ID: 947791021

View in Genome Browser
Species Human (GRCh38)
Location 2:232869402-232869424
Sequence GGGCGCTGACAGAACTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947791018_947791021 -3 Left 947791018 2:232869382-232869404 CCATCAAGGTGTGAAGTAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG 0: 1
1: 0
2: 1
3: 2
4: 90
947791013_947791021 15 Left 947791013 2:232869364-232869386 CCTTAGCGCGGTGGGAAACCATC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG 0: 1
1: 0
2: 1
3: 2
4: 90
947791009_947791021 26 Left 947791009 2:232869353-232869375 CCGAGGCAAGCCCTTAGCGCGGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG 0: 1
1: 0
2: 1
3: 2
4: 90
947791012_947791021 16 Left 947791012 2:232869363-232869385 CCCTTAGCGCGGTGGGAAACCAT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG 0: 1
1: 0
2: 1
3: 2
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947791021 Original CRISPR GGGCGCTGACAGAACTCTGA GGG Intronic
902251262 1:15155218-15155240 CGGAGCTGACAGCTCTCTGATGG + Intronic
903102401 1:21042732-21042754 GTGAGCAGACAGAACTCTGAGGG - Intronic
907555283 1:55338059-55338081 GGGTGCTGACAAAACTCTCCAGG + Intergenic
910132475 1:83925065-83925087 GGGCAGCGACAGAACCCTGAGGG - Intronic
913677901 1:121159359-121159381 TAGAGCTGACAGTACTCTGATGG - Intergenic
914029735 1:143946991-143947013 TAGAGCTGACAGTACTCTGATGG - Intronic
914159714 1:145120959-145120981 TAGAGCTGACAGTACTCTGATGG + Intergenic
920025011 1:202987973-202987995 GGTAGCTGAGATAACTCTGAAGG - Intergenic
920465206 1:206177872-206177894 TAGAGCTGACAGTACTCTGATGG - Intergenic
920601820 1:207333260-207333282 GGTGGCTGGGAGAACTCTGAAGG + Intronic
1063418331 10:5890563-5890585 GGGCGCTCACTGAACTCGGTCGG + Intronic
1065086877 10:22187415-22187437 GGGCTCTTACAGGACTCTTATGG + Intergenic
1071475272 10:86020130-86020152 GGGCACTGCCAGCCCTCTGAGGG - Intronic
1072994323 10:100229679-100229701 GGGCGCTGCCAGAGCCCTGCCGG + Intergenic
1074869665 10:117566835-117566857 GGGCTTTGCTAGAACTCTGAGGG + Intergenic
1080501791 11:32878382-32878404 GGCACCTGATAGAACTCTGAAGG - Intergenic
1082616541 11:55368013-55368035 GGGCTCACACAGAACCCTGAGGG + Exonic
1082626319 11:55491243-55491265 GGGCTCACACAGAACCCTGAGGG + Intergenic
1082829098 11:57602205-57602227 GGGTCCTGAGAGGACTCTGAAGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1085203699 11:74717665-74717687 GGGAGCAGACAGAGCTCTGGAGG - Intronic
1085745907 11:79113987-79114009 GGGAGCTGAAACCACTCTGATGG - Intronic
1089846755 11:121464805-121464827 TGCCGCTGACAGCACTTTGAAGG + Intronic
1099243471 12:80165922-80165944 GGGTCCTGACAGAACACAGATGG - Intergenic
1100158951 12:91835024-91835046 GTGCTCTGACAGAACTGAGAAGG + Intergenic
1100779574 12:98009484-98009506 GGGACCACACAGAACTCTGAGGG + Intergenic
1108679875 13:52770675-52770697 TGGCTCTGAGAGAACACTGACGG + Intergenic
1113415759 13:110127236-110127258 AGGCTCTGATAGAACCCTGAGGG - Intergenic
1113416257 13:110131012-110131034 AGGCTCTGATAGAACCCTGAGGG - Intergenic
1122836729 14:104434284-104434306 GGATGCTGACAGAAGTCTCACGG + Intergenic
1128333972 15:66774326-66774348 GGGAGCTGACTGCAGTCTGAGGG - Intronic
1130183385 15:81653249-81653271 GGGGGCTGAAAGAACTGTGCAGG - Intergenic
1130725304 15:86432926-86432948 AGGCCCTGCCAGAACCCTGAGGG - Intronic
1131434551 15:92412545-92412567 GGCATCTGTCAGAACTCTGAAGG - Intronic
1134585901 16:15410588-15410610 TGGAGATGACAGAACTCTGGTGG - Intronic
1138213753 16:55184896-55184918 GGGCACTGACAGCACCCTGCTGG - Intergenic
1142214230 16:88822910-88822932 GGGCGCTGGCTAAACGCTGAAGG + Intronic
1148535587 17:48436023-48436045 GGACACTGACACAATTCTGAAGG - Intergenic
1150458447 17:65327188-65327210 GGGGGCTCACTGAACTGTGATGG - Intergenic
1152856544 17:82667932-82667954 GGGCGCTGACGGGGCACTGATGG + Intronic
1165297592 19:34940132-34940154 GGGCCCTGATAGAATACTGAAGG + Intronic
1165443490 19:35844138-35844160 CTGCACTGCCAGAACTCTGAGGG - Exonic
1167350479 19:48970918-48970940 GGGCGCTGACCGTAAGCTGAGGG + Exonic
928532996 2:32211195-32211217 GTCCGCTGCCCGAACTCTGAAGG - Intronic
936454891 2:112665485-112665507 AGGCAGTGCCAGAACTCTGAGGG - Intergenic
937241327 2:120464471-120464493 GGGCCCTGACTGAGCTGTGACGG - Intergenic
937656203 2:124379698-124379720 GGGCGCTGCCAGACCTCACAAGG - Intronic
940153760 2:150631065-150631087 GGGCTTTGACTGAACTTTGAAGG + Intergenic
943811081 2:192190188-192190210 AGGGGTTGACAGAACTCTAAAGG - Intronic
947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG + Intronic
948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG + Intronic
1170884043 20:20322695-20322717 GGAAGATGCCAGAACTCTGAGGG - Intronic
1172191730 20:33065847-33065869 GGGTCCAGACAGCACTCTGAAGG + Intronic
1175918611 20:62439416-62439438 GGACGCAGACAGCACACTGAAGG - Intergenic
1178242836 21:30922427-30922449 AGGCCCTGACACAACACTGAGGG + Intergenic
949972045 3:9416177-9416199 GAGTGCTGACAGAAGACTGAGGG - Intronic
953710334 3:45264530-45264552 GGGGCCTGAGGGAACTCTGAGGG + Intergenic
954390294 3:50264997-50265019 GGGCCCTGTCAGAACTGAGATGG - Intergenic
954957424 3:54534031-54534053 GGGAGCTGACAGACTTCTGGTGG - Intronic
957053833 3:75429683-75429705 GAGCCCAGACAGAACTGTGAGGG + Intergenic
962739913 3:138356008-138356030 GGGTGCTGAGAGACCTCAGAAGG + Intronic
965934043 3:174083223-174083245 GGACTCTGACAGAACTTAGATGG + Intronic
967712215 3:192722460-192722482 TGGCCCTGACTGAACTCTGATGG + Intronic
968868677 4:3229942-3229964 TGACGCTGACAGAACTGCGAAGG + Exonic
969306325 4:6328081-6328103 GGGCTCTCCCAGACCTCTGAGGG - Intronic
979766174 4:124466865-124466887 GTGAGCTAAGAGAACTCTGAAGG - Intergenic
981225678 4:142291053-142291075 AGGCACTGACAGAGTTCTGAGGG - Intronic
983266042 4:165509181-165509203 GGGGGATACCAGAACTCTGAGGG + Intergenic
985760483 5:1746311-1746333 GGGCCCTGGCAGGACCCTGAGGG + Intergenic
985920248 5:2965949-2965971 GGCCACTGAGAGAACTCTGGGGG + Intergenic
985922481 5:2989450-2989472 GGCCACTGACAGCACGCTGAGGG + Intergenic
990993569 5:61708538-61708560 GGTAACTGACAGAACTCAGATGG + Intronic
990996344 5:61735919-61735941 GGCAGCTGACAGAACTCAGTTGG - Intronic
995175653 5:109173545-109173567 GGGCACTGGGAGAATTCTGAAGG - Intronic
995438726 5:112166205-112166227 GGTCACTGCCAGAACTCTGGTGG + Intronic
1000257288 5:159552061-159552083 AGGATCTGACAGAACCCTGAAGG + Intergenic
1001284112 5:170410090-170410112 AGGGGCTCACAGCACTCTGATGG - Intronic
1009752353 6:67888756-67888778 GGGCATTGACCGAACACTGAAGG + Intergenic
1011686255 6:89826353-89826375 GCAGTCTGACAGAACTCTGAAGG - Intergenic
1015918432 6:138242347-138242369 GGGCAGAGACAGAACTGTGAGGG - Intronic
1019274806 7:170662-170684 GGGCGCTGACAGGACCCGCAAGG + Intergenic
1023962166 7:44935861-44935883 GTGCCCTGCCAGAACTCTGTGGG - Intergenic
1038955801 8:32467316-32467338 GGGCTCTGACAAAAGGCTGATGG - Intronic
1042872340 8:73410415-73410437 GGGTGCTGACTGGGCTCTGATGG + Intergenic
1047018999 8:120754736-120754758 GGGCACAGACAGTACACTGAAGG - Intronic
1048935270 8:139349965-139349987 AGGAGCTGACATAACTCTGGGGG + Intergenic
1049432391 8:142571388-142571410 GGGCCCAGACAGCACCCTGATGG - Intergenic
1052623422 9:30943855-30943877 GGGCGCTGTCACAACTCGGTTGG + Intergenic
1053173569 9:35907303-35907325 GGGCTCTGTCTGAGCTCTGAGGG + Intergenic
1057271917 9:93656303-93656325 GGGCACTGACAGAACTCTCATGG + Intronic
1059365931 9:113786436-113786458 GGACGCTGCCAGAATGCTGATGG - Intergenic
1188324428 X:28783526-28783548 TGGCCCTGACAAAACTCTGTGGG - Intronic
1193845023 X:86457920-86457942 GGGGGTTGACAGATCTCTAAAGG + Intronic
1202627414 Y:56874011-56874033 GGACCCAGACATAACTCTGAAGG + Intergenic