ID: 947789835

View in Genome Browser
Species Human (GRCh38)
Location 2:232858850-232858872
Sequence TGATCCACATGTTAGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947789835 Original CRISPR TGATCCACATGTTAGCAGAA AGG (reversed) Intronic
907639541 1:56172751-56172773 TGATTAAAATGCTAGCAGAATGG - Intergenic
908675828 1:66602409-66602431 TGATCCACATGTGACCATGATGG + Intronic
913333412 1:117685937-117685959 TGATGCACATCTAAGCAGATTGG + Intergenic
914399259 1:147301038-147301060 TGTTCCAGATCTTAGCATAAAGG - Intergenic
916503109 1:165403907-165403929 TCACCCACAGGTTAGCAGCAAGG + Intronic
917301012 1:173574236-173574258 AGATCCACCTGTAAGGAGAATGG - Intronic
917690735 1:177465768-177465790 TTCTTCACATGATAGCAGAAAGG + Intergenic
919532293 1:198738222-198738244 TTATCCAGATCTTAGAAGAAAGG + Intronic
920421245 1:205835351-205835373 TCATCTACATGTTAACAGATAGG - Intronic
920602464 1:207342373-207342395 TGATCCAGTTCTTAGAAGAAAGG + Intronic
920742596 1:208595618-208595640 TAATCCACAGGTTGGCAGACAGG - Intergenic
921053271 1:211526210-211526232 TGATCCTCCTATTACCAGAAAGG - Intergenic
922044694 1:221933429-221933451 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
922127479 1:222742568-222742590 TGATGCACATCTTAGAAGACAGG - Intronic
922188554 1:223297205-223297227 CTCTCCACATGTTAGCAGACAGG - Intronic
923692058 1:236203985-236204007 TGTTCCACATCTTAGAGGAAAGG + Intronic
923741265 1:236657189-236657211 TGATGCTGATGTTAGCAGACTGG - Intergenic
924832324 1:247610169-247610191 TGATCCAGATCTTGGAAGAAAGG - Intergenic
1063311766 10:4959136-4959158 TGGTGTACATGTTAACAGAAAGG + Intronic
1069874305 10:71552293-71552315 TGATCCACATGAGAGCTGGAGGG + Intronic
1070957300 10:80472948-80472970 TGCTCCACAGGACAGCAGAACGG - Intronic
1072603623 10:96957126-96957148 TGATCCAAATACTAGTAGAAGGG + Exonic
1073294590 10:102431447-102431469 TTATCCACATTTTACCTGAAAGG + Intronic
1073531835 10:104239393-104239415 GGCTCCACTTGTTAGGAGAATGG - Intronic
1074679404 10:115888799-115888821 TGAGCCACATGCTAGGAAAATGG - Intronic
1074804428 10:117034102-117034124 TGTTCCAGATCTTAGAAGAAAGG - Intronic
1074812252 10:117116975-117116997 TGTTCCACATCTTAGAGGAAAGG - Intronic
1077315549 11:1917939-1917961 TGAACCACGTGTAACCAGAATGG + Intergenic
1077939005 11:6819440-6819462 TGTTCCACATCTTAGAGGAAAGG - Intergenic
1080989975 11:37520082-37520104 TGATCCAGATCTTAGATGAAAGG - Intergenic
1082244682 11:49907733-49907755 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1083002356 11:59305132-59305154 TGTTCCACATCTTAGAGGAAAGG + Intergenic
1085718621 11:78894406-78894428 AGATCAAAATGTTAGCAGTAAGG + Intronic
1085926605 11:81031378-81031400 TGTTCCACATCTTAGAAGAAAGG - Intergenic
1086481889 11:87249163-87249185 TGTTCCAGATCTTAGAAGAAAGG + Intronic
1086616512 11:88827681-88827703 TAATCCATATTTTAGCAGATAGG - Intronic
1086850937 11:91807193-91807215 TGTTCCAGATCTTAGGAGAAAGG + Intergenic
1086972218 11:93094905-93094927 AGATCCATATGTTAGTAGAGAGG - Intergenic
1086990828 11:93302611-93302633 TGTTCCAAATGTTAGAGGAAAGG - Intergenic
1087532488 11:99402141-99402163 TGTTCCAGATCTTAGAAGAAAGG + Intronic
1088137791 11:106578421-106578443 GGATCAAGATGTTAGCAGAGGGG + Intergenic
1088375623 11:109138127-109138149 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1089370940 11:117956654-117956676 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1090086577 11:123655141-123655163 TGATCCAAATGTCAGCGCAAGGG + Intronic
1092139661 12:6174362-6174384 TGATACAAGTGTTAGAAGAAAGG + Intergenic
1093213947 12:16340709-16340731 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1095284257 12:40389560-40389582 TTATCCACATGACAGCAGGAAGG + Intergenic
1097146641 12:56944305-56944327 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1097696755 12:62782168-62782190 TGAACCACTTATTAGCAAAAAGG + Intronic
1101241242 12:102842029-102842051 TGAGCCACTTCTCAGCAGAATGG + Intronic
1106842835 13:33704052-33704074 TGTTCCACTCATTAGCAGAAAGG + Intergenic
1107071192 13:36271512-36271534 TTATCTACTTGTTAGCTGAAGGG - Intronic
1107224279 13:38028322-38028344 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1110244310 13:73304643-73304665 TCATACACACGTTATCAGAAGGG + Intergenic
1110326564 13:74223076-74223098 GGATCCAGATGTTTACAGAAGGG - Intergenic
1110388838 13:74947658-74947680 TGTTCCAGATGCTAGAAGAAAGG - Intergenic
1110472999 13:75881539-75881561 TGAACCACAGGGTAGCAGATGGG + Intronic
1111364870 13:87229758-87229780 TGTTCCAGATATTAGGAGAAAGG + Intergenic
1112648420 13:101362658-101362680 TGTTCCAGATCTTAGCAGAAAGG - Intronic
1114725839 14:24936251-24936273 TGATCCATATGTGAGGAGGAGGG - Intronic
1114762722 14:25334423-25334445 TGATCCAGTTCTTAGGAGAAAGG - Intergenic
1116242320 14:42360866-42360888 AGAACTAAATGTTAGCAGAATGG - Intergenic
1117583305 14:57174636-57174658 TGCTCTACAAGTTAGCAGTATGG - Intergenic
1118509497 14:66455663-66455685 TGTTCCACATCTTAGAGGAAAGG - Intergenic
1118511705 14:66482264-66482286 TCATCCACTTGTTAAAAGAATGG - Intergenic
1119256501 14:73202235-73202257 TGAGCCACAGGTTGGGAGAAGGG + Intronic
1122194883 14:100077478-100077500 GGCTCCACATTTTAGAAGAAAGG + Intronic
1202841894 14_GL000009v2_random:128929-128951 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1202911287 14_GL000194v1_random:119172-119194 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1202881339 14_KI270722v1_random:63482-63504 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1124401648 15:29353801-29353823 TGATCCCCATGTTACCAGTGGGG + Intronic
1126816103 15:52455885-52455907 TGATCCGTATGTTAGATGAAAGG - Intronic
1127133047 15:55888054-55888076 TGTTCCAGATGTTAGAGGAAAGG - Intronic
1127758555 15:62116022-62116044 TGAACCTCAAGATAGCAGAAAGG - Intergenic
1128002555 15:64206943-64206965 TGCTACACATTTTACCAGAAAGG - Intronic
1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG + Intronic
1130336398 15:82960491-82960513 TGATCCACATTAGAACAGAATGG - Intronic
1136558189 16:31021432-31021454 TTATGCAGATGTTACCAGAAAGG + Intergenic
1137997391 16:53233406-53233428 TCATCCACATGCCAGGAGAATGG - Intronic
1138849900 16:60615181-60615203 TCACCCCCTTGTTAGCAGAAAGG + Intergenic
1140157724 16:72450607-72450629 TGATCCAAATCTTAGAGGAAGGG + Intergenic
1143352931 17:6302245-6302267 TGACCCACATCTGTGCAGAATGG + Intergenic
1145880558 17:28349757-28349779 TGATCCACATTTTAGGAGTAAGG + Intronic
1146299431 17:31676694-31676716 TGATCCAGGTATGAGCAGAAAGG + Intergenic
1146677780 17:34785304-34785326 AGAGCCACATGTTCCCAGAACGG - Intergenic
1149951170 17:60987897-60987919 TGTTCCATATCTTGGCAGAAAGG + Intronic
1153347209 18:4039994-4040016 TGTTCTATATATTAGCAGAAAGG - Intronic
1153421565 18:4912504-4912526 TGTTCAACATCTTAGAAGAAAGG - Intergenic
1154183899 18:12163581-12163603 TGTTCCACATCTTAGAGGAAAGG + Intergenic
1154296379 18:13153474-13153496 TGTTCCATATGTTAGAGGAAGGG + Intergenic
1154958236 18:21281022-21281044 TAATCCCCTTGTTTGCAGAATGG + Intronic
1155841881 18:30656533-30656555 TGTTCCTTATCTTAGCAGAAAGG - Intergenic
1156873222 18:41972988-41973010 TTTTCCCCAAGTTAGCAGAATGG - Intronic
1158948662 18:62470961-62470983 TGTTCCAGATGTTAGAGGAAAGG + Intergenic
1163577153 19:18117723-18117745 AGATTTACATTTTAGCAGAAAGG + Intronic
1163829084 19:19539257-19539279 TGATCCCCATTTTAACAGGAGGG - Intronic
1165187520 19:34034839-34034861 TAATCCTCATATTACCAGAAAGG + Intergenic
1202656948 1_KI270708v1_random:32589-32611 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
925937491 2:8779070-8779092 TGATCCACATATTATCATAAAGG - Exonic
926524684 2:13963964-13963986 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
926531095 2:14046749-14046771 TGAACCATGTGTTTGCAGAATGG - Intergenic
930230334 2:48836736-48836758 GGTTCCAGATCTTAGCAGAAAGG + Intergenic
930481093 2:51948662-51948684 TGATTCACATGGTGGCAGGAAGG - Intergenic
932184775 2:69684823-69684845 TTCTCCACATGTTATCAGTAAGG + Intronic
932648140 2:73526842-73526864 TGTTCCACATCTTAGAGGAAAGG + Intronic
935325243 2:101929602-101929624 TTCTCCACTTGTTTGCAGAAAGG - Intergenic
936411234 2:112260064-112260086 TTATCCACCTGTTATCAGGAGGG + Intergenic
936470340 2:112792970-112792992 TGGTCAAAATGTTACCAGAAAGG - Intergenic
936963571 2:118102908-118102930 TGATTCACAATTTAGCAGACTGG - Intronic
937033392 2:118760189-118760211 TGTTCCAGATCTTAGCGGAAAGG - Intergenic
938850808 2:135257295-135257317 TAATCTATATGTTACCAGAAAGG - Intronic
939347560 2:140986659-140986681 TGATCCACATGGAAGCACATGGG - Intronic
939364013 2:141209344-141209366 TTCTTCACATGTTAGCAGCAAGG - Intronic
939607628 2:144271968-144271990 TGATACACATGTCAGCAAAGTGG - Intronic
939701400 2:145396891-145396913 GCATCCAGATGTTAGAAGAACGG + Intergenic
940045190 2:149402272-149402294 TTATCCACATGTTAACTGATGGG + Intronic
940077631 2:149760909-149760931 TGTTTCAGATCTTAGCAGAAAGG + Intergenic
941303876 2:163836444-163836466 TGAGCCACATGTAAGCAGGAGGG + Intergenic
943467038 2:188240643-188240665 TTCTCCACATGTTAGAGGAAAGG - Intergenic
944769885 2:202903354-202903376 TGTTCCAGATGTTAGAGGAAAGG - Intronic
944950102 2:204738820-204738842 TTCTCCTGATGTTAGCAGAAGGG - Intronic
947789835 2:232858850-232858872 TGATCCACATGTTAGCAGAAAGG - Intronic
1169334350 20:4743116-4743138 TGATCCACTTGGTAACAGAGCGG + Intergenic
1169679637 20:8196388-8196410 TGATACACTTGTGAGCAAAATGG - Intronic
1172347190 20:34210758-34210780 TGTTCCAGATGTTAGATGAAAGG + Intronic
1173263341 20:41456077-41456099 TGAACTACATGTTAGAACAAAGG + Intronic
1174201137 20:48807434-48807456 TGATCCACATGTTGGGGTAACGG - Intronic
1174747899 20:53082261-53082283 TTATTAACATGTGAGCAGAATGG - Intronic
1174831361 20:53815393-53815415 TGATCCAGATCTTAGAGGAAAGG + Intergenic
1174979284 20:55374954-55374976 TGATATACATGCTAGCAGAAAGG + Intergenic
1176630639 21:9133839-9133861 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1176642648 21:9320992-9321014 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1177495863 21:21890812-21890834 TGTTCCAGTTCTTAGCAGAAAGG + Intergenic
1178004439 21:28201487-28201509 TGTTCCAGATCTTAGCAGAAAGG - Intergenic
1180351652 22:11810342-11810364 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1180375952 22:12093786-12093808 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1180386549 22:12181733-12181755 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1180607527 22:17070688-17070710 TATTCCAGATGTTAGAAGAAAGG + Intergenic
949221569 3:1640106-1640128 TGACCCACCTGAAAGCAGAAAGG + Intergenic
949250277 3:1975200-1975222 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
951423484 3:22515321-22515343 TGCTCCAGATCTTAGAAGAAAGG - Intergenic
953864065 3:46568621-46568643 TGTTCCAGATATTAGAAGAAGGG - Intronic
954581010 3:51702953-51702975 TGAGCCACAAGATAGCAAAAGGG - Intronic
956237311 3:67088129-67088151 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
957097457 3:75789658-75789680 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
957450308 3:80372840-80372862 TCATCCTCATGTTGACAGAAAGG + Intergenic
959118153 3:102201817-102201839 TGTTCCAGATCTTAGAAGAAAGG + Intronic
959414225 3:106063928-106063950 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
960164476 3:114386020-114386042 TGACAAACATGTGAGCAGAAAGG - Intronic
961096631 3:124162200-124162222 TGCTCCACAGGTTAGAAGACAGG + Intronic
963912114 3:150823743-150823765 TTATTCAAATGTTAGCAGATGGG + Intergenic
964975444 3:162614343-162614365 TTCTTCACATGTTAGCAGGAAGG - Intergenic
965047824 3:163601851-163601873 TGTTCCAGATTTTAGAAGAAAGG - Intergenic
965526667 3:169727221-169727243 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
965743889 3:171905136-171905158 TGATCCACATGTTTGCCAAGTGG + Intronic
965860968 3:173149706-173149728 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
966167209 3:177033685-177033707 TTATCCACTTGTTAGCTGATGGG - Intronic
967090009 3:186127106-186127128 TGAGGCAAATGTTAGAAGAAAGG + Intronic
1202744238 3_GL000221v1_random:84024-84046 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
970052820 4:11934755-11934777 TGTTCTACATGTTAGAAGAAGGG + Intergenic
972708499 4:41570033-41570055 TGAACCACATGTTTGCAGAATGG + Intronic
973189480 4:47370800-47370822 TGATCCACTTGTAAGCAGCATGG - Intronic
973360107 4:49157221-49157243 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
973622614 4:52742520-52742542 TGATTCACATGTAAGAGGAATGG - Intronic
974612400 4:64232808-64232830 TGAGCCACATCTTGGCACAAAGG + Intergenic
975081159 4:70282057-70282079 TGTTCCAGATATTAGAAGAAAGG - Intergenic
975312745 4:72920911-72920933 TGTTCCAAATCTTAGCAGAAAGG + Intergenic
976603985 4:86965449-86965471 TTATCCACCTATTAGCAAAAGGG + Intronic
977594231 4:98860678-98860700 TAATCCCCATTTTAACAGAATGG + Intergenic
978097877 4:104801897-104801919 TGTTCCACATCTTAGAGGAAAGG - Intergenic
978288039 4:107101225-107101247 TGTTCCAGATATTAGAAGAAAGG - Intronic
978326880 4:107568243-107568265 TGTTCCACATCTTAGCAGAAGGG - Intergenic
978456782 4:108901934-108901956 TGAGCCACATGGAAGCATAAAGG - Intronic
978661605 4:111133690-111133712 AGATCCACATCTTAGAGGAAAGG + Intergenic
980146410 4:128990511-128990533 TGTTCCAGATATTAGCAGAAAGG - Intronic
980443530 4:132878575-132878597 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
981318172 4:143362288-143362310 GCATCCATATGTTACCAGAAAGG + Intronic
981453425 4:144926156-144926178 TGTTCCACATCTTAGAAAAAAGG + Intergenic
982790022 4:159580548-159580570 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
983138848 4:164122850-164122872 TGTTCCAGATGTTAGAGGAAAGG - Intronic
983860739 4:172703267-172703289 TGTTCCAGATCTTAGAAGAAAGG + Intronic
1202757549 4_GL000008v2_random:79227-79249 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
986387487 5:7248818-7248840 TGATCCAGAGGTTTGCAGTATGG + Intergenic
987652911 5:20767591-20767613 TGAAGCAGCTGTTAGCAGAAAGG + Intergenic
988742652 5:34093893-34093915 TGAAGCAGCTGTTAGCAGAAAGG - Intronic
988955828 5:36317694-36317716 TGTTCCAGATGTTAGAGGAAAGG + Intergenic
988965076 5:36408040-36408062 TGTTCTAGATGTTAGAAGAAAGG - Intergenic
989729711 5:44634060-44634082 TGATGCAGATGTCAGCATAAAGG - Intergenic
993580790 5:89658743-89658765 TGTTCCAAATCTTAGAAGAAAGG - Intergenic
994457615 5:100032293-100032315 TGTTCCAGATTTTAGAAGAAAGG - Intergenic
995696990 5:114890340-114890362 TGATCTACATCTTAGAGGAAAGG + Intergenic
996298807 5:121957057-121957079 TGTTCTAGATCTTAGCAGAAAGG + Intergenic
996491649 5:124105168-124105190 TGATGCAGATGTGTGCAGAATGG + Intergenic
997964996 5:138349811-138349833 TGACCCACATCTTAGATGAAGGG - Intergenic
999410948 5:151349356-151349378 TGCACCACATGTTAGCAGGCAGG + Intergenic
999623591 5:153497002-153497024 TGCTAGACATGTTAGCAGCAGGG + Intronic
1001994282 5:176142992-176143014 AGATCCACCTGTTACCAGAAAGG + Intergenic
1006087411 6:31606170-31606192 TCATCCTAATGTTAGCACAACGG - Intergenic
1009329344 6:62396905-62396927 TGTTCCAGATGTTAGAAAAAAGG + Intergenic
1010296379 6:74202238-74202260 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1010319657 6:74491054-74491076 TGATAAGCATGTTAGTAGAATGG - Intergenic
1010408820 6:75537366-75537388 TAATCCACATGGTAGCAAGATGG + Intergenic
1011236362 6:85222492-85222514 TGTTCCAGATGTTAGAGGAAAGG - Intergenic
1011621757 6:89250147-89250169 TCATCCTCCTGTGAGCAGAAAGG - Intergenic
1012050254 6:94332879-94332901 TGTTCCACATCTTAGAGGAAAGG - Intergenic
1012600287 6:101088267-101088289 TGTTCCAGATGTTAGAGGAAAGG + Intergenic
1012827844 6:104168113-104168135 TGCTCCAGATCTTTGCAGAAAGG - Intergenic
1013193555 6:107825245-107825267 TAAGCCACATGTTTGTAGAATGG - Intergenic
1013839182 6:114370052-114370074 TGAACCAAATGTTAGAAGACTGG + Intergenic
1015030662 6:128591119-128591141 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1015578291 6:134696491-134696513 TGTTCCAAATGTTAGAGGAAAGG + Intergenic
1016513837 6:144872130-144872152 TGGCCCAGATGTTACCAGAAAGG + Intergenic
1016643156 6:146373935-146373957 TGCTCCACATCTTAGAGGAAAGG + Intronic
1016948625 6:149558449-149558471 TGATCCACTTCTTAGAGGAAAGG - Intergenic
1018012000 6:159679245-159679267 TGATGCACATCTTAGAAGACAGG + Exonic
1018233074 6:161694752-161694774 TCATCCTCATGTTAGCAAACAGG - Intronic
1021284539 7:18763950-18763972 TGTTCCACATTTTAAGAGAAAGG + Intronic
1022424852 7:30258726-30258748 TGATCCATAGATTTGCAGAATGG - Intergenic
1025288709 7:57691971-57691993 TGATCCTGATCTTAGAAGAAGGG + Intergenic
1027167203 7:75843382-75843404 TGATCCAAGTGTTACCAGAAAGG + Intronic
1027958507 7:84913591-84913613 TGATTAAAATGTTACCAGAAAGG - Intergenic
1028228209 7:88274508-88274530 TAATGCATATGTTACCAGAAAGG + Intergenic
1030008943 7:105146550-105146572 TGATGCATATGTGAGAAGAATGG - Exonic
1030953070 7:115816887-115816909 TGTTTCACATTTGAGCAGAAGGG - Intergenic
1031223734 7:119007652-119007674 AAATCCACAGGTAAGCAGAAGGG + Intergenic
1031746239 7:125501897-125501919 TGTTCCACATCTTAGATGAAAGG + Intergenic
1033931172 7:146524095-146524117 TGATACTCTTGTGAGCAGAATGG - Intronic
1039001884 8:32990644-32990666 TGTTCCACATCTTAGAGGAAAGG + Intergenic
1039094654 8:33870609-33870631 TCATCCACTTGTTGGAAGAAAGG - Intergenic
1041212079 8:55562130-55562152 TGATCCAAAGGATAGGAGAAGGG - Intergenic
1041691106 8:60688131-60688153 TCATCTCCATGTGAGCAGAAGGG - Intronic
1041890500 8:62863357-62863379 TGATGCATATGTGAGAAGAACGG - Intronic
1042188265 8:66158454-66158476 GGATCCAAAAGTTAGAAGAAAGG + Intronic
1042363276 8:67906996-67907018 ATATCCACATTTTAGCAGATGGG - Intergenic
1043881582 8:85549505-85549527 AGATTCACATGTTAGAAGGATGG + Intergenic
1044616397 8:94147150-94147172 TGATCCCCATGGTATGAGAAAGG + Intronic
1045838538 8:106552231-106552253 TGATCTACAGGCAAGCAGAAAGG - Intronic
1046557491 8:115792478-115792500 TGTTCCACATCTTAGAGGAAAGG - Intronic
1048029625 8:130618968-130618990 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1048036240 8:130680012-130680034 TGATCCACATTTTACAAGAGAGG - Intergenic
1048119142 8:131560134-131560156 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1049864410 8:144924707-144924729 TGAGGCACATGTCAGCAGATTGG + Intergenic
1051006205 9:12348139-12348161 TGGTCCACAAGCTAGAAGAAAGG + Intergenic
1052586258 9:30431832-30431854 TGATCCAGATCTTAGACGAAAGG - Intergenic
1053570557 9:39301039-39301061 TGATCCTTATGTTACCAGAAAGG - Intergenic
1053836504 9:42141957-42141979 TGATCCTTATGTTACCAGAAAGG - Intergenic
1054092176 9:60860056-60860078 TGATCCTTATGTTACCAGAAAGG - Intergenic
1054113589 9:61135649-61135671 TGATCCTTATGTTACCAGAAAGG - Intergenic
1054126591 9:61317973-61317995 TGATCCTTATGTTACCAGAAAGG + Intergenic
1054594106 9:67046538-67046560 TGATCCTTATGTTACCAGAAAGG + Intergenic
1055624224 9:78157378-78157400 TGAACCACAGGTTAGTAAAAGGG + Intergenic
1056200527 9:84271489-84271511 TCATCCTCATGTCATCAGAAAGG + Intergenic
1056277586 9:85008126-85008148 TTTTCAACCTGTTAGCAGAAGGG + Intronic
1056320035 9:85427293-85427315 TGAGGCCCATGTTAGCAGATGGG - Intergenic
1057825317 9:98368684-98368706 TGAATCACATATTAGCACAAAGG + Intronic
1058600393 9:106663161-106663183 TGGTCCACATGTTTGCACCATGG - Intergenic
1059586014 9:115607082-115607104 AGATCCACATGGTAGCAATATGG - Intergenic
1060466969 9:123915055-123915077 TCATCCTCATGTTGGCAGGATGG - Intronic
1203753468 Un_GL000218v1:101540-101562 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1203712871 Un_KI270742v1:113976-113998 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1186315954 X:8370566-8370588 TCATTCAGGTGTTAGCAGAAGGG + Intergenic
1187642509 X:21310516-21310538 TGAACCAGATGTAAGAAGAAGGG - Intergenic
1188349078 X:29104874-29104896 TCATCCTCATGTTCACAGAATGG + Intronic
1188741739 X:33791936-33791958 TGTTCCATATCTTAGAAGAAAGG + Intergenic
1190919053 X:54833286-54833308 TGCTCCAGACCTTAGCAGAAAGG + Intergenic
1194285287 X:92002962-92002984 TGTTCCAGATGTTAGAGGAAAGG + Intronic
1194467326 X:94249537-94249559 TCATCCATATGTTAGCAATATGG + Intergenic
1195824648 X:108985409-108985431 TGATCCAGATCTTAGAGGAAAGG + Intergenic
1196254670 X:113502744-113502766 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1196600905 X:117600924-117600946 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1196639652 X:118043811-118043833 TGTTCCAGATCTTAGAAGAAAGG - Intronic
1197559196 X:127996692-127996714 TGTTCCAGATCATAGCAGAAAGG - Intergenic
1197661182 X:129174577-129174599 TGTTCCAGATCTTAGAAGAAAGG + Intergenic
1199367990 X:147010039-147010061 TGTTCCAGATGTTAGAGGAAGGG + Intergenic
1200602855 Y:5227504-5227526 TGTTCCAGATGTTAGAGGAAAGG + Intronic
1201167113 Y:11219099-11219121 TGTTCCAGATCTTAGAAGAAAGG - Intergenic
1201896251 Y:18995756-18995778 TGAACCACATGTTAGGATTAAGG - Intergenic