ID: 947792055

View in Genome Browser
Species Human (GRCh38)
Location 2:232873976-232873998
Sequence CTGGAAAGGGGTTCTGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 209}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947792047_947792055 -3 Left 947792047 2:232873956-232873978 CCTCCTGCCAGAGGTCTTTTCTG 0: 1
1: 0
2: 1
3: 37
4: 330
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792039_947792055 21 Left 947792039 2:232873932-232873954 CCAATGGGCCTTCCACCCATGGG 0: 1
1: 0
2: 1
3: 7
4: 121
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792044_947792055 6 Left 947792044 2:232873947-232873969 CCCATGGGGCCTCCTGCCAGAGG 0: 1
1: 0
2: 1
3: 28
4: 235
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792051_947792055 -10 Left 947792051 2:232873963-232873985 CCAGAGGTCTTTTCTGGAAAGGG 0: 1
1: 0
2: 2
3: 13
4: 199
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792049_947792055 -6 Left 947792049 2:232873959-232873981 CCTGCCAGAGGTCTTTTCTGGAA 0: 1
1: 0
2: 2
3: 16
4: 187
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792042_947792055 13 Left 947792042 2:232873940-232873962 CCTTCCACCCATGGGGCCTCCTG 0: 1
1: 0
2: 1
3: 32
4: 276
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792043_947792055 9 Left 947792043 2:232873944-232873966 CCACCCATGGGGCCTCCTGCCAG 0: 1
1: 1
2: 2
3: 25
4: 321
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209
947792046_947792055 5 Left 947792046 2:232873948-232873970 CCATGGGGCCTCCTGCCAGAGGT 0: 1
1: 0
2: 1
3: 19
4: 260
Right 947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947792055 Original CRISPR CTGGAAAGGGGTTCTGCCTT GGG Intronic
900896241 1:5484856-5484878 CTGGTGAGGAGTTCTGCCCTAGG + Intergenic
904477990 1:30776867-30776889 ATGGGAAGGGGCTGTGCCTTGGG + Intergenic
905629046 1:39508687-39508709 CTGGCCAGTGGTTGTGCCTTTGG - Intronic
907736652 1:57119777-57119799 CTGGAAGGGGGTTTTGCTGTAGG - Intronic
909824050 1:80103443-80103465 TTTGAAAGAAGTTCTGCCTTGGG - Intergenic
912745219 1:112240233-112240255 TGGGAAAAGGGCTCTGCCTTTGG + Intergenic
916279035 1:163028318-163028340 CGGGAAAGGGGATCTGACTGTGG + Intergenic
920022808 1:202967897-202967919 CTGGATGGGAGTTCTGCCTAAGG + Intergenic
921066541 1:211626903-211626925 CTGGAAAGTGATGCTGCCTCCGG + Intergenic
921944137 1:220875027-220875049 GTTGAAATGGGTTCTGCCATAGG + Intergenic
922124518 1:222709700-222709722 CTGGAACATAGTTCTGCCTTAGG - Intronic
922454890 1:225766844-225766866 CTTGAGAGGGGCACTGCCTTAGG - Intergenic
1062842853 10:684648-684670 TTGGAATGGAGTTCTGCCCTCGG - Intronic
1064869978 10:19926587-19926609 ATGGAAAGGAATTCTGCATTTGG - Intronic
1065471646 10:26087830-26087852 CAGTAAAGTGGTTCTGGCTTTGG + Intronic
1066386887 10:34948634-34948656 CTGGCGAGGGGGTCAGCCTTGGG + Intergenic
1066450187 10:35521637-35521659 CTGCGAAGGGGATATGCCTTGGG + Intronic
1066454339 10:35560084-35560106 CTGGAGAGGAATTTTGCCTTAGG + Intronic
1066506339 10:36048715-36048737 TGGGACAGAGGTTCTGCCTTGGG - Intergenic
1066693946 10:38061448-38061470 CTGGCAAGGGGTTTTGCATTGGG - Intronic
1067150476 10:43728634-43728656 CTGGAATGAGGCTCTGCATTCGG - Intergenic
1067461198 10:46459992-46460014 CTGCAAAGGGGGTCTGGCATAGG - Intergenic
1067499056 10:46785947-46785969 CGGGAAAGGGGTTTTCCCTGAGG - Intergenic
1067625997 10:47924609-47924631 CTGCAAAGGGGGTCTGGCATAGG + Intergenic
1070839353 10:79472722-79472744 CTGGAAGGAGGGTCTGTCTTGGG + Intergenic
1071392109 10:85185770-85185792 CTGTAAAGGGTTTCTGACCTGGG - Intergenic
1071548733 10:86549387-86549409 CTGGAGAGGAATTTTGCCTTAGG + Intergenic
1072471800 10:95720161-95720183 GTGTAAGGGGGTACTGCCTTTGG + Intronic
1074228685 10:111512643-111512665 CTGGAAAAGGGTTCTGGGTCTGG + Intergenic
1074379904 10:112970829-112970851 CTGGAAACAGGTTCAGCCCTTGG + Intronic
1075465793 10:122649223-122649245 CTAGTAAGGGGTTCTGCCCTGGG + Intergenic
1077904576 11:6519967-6519989 AGAGAAAGGGTTTCTGCCTTGGG - Exonic
1078622097 11:12917685-12917707 GTGGAAAGGATTTCTGCTTTTGG + Intronic
1079364995 11:19801341-19801363 CTGGCAAAGGACTCTGCCTTTGG - Intronic
1081847020 11:46248031-46248053 CAGGAGAGGGTTTCTGACTTTGG + Intergenic
1084774417 11:71366046-71366068 TTGGAAAGGGCTCCTGACTTTGG + Intergenic
1089303733 11:117514137-117514159 CTGGGAAGGGGCTCTGGCATGGG - Intronic
1089606003 11:119641664-119641686 CTGGAATGGGGTTCCTCCTCTGG + Intronic
1090228372 11:125084988-125085010 CTGGAGAGTGCTCCTGCCTTGGG + Intronic
1092318692 12:7447527-7447549 CTGGAAAGGAATTTTGCCTCAGG + Intronic
1093911219 12:24749554-24749576 CTGGAAAAGCATTCTGGCTTAGG - Intergenic
1094091962 12:26660521-26660543 TTAGAAAGTGGTTTTGCCTTAGG + Intronic
1094614630 12:32025111-32025133 CTGGAAAGTCGTTCTACCCTTGG + Intergenic
1095769240 12:45933842-45933864 CTGTAAAAGGGTTCTTCTTTAGG + Intronic
1095784419 12:46093910-46093932 CTTGCCAGGGATTCTGCCTTTGG + Intergenic
1100593574 12:96052263-96052285 TTGGAAAGGAATTTTGCCTTAGG + Intergenic
1101186252 12:102283860-102283882 CTGGTAAGGGGTCCTCCATTAGG - Intergenic
1101946210 12:109139531-109139553 CTGGAAAGGGCTCCTGGCTCGGG - Exonic
1101946576 12:109141845-109141867 CTGGAGTGGGGTTCAGTCTTTGG + Intronic
1105698531 13:22915519-22915541 GTGGAAAGGGGTTCGGGCTTAGG + Intergenic
1105981190 13:25518091-25518113 CTGGGAAGGGCTTTTGCATTTGG + Intronic
1106770194 13:32954280-32954302 ATGGAAAGTGGCTCTGCCCTCGG + Intergenic
1108294453 13:48999436-48999458 CTGGAAAGGAATTTTGCCTCAGG + Intronic
1112196411 13:97230793-97230815 CTGGCAAGGGTTTCTGGCTGTGG + Intronic
1112601271 13:100857896-100857918 CTGGAACGGGGTTGTGCGTGAGG + Intergenic
1112948845 13:104964514-104964536 ATGGAAAATGGTTCTACCTTTGG - Intergenic
1113382113 13:109813631-109813653 CTGGAATGGGTTTCTTACTTGGG + Intergenic
1113659722 13:112097441-112097463 CTGGAAAGAGCTTCTGATTTTGG + Intergenic
1114826424 14:26086297-26086319 TTAGAAGGGGCTTCTGCCTTTGG - Intergenic
1115398903 14:32937680-32937702 CTGAAAAGGGGTCCTCCATTCGG - Intronic
1115490152 14:33950926-33950948 CGGGAGAAGGGATCTGCCTTCGG + Exonic
1117412792 14:55466001-55466023 CTGGAAATGGATGCTGCCATGGG - Intergenic
1120117588 14:80637925-80637947 CAAGAAAAGGGTTCTCCCTTAGG + Intronic
1120713308 14:87815478-87815500 CTGGAGAGGGGTTCAGCCACTGG + Intergenic
1120910831 14:89665221-89665243 CTGGAAAGGGGGTATGTCCTTGG + Intergenic
1121221597 14:92289368-92289390 CTTAAATGGGATTCTGCCTTAGG + Intergenic
1121753596 14:96381493-96381515 CTGGATTGGGGTTCTGCTCTAGG - Intronic
1122480258 14:102042613-102042635 CTGGAACGGCGCTCTCCCTTAGG + Exonic
1124176750 15:27433195-27433217 CTGGAGTGGGGTTCCGCCTTTGG - Intronic
1127550960 15:60037970-60037992 CAGGAAGGGAGCTCTGCCTTGGG - Intronic
1128231160 15:66036328-66036350 CTGCACACTGGTTCTGCCTTTGG + Intronic
1129115512 15:73363342-73363364 GGGGAAAGGGGTTCTCCCTTGGG - Intronic
1129220567 15:74129515-74129537 CAGGAAAGGGGTTCAGGCTCCGG - Exonic
1129908277 15:79205247-79205269 CTGGAAAGGGGCTCAGCACTCGG + Intergenic
1129914259 15:79254428-79254450 CAGGAAAGGGCTTCTCCCATGGG + Intergenic
1130849064 15:87776387-87776409 CTGGAAAGGGGTTAGGCCGCAGG + Intergenic
1131126066 15:89858115-89858137 CTGGAAAAGGGTTCTTAGTTAGG + Intronic
1133054346 16:3138122-3138144 GGGGGATGGGGTTCTGCCTTTGG + Intronic
1139000761 16:62506913-62506935 CTGGAAAGGAATTCTGCATCAGG + Intergenic
1139130503 16:64137477-64137499 TGGGAAAGGCATTCTGCCTTTGG + Intergenic
1140782124 16:78306479-78306501 CTGCACAGGGGGCCTGCCTTTGG - Intronic
1141532880 16:84658891-84658913 CTGGAAAGGGTCCCTGGCTTTGG + Intronic
1142914853 17:3127968-3127990 CTGGAAAGGGGTTTTGGAATTGG + Intergenic
1147460494 17:40565174-40565196 CTGGAGAAGGGGTCAGCCTTTGG - Intronic
1147744332 17:42685951-42685973 CTGGATAGGGCTGCTGCCTGAGG - Exonic
1148043943 17:44730871-44730893 CTGGTGAGGGGTTATGTCTTGGG - Intronic
1151341639 17:73475053-73475075 CTGGAAATTGGTCCAGCCTTTGG + Intronic
1152047154 17:77944690-77944712 CTGGAGACAGGTTCTGCCCTTGG - Intergenic
1152869127 17:82742357-82742379 CTGCTAATGGGTTCTGCTTTAGG - Intronic
1156508549 18:37615651-37615673 CTGGAAAGGGGTTTTTACTGGGG - Intergenic
1157992401 18:52512652-52512674 CAGGACAGGGCTTCTGCCTATGG - Intronic
1159945112 18:74438917-74438939 CTGGAAAGTGGGTCTCCCCTTGG + Intronic
1161116519 19:2499984-2500006 ATCTAAAAGGGTTCTGCCTTTGG - Intergenic
1162638609 19:11989293-11989315 CTGGAAACAGCTTGTGCCTTCGG + Intergenic
1163364392 19:16868056-16868078 ATGGAATGGGGTTCTGACTTTGG - Intronic
1163421202 19:17214630-17214652 CTGGGAAGGGGTTCTCCATGGGG + Intergenic
1163554543 19:17984632-17984654 CTGCAAAGAGGTTCTGCCTGTGG - Intronic
1164173678 19:22749309-22749331 GTCTAAAGGGGTACTGCCTTTGG - Intergenic
1165127913 19:33613774-33613796 CTGGAAAGGGGGTGTCCCCTGGG + Intergenic
1166255212 19:41599390-41599412 CTGGGAAGTGCTTCTGCCCTGGG + Intronic
1166281378 19:41796535-41796557 CTGGAAAGTGCTCCTGCCCTGGG + Exonic
1166592337 19:44010893-44010915 GTGGTAAGAGCTTCTGCCTTAGG + Exonic
1167862689 19:52297817-52297839 CTGAAAAGGTGTTCTGCTTGTGG + Intronic
929677227 2:43948805-43948827 CAGGAAAGGGGTAAGGCCTTGGG - Intronic
929961767 2:46502547-46502569 CTGGTAACGTGTTCTGCCCTTGG + Intronic
930745122 2:54874908-54874930 ATGGACCTGGGTTCTGCCTTTGG - Intronic
932847757 2:75152786-75152808 CTGCTAAGGGGTTGTTCCTTAGG + Intronic
936351644 2:111717137-111717159 CTGGGAAGAGGTTCTGCCCAGGG + Intergenic
937255868 2:120555130-120555152 CTGGATAGTGGTTCTGGCTAGGG + Intergenic
938317703 2:130341630-130341652 CTGGGAAGGGGTTCTGCAGAAGG + Intronic
938709476 2:133963696-133963718 CGGGAATGTGGTTTTGCCTTTGG - Intergenic
939932782 2:148255230-148255252 CTGCCAAGGGCTTCTGCCCTGGG + Intronic
940150832 2:150598641-150598663 CTGGCAAGAGGTGCGGCCTTTGG - Intergenic
940176473 2:150882822-150882844 CTTGTCAGTGGTTCTGCCTTGGG - Intergenic
941806122 2:169713504-169713526 CTGCCAAGGGCTTCTGCCCTGGG + Intronic
942313410 2:174676964-174676986 GTGGAAATGGGGTCTCCCTTTGG - Intronic
946908175 2:224435990-224436012 CTGTAAAGTGGTTCTGCCCTGGG - Intergenic
947249845 2:228089910-228089932 CTGGTAAGGCCTTCTGCCTCTGG - Intronic
947670008 2:231929960-231929982 CTGGAGAGGGGCCCTTCCTTGGG + Intergenic
947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG + Intronic
948776621 2:240292383-240292405 CTGGCAATGGGGTCTGCCTGGGG + Intergenic
1168741275 20:193449-193471 GTGTAAGGGGGTACTGCCTTTGG + Intergenic
1170599101 20:17827570-17827592 CTTGAAAAGGGTTTTGTCTTTGG + Intergenic
1174326352 20:49781823-49781845 CTGGCTCTGGGTTCTGCCTTGGG + Intergenic
1175690267 20:61060304-61060326 CTGGAACTGGGAGCTGCCTTTGG - Intergenic
1178035997 21:28583373-28583395 CTTGAAGGGGTTTCTGGCTTGGG - Intergenic
1178881757 21:36455541-36455563 CTTGAAACGGGCTCTGCCCTTGG + Intergenic
1179198586 21:39191201-39191223 CTGGAAAAGGGGTTTGCCATTGG - Intronic
1179880430 21:44291313-44291335 ATGGAAAGGGGTTCTGAGTCAGG + Intronic
1180590178 22:16930718-16930740 CTGGAGAGGGGCTCTGCTTAAGG - Intergenic
1180845625 22:18979875-18979897 CTGCTAATGGGTTCTGCTTTAGG + Intergenic
1180910162 22:19444303-19444325 CTGGAGGGGGGCTCTGCCTCGGG + Exonic
1181036053 22:20170216-20170238 CTGGACAAGGGTTCTGCATGAGG - Intergenic
1182428394 22:30286634-30286656 CTGGAAAGGGATCCAGCTTTGGG + Intronic
1183074064 22:35415645-35415667 CTGGAAGGGGATGCTGCCCTGGG - Intronic
1183664698 22:39240540-39240562 CTGAAAAGGGGGGCTGCCCTCGG + Intronic
1184222923 22:43111958-43111980 GTGGAAAGAGGTTTTGGCTTGGG - Intronic
1184679565 22:46062975-46062997 CTGGGTAGGGGTCCTGCCGTGGG + Intronic
950205489 3:11076990-11077012 CTGGAAAGGGGTCAAGTCTTTGG + Intergenic
950769972 3:15303491-15303513 GTGGAAATGGGTTCTGGTTTAGG - Intronic
953742267 3:45547895-45547917 CTGGGAAATGGCTCTGCCTTAGG + Exonic
954199036 3:49013346-49013368 CTCGACAGGACTTCTGCCTTAGG - Exonic
954480730 3:50797499-50797521 CTGGAAAGGTGCTGCGCCTTAGG - Intronic
954937427 3:54339354-54339376 GGTGAAAGGGGTTCTACCTTAGG - Intronic
957230783 3:77511298-77511320 CTTGAAAGGAGTTCTGGTTTAGG + Intronic
959505510 3:107152466-107152488 TGGGAAAGGGGTTGTGACTTTGG - Intergenic
959979921 3:112504488-112504510 CAGGAAAGGGGATTTGCTTTTGG + Intergenic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
961110615 3:124280175-124280197 CTGGAAGGGAGTTCTGCCATGGG - Intronic
961418934 3:126784387-126784409 CTGACAAGGGGGTCTGCCCTGGG - Intronic
962387169 3:134941028-134941050 CTGGAAAGGGGCACTTCCTCTGG - Intronic
962631867 3:137284761-137284783 TTGGAAAGGTGTTCTTACTTAGG + Intergenic
967419864 3:189260946-189260968 CTTGAAAGGGCTTCTGCTCTGGG + Intronic
968729725 4:2263972-2263994 CTTGTGAGGGGCTCTGCCTTGGG - Intergenic
968904555 4:3445359-3445381 CTGGCGGGGGGTGCTGCCTTGGG + Intronic
968975346 4:3819479-3819501 CTGGAGAGGAATTTTGCCTTAGG - Intergenic
969249746 4:5959246-5959268 GTGGCAAGTGGTTTTGCCTTCGG - Exonic
977981141 4:103323642-103323664 TTGGAAAGAAGTTCTACCTTGGG - Intergenic
978944034 4:114472665-114472687 CCGCAAATGGCTTCTGCCTTAGG - Intergenic
985479195 5:97098-97120 CAGGTAAGGGGTTTTGACTTTGG - Intergenic
985479202 5:97151-97173 CAGGTAAGGGGTTTTGACTTTGG - Intergenic
985479221 5:97257-97279 CAGGTAAGGGGTTTTGACTTCGG - Intergenic
985479229 5:97310-97332 CAGGTAAGGGGTTTTGACTTTGG - Intergenic
985479237 5:97363-97385 CAGGTAAGGGGTTTTGACTTCGG - Intergenic
986880318 5:12161855-12161877 CTGGAGAGAAGTTTTGCCTTAGG + Intergenic
986940020 5:12937842-12937864 CTGCTAAGGGCTTCTGCCCTGGG - Intergenic
989800864 5:45537152-45537174 CTGTAATAGGGTACTGCCTTAGG + Intronic
991139773 5:63226713-63226735 CTGCAATGGGGTTTTGCATTGGG + Intergenic
991407832 5:66319350-66319372 CTTGATTGGGGATCTGCCTTGGG - Intergenic
992537863 5:77729348-77729370 CTGGAAAAGTGTTCTCCATTAGG + Intronic
994991614 5:107003943-107003965 GTGGACATGGGTTCTGCCTTTGG + Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
999050528 5:148519464-148519486 CTGGAGTAGGTTTCTGCCTTGGG + Intronic
999776701 5:154817714-154817736 CTCGGCAGGGGTTCTGCCATTGG + Intergenic
1002055855 5:176597565-176597587 CTGGACACGGGCTCGGCCTTCGG + Exonic
1003976781 6:11352075-11352097 CTGGAAAGGGACCCTGCCTGTGG - Intronic
1008627021 6:53326749-53326771 CTGGAAAGCAGTTTTGCCCTAGG + Intronic
1011652745 6:89522055-89522077 CTGGCAAGGAGTTCTTCCTTGGG - Intronic
1013994351 6:116290827-116290849 CTGGAAAAAGTTTCTCCCTTTGG - Intronic
1014116770 6:117675537-117675559 GTGGAAAGGGGTTCGGGCTCGGG + Exonic
1015156619 6:130103551-130103573 CTGGAAATGGTTTGGGCCTTAGG - Intronic
1015903830 6:138095897-138095919 CTGAAATGGTGTTCTGCCGTGGG - Intronic
1018754820 6:166839780-166839802 CCAGAAATGGGTTCTCCCTTGGG + Intronic
1019012626 6:168854121-168854143 CCGGAAAGAGGTTGTTCCTTTGG - Intergenic
1023255083 7:38305098-38305120 GTGGAAAGGGGTGCTGGTTTGGG + Intergenic
1023334535 7:39154614-39154636 CTAGAAAGTGGTTCTACCTGCGG - Intronic
1023684736 7:42722748-42722770 TTGGAAAGGGTTCTTGCCTTTGG - Intergenic
1026640516 7:72120575-72120597 CTGAAAAGTGTTTCTGCCCTTGG - Intronic
1028146299 7:87323456-87323478 CTGGAAAGGGGCACTGCATGGGG + Intergenic
1030688976 7:112513509-112513531 CTGGGAAGGTGTTCTTTCTTAGG - Intergenic
1031515050 7:122690248-122690270 CTGCCAAGGGCTTCTGCCCTGGG + Intronic
1033601711 7:142893389-142893411 CTGGAAAAGAATTCTGCTTTGGG - Intergenic
1033929470 7:146505411-146505433 CTGCAAAGGACTTCTGCCCTGGG + Intronic
1034960259 7:155360338-155360360 CAGGACAGGGGTTCTGACTGTGG - Intronic
1035968891 8:4225658-4225680 CAGGAAAGTGGTGATGCCTTAGG + Intronic
1037686215 8:21141745-21141767 CTGGAAAAGTATTCAGCCTTGGG - Intergenic
1038335069 8:26639393-26639415 TTGGGAAGGAATTCTGCCTTTGG - Intronic
1039450058 8:37665647-37665669 CTTGGAAGTGGTTCTGGCTTGGG - Intergenic
1041173889 8:55173192-55173214 CTGGAAAGGGGGCCTGCCAAGGG - Intronic
1046198229 8:110890623-110890645 CTGCCAAGGGCTTCTGCCCTGGG + Intergenic
1046645743 8:116783682-116783704 CTGGAGAGGGCAGCTGCCTTGGG - Intronic
1046755236 8:117966210-117966232 TTGGAATGGGATGCTGCCTTGGG - Intronic
1048933457 8:139335893-139335915 CTGGGAAGGGCTTGTGCCTTGGG - Intergenic
1049193123 8:141299888-141299910 CTGGAAAGGGGATCCTCCATTGG - Intronic
1050567533 9:6901677-6901699 AGGGAAAGGGGCTCTGCCTGTGG + Intronic
1050652187 9:7787430-7787452 CTGCCAAGGGCTTCTGCCCTGGG + Intergenic
1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG + Intronic
1052246119 9:26337435-26337457 TGGTAAAGGGGATCTGCCTTGGG - Intergenic
1052730185 9:32276294-32276316 CTGGAGAGGAATTTTGCCTTAGG - Intergenic
1054958714 9:70943001-70943023 ATGGAAAGGAGTTTTGTCTTTGG + Intronic
1057498957 9:95581760-95581782 CGAGGAAGGGGTCCTGCCTTTGG + Intergenic
1059771942 9:117434872-117434894 GGGCAAAGGGCTTCTGCCTTTGG + Intergenic
1060922693 9:127433455-127433477 CAGGAAATGATTTCTGCCTTAGG + Intronic
1062049957 9:134442163-134442185 CTGGAAAAGGGGTCGGCCCTGGG + Intergenic
1062356698 9:136168256-136168278 CTGGAAAGGGTTTGATCCTTCGG + Intergenic
1187483993 X:19684759-19684781 TTGGAAAGGGATTCAGCTTTGGG - Intronic
1189650232 X:43181000-43181022 CTGTAATGGGGTTTTGCATTTGG - Intergenic
1190099780 X:47513594-47513616 GTGGAAAGGGGTTCGGGCTCGGG - Intergenic
1190781852 X:53604486-53604508 CTTGAAAGGAGGTCTGCCTGAGG - Intronic
1193042478 X:77018020-77018042 CTAGAAAATGGTACTGCCTTGGG + Intergenic
1194698919 X:97090359-97090381 CTAGAAAGGGGTGCTCCCCTAGG + Intronic
1199510994 X:148622384-148622406 CAGGAAAGAAGTTCTGCCTCCGG - Intronic