ID: 947791810

View in Genome Browser
Species Human (GRCh38)
Location 2:232872995-232873017
Sequence TCCTGGGGCCCTGGCCGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947791797_947791810 17 Left 947791797 2:232872955-232872977 CCACTTGGGCACCAGCCTAGGTT 0: 1
1: 0
2: 0
3: 19
4: 129
Right 947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG 0: 1
1: 0
2: 0
3: 25
4: 218
947791795_947791810 29 Left 947791795 2:232872943-232872965 CCTATGTGTCTGCCACTTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 143
Right 947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG 0: 1
1: 0
2: 0
3: 25
4: 218
947791801_947791810 6 Left 947791801 2:232872966-232872988 CCAGCCTAGGTTGGCAGGGAGCT 0: 1
1: 0
2: 4
3: 16
4: 137
Right 947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG 0: 1
1: 0
2: 0
3: 25
4: 218
947791803_947791810 2 Left 947791803 2:232872970-232872992 CCTAGGTTGGCAGGGAGCTGGTG 0: 1
1: 0
2: 4
3: 35
4: 324
Right 947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG 0: 1
1: 0
2: 0
3: 25
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947791810 Original CRISPR TCCTGGGGCCCTGGCCGCTT GGG Intronic
900609160 1:3537174-3537196 GCCTGGGGCCTTGGCCCCCTTGG - Intronic
900655531 1:3754962-3754984 TCCTGGAGCCCTGGCCACCGTGG - Intronic
900830407 1:4961253-4961275 TCATGGAGCCCTGTCCCCTTTGG - Intergenic
901454220 1:9354048-9354070 TCCTGGAGACCTGGCCGCCCCGG + Intronic
901799331 1:11698374-11698396 TCCTGGAGCCCCGGCCCCCTAGG - Intronic
902187505 1:14736213-14736235 TCCTGGGCCCCTGGCCTGTTGGG + Intronic
902623293 1:17662767-17662789 CCCTGGGGCCCTTCCGGCTTTGG + Intronic
902797458 1:18808736-18808758 GCCTGGGGTCCTGCCTGCTTAGG - Intergenic
902892447 1:19454055-19454077 TCCAGGAGCCCTGGCCACTCTGG - Intronic
903056843 1:20641961-20641983 TGCTGGGGCCCTGACAGCCTGGG + Intronic
903919347 1:26788245-26788267 TCCTTGGGCCGTGGCCCCTCTGG + Exonic
904453964 1:30635836-30635858 TACTGGGGACCCGGCCTCTTTGG - Intergenic
904804686 1:33122587-33122609 TCCTGGACCCCTGGCTGCATGGG + Intergenic
906109062 1:43311534-43311556 TCCCTGGGCCCTGGCCACTATGG + Intronic
906332535 1:44898949-44898971 TCCTGTGGTCCTAGCTGCTTGGG - Intronic
907241216 1:53082084-53082106 TCCAAGGACCGTGGCCGCTTGGG + Exonic
907306353 1:53515206-53515228 TCCTGGGTCTCTGTCTGCTTCGG - Intronic
907520357 1:55019719-55019741 CCCTGGGGCCCGGGCTGCTGGGG + Intergenic
910677871 1:89833042-89833064 TCCTGAAGCCATGGCAGCTTGGG - Intronic
912734686 1:112139812-112139834 TCTTGGGCTCCTGGCAGCTTGGG + Intergenic
913967057 1:143385159-143385181 CCCTGGGCCCCTTGCCGCATAGG + Intergenic
914061433 1:144210766-144210788 CCCTGGGCCCCTTGCCGCATAGG + Intergenic
914117717 1:144755603-144755625 CCCTGGGCCCCTTGCCGCATAGG - Intergenic
914914603 1:151811416-151811438 TCTTGGAGCCCTGGCCGATCTGG + Exonic
915201301 1:154231423-154231445 ACCTGTGGCCCTAGCTGCTTGGG - Intronic
915645637 1:157270073-157270095 TCTTGGAGCCCTGCCCTCTTGGG - Intergenic
915698353 1:157767453-157767475 TCCTGGGGCCCAGGCTGCAGTGG - Exonic
919810662 1:201407050-201407072 ACCTGGGGCCCTGGCAGATTGGG - Exonic
920053345 1:203176208-203176230 TGCTGGGGCCCTGACAGTTTGGG + Intergenic
921213890 1:212921399-212921421 TCCTGGGAGCCTGGCAGCCTGGG + Intergenic
922654357 1:227368157-227368179 GCCTGTGGTCCTAGCCGCTTGGG + Intergenic
922807673 1:228399032-228399054 CTCTGGGGCCCTGGCTGCTATGG - Intronic
1062802673 10:391665-391687 TCCTGGAACCCTGGCTGTTTTGG - Intronic
1063365207 10:5486427-5486449 TCCTGGAGCGCTGGCCTCTCTGG + Intergenic
1064118589 10:12599978-12600000 TCCTGTAGTCCTGGCTGCTTAGG + Intronic
1066022819 10:31319742-31319764 TCCCGGGGGCCTGGGCGCTGAGG - Intronic
1067067531 10:43112285-43112307 TCCTGGGGCCCTGCCAGCCTGGG + Intronic
1067142071 10:43666543-43666565 CCCCGGGGCCCGGGCCACTTGGG - Intergenic
1067160144 10:43818921-43818943 TTCTGGGTCCCTGGCTGCTTGGG + Intergenic
1068717631 10:60205721-60205743 CCCTGGGGCTCTGGCTGCTAAGG + Intronic
1070964927 10:80524162-80524184 TCCTGGGCCCCAGGCCTCTGTGG - Exonic
1072641004 10:97211342-97211364 TCCTGGGCCCCTGCCCGCCTCGG + Intronic
1074135013 10:110618394-110618416 TCCTGGGGCTCTCCCCACTTAGG - Intergenic
1074979759 10:118610089-118610111 CCATGGGGCCCTGGCTGCTAAGG + Intergenic
1075077244 10:119359596-119359618 TGCTGTGGCCCTGGCTGCTGTGG + Intronic
1075272436 10:121064011-121064033 TCCTGGAACCCTGGCTGCCTGGG - Intergenic
1076725434 10:132410817-132410839 TCCTGGTGTCCCGGCCTCTTGGG + Intronic
1076904635 10:133355888-133355910 TCCTGGTGCCCTCCCTGCTTTGG - Intronic
1077089880 11:773573-773595 TCCTGGGGCCCTGACCGACCTGG - Exonic
1077162844 11:1121490-1121512 TCCTGGGGCCCCGCCCTCTTTGG - Intergenic
1077225497 11:1437547-1437569 CCCTGGGGCCCTCCCCACTTGGG + Intronic
1079333786 11:19553780-19553802 CCCTGGAGCCCTGGCAGCTGTGG - Intronic
1081802493 11:45869649-45869671 TCCTGAGGCCCTGGCCAAGTGGG + Exonic
1084153537 11:67302145-67302167 TCCTGGGCCCCTGGGCTCTGTGG - Exonic
1084231129 11:67754050-67754072 TCCTGGGACCATGACAGCTTCGG + Intergenic
1084561827 11:69909865-69909887 TCCCAGGGCCCTGGCTGCTCCGG - Intergenic
1087048210 11:93862094-93862116 TCCTGGGGGCCTGAAAGCTTGGG - Intergenic
1088921255 11:114261133-114261155 TCCTGGGTCCCTGGCTCCGTGGG - Intronic
1089640676 11:119845380-119845402 CCCTGGGGACCGGGACGCTTGGG + Intergenic
1089784751 11:120899984-120900006 TCCTGGGGCCCAGGCGCCCTGGG + Intronic
1094495063 12:30984081-30984103 TGCAGGGGCCCTTGCCGCTGAGG - Intronic
1096227035 12:49872607-49872629 TGTTGGAGCCCTGGCCTCTTGGG - Intronic
1096552939 12:52385434-52385456 TTCCGGGGCCTTGGCAGCTTTGG - Exonic
1096675634 12:53224304-53224326 TGCTGGGTCCCTGGCACCTTGGG - Intronic
1105696937 13:22898057-22898079 GCCAGGGACCCTGGCCTCTTGGG - Intergenic
1106128592 13:26921095-26921117 TCCTGTGGCCCAGGCCGTCTGGG - Intergenic
1112736884 13:102430700-102430722 TCCTGGGGACATGCCCTCTTAGG + Intergenic
1113600759 13:111566686-111566708 TCCTGGGGCCCTGGGTCCTCCGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114183794 14:20385164-20385186 TCCTGGGGCCTTGGCAGGTCTGG - Intronic
1116039946 14:39673951-39673973 TCCTGGCACCCTGGCCACATAGG - Intergenic
1119484622 14:74979554-74979576 GCCTGGGGCCCTGGAGGCCTAGG + Intergenic
1120095218 14:80380620-80380642 TCCTGGGGCCATTGCCTGTTTGG - Intronic
1120219440 14:81715547-81715569 GCCTGGGCCCCTGTCAGCTTGGG - Intergenic
1121282814 14:92711491-92711513 TCCTGGGGACCTGTGGGCTTTGG - Intronic
1121315586 14:92959275-92959297 TCCTGGGGCCCTGCGGGCTGAGG - Intronic
1121648364 14:95536149-95536171 CCCTGGTGCCCTGGCCCCCTGGG - Intronic
1122688669 14:103521623-103521645 CCCTGGGCCCCAGGCCGCTGTGG + Intronic
1122969910 14:105148296-105148318 TCCGCAGGCCCTGGCCGCCTGGG - Intronic
1123002877 14:105305715-105305737 TCCTGGGGCGCTTGCAGCATGGG - Exonic
1123049940 14:105536351-105536373 TCCTGGCTCCCTGGCAGCTCAGG - Intergenic
1125503159 15:40252102-40252124 TCTTGGGGCCCTGTCCACATGGG + Exonic
1126451090 15:48810561-48810583 TCCTGGGCCCCGTGCGGCTTTGG - Intronic
1128785650 15:70395059-70395081 TCCTGGGGTCCAGGTTGCTTGGG + Intergenic
1129781705 15:78276641-78276663 TGCTGGGGCCCAGGCTGCTTCGG - Intronic
1129853565 15:78809654-78809676 TCCTGGCCCCCTGGCAGCTGTGG - Intronic
1132667405 16:1088450-1088472 TCGTGCTGCCCTGGCCACTTAGG - Intergenic
1132675310 16:1118923-1118945 TCCTGGGCCCCAGGCCGCGATGG - Intergenic
1132681597 16:1144676-1144698 TCCGGGGGCCTTGGCCACTTGGG - Intergenic
1132738465 16:1398977-1398999 GCCTGAGCCCCTGGCAGCTTGGG + Intronic
1132761549 16:1510926-1510948 TCCTGGGGCCCAGGCCCCTCAGG + Exonic
1132880956 16:2161494-2161516 TGCTGGGGTCCTGGCCACCTGGG + Intronic
1133001832 16:2855797-2855819 TGCTGGGGGCCTGGCAGCTGGGG - Exonic
1134413764 16:14025598-14025620 TCCTGGGGCCCTGTGGGCCTAGG + Intergenic
1135917967 16:26623072-26623094 TCCTGTGGCCCTTGCCACATAGG - Intergenic
1136577978 16:31135460-31135482 TCCTGGGGCCTGGGCAGCTGGGG - Exonic
1136927710 16:34389389-34389411 TCCTGCGGTGCTGGGCGCTTGGG + Intergenic
1136976864 16:35022417-35022439 TCCTGCGGTGCTGGGCGCTTGGG - Exonic
1137558701 16:49489404-49489426 TCCTGGAGACCTGGCAGTTTTGG - Exonic
1139249712 16:65483022-65483044 TCCTGGTGCCCTGGCTTCTGTGG - Intergenic
1141280798 16:82628105-82628127 GCCTGGGGTGCTGGCCGCTGCGG + Intronic
1141317368 16:82975180-82975202 CCTTGGGGCCCTGGCTGCTGTGG + Intronic
1141564315 16:84891247-84891269 CCCTGGGCCCCTGGACGCTCAGG + Intronic
1141692128 16:85602439-85602461 CCCTTGGGCCCTGGCCGCCCTGG + Intergenic
1141771844 16:86094306-86094328 TCCTGGGTGCCTGGCCCCTCAGG + Intergenic
1142402897 16:89870277-89870299 TCCTGGAGGCCTGGCCACCTGGG - Exonic
1151952653 17:77363781-77363803 TTCTGGGGACCTGTCCACTTGGG - Intronic
1152035916 17:77872712-77872734 TTCTGGGGCACTGGGGGCTTGGG + Intergenic
1152579282 17:81158966-81158988 TCCTGTGGCCTTGTCCTCTTTGG - Intronic
1152631911 17:81414265-81414287 GCCTGGCGCCCTGGCCTCTGGGG + Intronic
1153285372 18:3450905-3450927 TCCCGCGGCCCCGGCCGCCTGGG - Intronic
1153831278 18:8925378-8925400 GCCTGTGGTCCTGGCTGCTTGGG + Intergenic
1158889817 18:61862554-61862576 TCCTTGAACCCTGTCCGCTTGGG - Intronic
1160255335 18:77243581-77243603 GCCTGGGGACCTGGCTGCTCCGG - Intergenic
1160862714 19:1244507-1244529 TCCTGGGGTCCCGGCCACCTGGG + Exonic
1160987989 19:1848385-1848407 CCCTGGGGCCCGGGCGGCTCCGG - Exonic
1160996286 19:1883560-1883582 TAGTGGGGCCCTGGCCACCTCGG - Intronic
1161091518 19:2361925-2361947 TCCTGGGGGCCTGGCTGGGTGGG + Intergenic
1161383287 19:3977702-3977724 ACCTGGGGCCTTGCCCGCCTTGG + Intronic
1161538006 19:4831647-4831669 TCCTGGGGTCCTGGGGGCTGGGG + Exonic
1162958935 19:14114806-14114828 TTCTGGATCCCTGGCCTCTTGGG + Intronic
1164639185 19:29812186-29812208 TCCTGGGGCCCAGACCGCGCCGG + Intronic
1165149413 19:33752080-33752102 TCCTGGGGCTCAGGCAGCTGTGG - Intronic
1165529870 19:36389740-36389762 TCCTGATGCTCTGGCCACTTGGG + Intronic
1165770388 19:38376510-38376532 TTCTGGAGCTCTGGCTGCTTGGG + Intronic
1166368744 19:42290302-42290324 TCCGGGGGCCCTGGGGGCTCAGG - Exonic
1167410231 19:49339872-49339894 CCCTGGGGCTCTGGCCGCTGTGG + Intronic
1167452736 19:49581584-49581606 TCCAGGGCCCCTGCCCACTTAGG + Intronic
1167467578 19:49658340-49658362 TCTGGGGGCCCTGGCTCCTTGGG - Exonic
1167497935 19:49830258-49830280 TGCTGGAGCCCTGGCCCCTGGGG + Intronic
1167738192 19:51310400-51310422 GCCTGGGGGCCTGGCCTCCTGGG + Intergenic
1168324505 19:55531064-55531086 TCCTGCGGCCCAGGCTGCTCAGG + Intronic
1168570720 19:57466669-57466691 TTCTGGGCCCCAGGCCACTTCGG + Intronic
1202700840 1_KI270712v1_random:162654-162676 CCCTGGGCCCCTTGCCGCATAGG + Intergenic
925148384 2:1598434-1598456 CCCTGGGGCCCAGCCCGGTTTGG - Intergenic
925740238 2:6999316-6999338 TCGGGGTGCCCTGGTCGCTTTGG + Intronic
929883785 2:45860707-45860729 TCTGGGGGCCCTGCCCACTTTGG + Intronic
934171769 2:89546143-89546165 CCCTGGGCCCCTTGCCGCGTAGG + Intergenic
934282078 2:91620461-91620483 CCCTGGGCCCCTTGCCGCGTAGG + Intergenic
939275640 2:139993108-139993130 TCCTGGGGCCTTGGACCCGTGGG - Intergenic
940674581 2:156713120-156713142 TCCTGGGCCCCTCGCCTTTTAGG + Intergenic
946167225 2:217871739-217871761 TCCTGGGGCCCAGGCCGGATGGG - Intronic
946229501 2:218282729-218282751 TCCTCGGGGCCTGGCAGCTCTGG - Intronic
947527329 2:230886639-230886661 TCCTGGGGCCCTGTTCCCTGTGG + Intergenic
947791810 2:232872995-232873017 TCCTGGGGCCCTGGCCGCTTGGG + Intronic
948487363 2:238289226-238289248 TCCCGCGGCCCTGGCCGCTGGGG - Intronic
1169210883 20:3765740-3765762 CCCTAGGGACCTGGCTGCTTTGG - Intronic
1170909698 20:20553425-20553447 TCCTGTGGTCCTGGCTACTTGGG + Intronic
1171426277 20:25050703-25050725 TCCTGGTGCCCTGGCTGCTGTGG - Intronic
1172074824 20:32287444-32287466 ACCTGTGGCCCTGGCTGCTTAGG - Intronic
1175443916 20:59007570-59007592 TCCTGGGGCCCTGAGCCCTGGGG + Intergenic
1175926099 20:62472336-62472358 TCCTGGGGCCCTGGGCTGTGGGG - Intronic
1176044354 20:63084585-63084607 AGTTGGGGCCCTGGCAGCTTCGG + Intergenic
1176114292 20:63424362-63424384 TCCTGGGGCCGTGGGCTCTCTGG - Intronic
1176246111 20:64097903-64097925 TCCTGGGCTTCTGGCCGTTTGGG + Exonic
1178428579 21:32499348-32499370 TCCTGGGACCCTGGCAGCTCCGG - Intronic
1178669781 21:34580362-34580384 TCCTGAGGCCCTGGCTGATATGG + Intronic
1179397845 21:41057517-41057539 TCCTGTGTCCCTGGCAGCTGGGG + Intergenic
1180128294 21:45806701-45806723 GCCTGGGTCCCTGGCCCTTTGGG - Intronic
1180148558 21:45935684-45935706 TCCATGGGCCCTGGCCCCTCAGG + Intronic
1181458181 22:23071037-23071059 TCCTCGGGCCCAGGCCTCTGGGG - Intronic
1181531084 22:23517874-23517896 TCCTAGGGCCCTGGGCACTTGGG + Intergenic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1184811144 22:46833018-46833040 TTCTGAGGCCCTGTCCGCCTGGG + Intronic
1185110465 22:48897611-48897633 GCCTGGGGTCCTGGCCACTTTGG + Intergenic
1185266779 22:49908179-49908201 TCCTGTGGCCCTTGCTGCCTTGG - Intronic
950125109 3:10505870-10505892 TCCTGGGACTCTGCCAGCTTCGG - Intronic
953179689 3:40584026-40584048 TCCACCAGCCCTGGCCGCTTTGG - Intergenic
954133926 3:48573381-48573403 TCCAGGAGCCCTGGCCACGTGGG - Intronic
954388979 3:50259143-50259165 GCCTGGGGCCAGGGCCGCTGGGG - Exonic
954817906 3:53298091-53298113 ACCTGTGGTCCTGGCTGCTTGGG + Intronic
955211064 3:56941330-56941352 TCCTGGGACCCCAGCTGCTTGGG - Intronic
961007107 3:123412457-123412479 CCCTGCAGCCCTGGCCCCTTTGG - Intronic
961017530 3:123479375-123479397 TCCTGGGCCCCTGAGCGCCTGGG + Intergenic
961879753 3:130053066-130053088 TCCTGGGACCATGGCAGCTTCGG + Intergenic
962677501 3:137767885-137767907 GTCTGGGGGCCTGGGCGCTTAGG + Intergenic
963149654 3:142032226-142032248 ACCTGTGGTCCTGGCTGCTTGGG - Intronic
965418521 3:168427192-168427214 GCCTGGGGCCTTGGCCACTCAGG - Intergenic
966849494 3:184155820-184155842 TCCGGGAGCCCCGGCCGCTCTGG + Intronic
968229079 3:196994033-196994055 TTCTGCTGCCCTGGCCCCTTGGG - Intronic
968284211 3:197498860-197498882 ACGTGGGGCCCTGGTCGCTGAGG - Intergenic
968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG + Intronic
968665880 4:1822145-1822167 TTCTGGGGCCCTGGAGGCTGAGG - Intronic
968711713 4:2124389-2124411 TCCTGTAGTCCTGGCTGCTTGGG - Intronic
968945597 4:3661954-3661976 TCCTGGGGCCCAGGCTGCAGAGG + Intergenic
968991958 4:3920175-3920197 TCCTGGGACCATGGCAGCTTCGG + Intergenic
969027983 4:4189744-4189766 CCCTGGGCCCCTTGCCGCATAGG - Intronic
969353934 4:6614226-6614248 TGCTGGGGTCCTGGGAGCTTCGG - Exonic
969823381 4:9737504-9737526 TCCTGGGACCATGGCAGCTTTGG - Intergenic
970191415 4:13522786-13522808 CCCTGGGGCTCTGAGCGCTTTGG - Intergenic
976717768 4:88141232-88141254 TCCTCATGTCCTGGCCGCTTTGG - Intronic
984929602 4:184835084-184835106 TCCTGGGGTCCTGCCCCCATAGG - Intergenic
995662385 5:114499696-114499718 CCCTGGGGGCCTGGCCAGTTAGG + Intergenic
999007301 5:147996856-147996878 TCCGGGGCCTCTGACCGCTTTGG + Intergenic
999133623 5:149302667-149302689 CCCTGGGCACCTGGCCTCTTCGG + Intronic
1001564410 5:172690111-172690133 CCCTGGAGCCCTGGCTGCTGTGG - Exonic
1002045880 5:176541662-176541684 TGCTGGGGCCCTGCCCGACTAGG + Intergenic
1002521361 5:179794740-179794762 TCCTGCAGCCCTGGCACCTTTGG - Intronic
1002702333 5:181133332-181133354 TCCTGGGGTCCTAGCTGCTCAGG - Intergenic
1003165169 6:3671212-3671234 TGCTGGGGTCCTGGCTGCATGGG + Intergenic
1003426939 6:6003784-6003806 TCCCGGCGCCCGGGCTGCTTTGG - Intronic
1006677977 6:35777354-35777376 TCCTGGATCCCTGGGCTCTTTGG + Intronic
1011443053 6:87408024-87408046 TCCTGGGGCCCTCACCGCGACGG - Exonic
1014722453 6:124934484-124934506 TCATGGTGGCCTGGTCGCTTGGG - Intergenic
1014749272 6:125236847-125236869 CCCTGGGGCCTTGGCCACTTGGG - Intronic
1017830096 6:158118977-158118999 TGCTGGGGCCCTGGTTGCTGGGG - Intronic
1019488114 7:1298806-1298828 CGCTGGTGCCCTGGCCGCCTTGG + Intergenic
1019519065 7:1452491-1452513 TTCCGGGGACATGGCCGCTTTGG - Intronic
1020314778 7:6897745-6897767 TCCTGGGACCATGGCAGCTTCGG + Intergenic
1022814926 7:33904948-33904970 CCCTGGGGCCCTGGCCTCCCTGG + Exonic
1023184428 7:37518148-37518170 TTCTGGGGCCTTGGCCTCTAAGG + Intergenic
1026024374 7:66733066-66733088 TCCTGGAGTCCTGGCCCCTAAGG + Intronic
1027213032 7:76165699-76165721 TCCTGGGGCCATGGCCACGGGGG - Intergenic
1032075492 7:128833928-128833950 GGCTGGGGCTCTGGCCGCCTGGG - Intronic
1032201950 7:129828537-129828559 TCCTGGGGTCCTGGCCACCAAGG - Intergenic
1032406023 7:131656055-131656077 GCATGGGGCCCTGGCCTCCTAGG - Intergenic
1033409053 7:141099778-141099800 ACCTGGGTCACTGGCCCCTTTGG + Intronic
1034354443 7:150441949-150441971 TCCTGGCCCACTGGCCTCTTGGG + Intergenic
1034484770 7:151352565-151352587 GCCTGTGGCCCTAGCTGCTTGGG - Intronic
1035414359 7:158670439-158670461 TCCTGTGGTCCTAGCCACTTGGG + Intronic
1037317062 8:17609094-17609116 CCCTGTGGTCCTGGCTGCTTGGG + Intronic
1037694774 8:21214072-21214094 TCCTGTGGTCCTGGCTGCTTGGG - Intergenic
1038773113 8:30502449-30502471 TCCTGTGGCCCAGGCCACTGGGG - Intronic
1040713248 8:50215124-50215146 TCCTGGGGCCCTGTCTCCTAGGG + Intronic
1046918292 8:119700299-119700321 TCCTGGGACCCAGGCTGCCTGGG - Intergenic
1047429654 8:124780266-124780288 GCCTGGGGCCCTGTGCGATTGGG + Intergenic
1048754331 8:137719377-137719399 TTCTGGGTCCCTGGCCGTTAAGG + Intergenic
1049319183 8:141986936-141986958 TCCTGAAGCCTTGGCCTCTTGGG - Intergenic
1049788234 8:144461539-144461561 TCCTGGAGCACTGGCTGCCTAGG + Intronic
1052768837 9:32668935-32668957 TCCTGGGGCCATTGCCTCTTGGG + Intergenic
1053344450 9:37367995-37368017 ACCTGTGGCCCTAGCTGCTTAGG + Intergenic
1055750655 9:79501144-79501166 TCCTGTGGCCCAGGCCACTGTGG - Intergenic
1060228223 9:121809016-121809038 TCCTGGGGCCCTGAGCCCCTGGG + Intergenic
1060571015 9:124640522-124640544 TCCTGTAGCCCTAGCCACTTGGG - Intronic
1061711096 9:132488610-132488632 TCCTGGGTCCCAGGTAGCTTCGG + Intronic
1062371119 9:136239305-136239327 TCCTGTGGCCCCAGCCACTTAGG - Intronic
1062431884 9:136530002-136530024 TCCTGGGGCCCTGGGAGCCAGGG - Intronic
1062447495 9:136601820-136601842 CGCCGGGGCCCTGGCCCCTTGGG + Intergenic
1062663193 9:137650789-137650811 GCCTGTGGCCCTGGCTACTTGGG - Intronic
1190463210 X:50699386-50699408 TCCTGGGGCTCTGACAGCTCTGG + Intronic
1191780457 X:64858651-64858673 ACCTGGGGCCCTGTCCACTTGGG + Intergenic
1196918321 X:120561412-120561434 TCCTGCGGACCTGGGGGCTTCGG - Intronic
1199086393 X:143634510-143634532 CCCCGCCGCCCTGGCCGCTTGGG + Intronic
1199973767 X:152879475-152879497 CCCTGGGGCCCTGGACGCAGAGG - Intergenic