGTGGG + Intronic
1174160957 20:48550047-48550069 CCCATGATCTAAAGTAAAGTAGG + Intergenic
1174595769 20:51682229-51682251 CCCCAAACCTAAAATAAAGTTGG + Intronic
1182290636 22:29276550-29276572 CCCTAAATCTTAACTAAAATGGG + Intronic
1184849910 22:47114187-47114209 CCCTTCATCTCAAGTTAAGTAGG - Intronic
955927164 3:64018433-64018455 CCCTTCTTCTAAACAAAACTGGG + Intronic
957417163 3:79919931-79919953 GCCTACCTCTTAAATAAAGTAGG + Intergenic
959875864 3:111381049-111381071 CCCTACAGCTAAAAGAGAGTGGG + Intronic
963781887 3:149494642-149494664 CCCTAAATCAAAACCAAAATGGG + Intronic
963965996 3:151371078-151371100 CCTAACATCTAAACTAAATGAGG + Intronic
971376135 4:26057196-26057218 CCCTATCTCTAAATGAAAGTGGG - Intergenic
971790056 4:31158140-31158162 TCTTCCATCTAAACTTAAGTAGG + Intergenic
974400998 4:61406315-61406337 CCCTACCTGTAAAAAAAAGTTGG + Intronic
974878617 4:67726977-67726999 CACTATATCTGAACAAAAGTGGG - Intergenic
976539395 4:86255746-86255768 CCCTAAACATAAACTAAAATTGG + Intronic
979729490 4:124007059-124007081 TCATACATCTGAACTAAAGAAGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
982828879 4:160034991-160035013 CCCTACATTTAAATTATAGGAGG - Intergenic
982982671 4:162160364-162160386 TTCTACAGCTAACCTAAAGTAGG + Intronic
983548224 4:168986046-168986068 CCCTAAATCTAAAATAAAGTTGG + Intronic
984569416 4:181373722-181373744 CCCTTCAGCTAAAATACAGTGGG - Intergenic
987993371 5:25244255-25244277 GCCTACATATAATCTAAAGCAGG - Intergenic
994961622 5:106612005-106612027 CCCTAGATGTAAAATAAACTTGG - Intergenic
996000637 5:118358837-118358859 CCTTACACCAAAACTACAGTTGG + Intergenic
997463646 5:134072189-134072211 CCCAACATCTAATATATAGTAGG - Intergenic
997711418 5:136007979-136008001 CCCTACATTTAAACTCTTGTGGG - Intergenic
999962747 5:156774970-156774992 CCACACATCTAAACTAAGTTTGG + Intergenic
1006231126 6:32587690-32587712 CCTAACATATGAACTAAAGTAGG + Intronic
1007888723 6:45263619-45263641 CCCTGAATCTAAAATAAAATTGG + Intronic
1012057613 6:94433555-94433577 CCTTACATATAAAATAAATTGGG - Intergenic
1013753064 6:113429276-113429298 CCTGACATCTACACTAAACTGGG + Intergenic
1015672481 6:135706110-135706132 CCCTAAATCTAAAATAAAAATGG - Intergenic
1016129928 6:140455211-140455233 CCCTACAGGTAAATTAAAATGGG - Intergenic
1021903587 7:25311755-25311777 ACCTCCATGTAAACTAAAATAGG + Intergenic
1025971460 7:66330086-66330108 CCCTGAATCTAAATAAAAGTTGG + Intronic
1026462423 7:70626520-70626542 CCCTAAATCTAAAATAAAAGTGG - Intronic
1027357647 7:77374582-77374604 CGCTACATGTAAAATAGAGTGGG + Intronic
1044496003 8:92883825-92883847 CCCTACATTTGTACTAAAATAGG + Exonic
1050943771 9:11492078-11492100 CAAGACATCTAAACTAAAGTAGG - Intergenic
1058559921 9:106216407-106216429 CACTCTATCTAAAATAAAGTAGG + Intergenic
1059788651 9:117615705-117615727 CCCTACCTCTTATCTAAACTGGG + Intergenic
1186989831 X:15055529-15055551 GCCTTCATCTAAAGTAGAGTTGG + Intergenic