ID: 947792947

View in Genome Browser
Species Human (GRCh38)
Location 2:232878138-232878160
Sequence ACTTTGTAGCGTCTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947792947_947792952 9 Left 947792947 2:232878138-232878160 CCTGTGGGAAGACGCTACAAAGT 0: 1
1: 0
2: 1
3: 2
4: 67
Right 947792952 2:232878170-232878192 TCTAAACCAGAGGCCTGTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 113
947792947_947792955 18 Left 947792947 2:232878138-232878160 CCTGTGGGAAGACGCTACAAAGT 0: 1
1: 0
2: 1
3: 2
4: 67
Right 947792955 2:232878179-232878201 GAGGCCTGTTCTGGCGAGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 137
947792947_947792954 17 Left 947792947 2:232878138-232878160 CCTGTGGGAAGACGCTACAAAGT 0: 1
1: 0
2: 1
3: 2
4: 67
Right 947792954 2:232878178-232878200 AGAGGCCTGTTCTGGCGAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 144
947792947_947792949 -1 Left 947792947 2:232878138-232878160 CCTGTGGGAAGACGCTACAAAGT 0: 1
1: 0
2: 1
3: 2
4: 67
Right 947792949 2:232878160-232878182 TCCCACTGGATCTAAACCAGAGG 0: 1
1: 0
2: 1
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947792947 Original CRISPR ACTTTGTAGCGTCTTCCCAC AGG (reversed) Intronic
904970176 1:34413358-34413380 ACTTTGGAGATTCTTCCCAGAGG - Intergenic
907684821 1:56600372-56600394 ACTTTAAAACGTCTTCCCTCTGG - Intronic
907911336 1:58829269-58829291 TCTCTGTAGCTTCTACCCACCGG - Intergenic
909149345 1:71981325-71981347 ACCTTCTAGCGTCCTCCTACTGG - Intronic
918453568 1:184684678-184684700 ACTTTGCAGCCTCGTCCCTCGGG + Intergenic
922291310 1:224211056-224211078 ACCCTGTACCCTCTTCCCACTGG + Intergenic
924361969 1:243251107-243251129 ACTATATAACTTCTTCCCACTGG - Intronic
924592867 1:245420110-245420132 ACTTTGTAGAGGCATCCCTCTGG + Intronic
924716281 1:246577315-246577337 CCTTTATAGCCTCTTCCTACTGG + Intronic
1084494312 11:69495265-69495287 GCTTTGTGGCAACTTCCCACTGG - Intergenic
1096761228 12:53843666-53843688 ACTTTGACCCCTCTTCCCACTGG - Intergenic
1101820205 12:108178227-108178249 TCTTCATAGCGTCTTCCCTCTGG + Intronic
1102161995 12:110776736-110776758 ACTTTGCATACTCTTCCCACTGG - Intergenic
1102446453 12:113006703-113006725 ACTTTGGAGAATCTGCCCACTGG + Intronic
1105573419 13:21625719-21625741 AGTTTGAAGCGCCTACCCACTGG - Intergenic
1109572903 13:64215930-64215952 GCTTTTTAGCTTCTTCGCACTGG + Intergenic
1110335308 13:74323305-74323327 TCTTTTTAGTGTTTTCCCACTGG + Intergenic
1119322099 14:73738423-73738445 TCTTTGTACTGTTTTCCCACAGG + Intronic
1120830885 14:88996476-88996498 ACTTTGCAGGGACTTCCCATAGG - Intergenic
1124831137 15:33150659-33150681 ACATTGAAGAGTCTTCCAACTGG + Intronic
1134434160 16:14239936-14239958 ACTTGGTAGTGTGTTCACACGGG + Intronic
1134780597 16:16891766-16891788 CCTTTGTAGCCTCTCACCACTGG - Intergenic
1141104877 16:81225310-81225332 ACTCTGAGGCGTGTTCCCACCGG + Intergenic
1144097579 17:11915565-11915587 ACTTTCTAGTGACTTCCCACTGG + Intronic
1160248634 18:77181791-77181813 ACTTTCTTGCCTCTTCCCAGTGG + Intergenic
1161046566 19:2138161-2138183 CCTTTGTCTCGTCCTCCCACGGG + Intronic
1162175543 19:8827465-8827487 ACTCTTTAGTGTCTTCCCACTGG + Intronic
1167004037 19:46763874-46763896 ACTATGTAGCGTCTTGCATCTGG - Intronic
938112342 2:128577347-128577369 GCTTTGTAGCATCTTCCCCGGGG + Intergenic
938728316 2:134126123-134126145 ACTTTGTGGAATCTTCCCATTGG + Intronic
938927437 2:136057184-136057206 ACTTTGTAGCGACTATTCACAGG + Intergenic
941446858 2:165611822-165611844 ACTTTGAAGCGTCTACAGACAGG - Intronic
944159689 2:196645155-196645177 ACTTTGTATCTTCTTCCCACAGG - Intronic
947792947 2:232878138-232878160 ACTTTGTAGCGTCTTCCCACAGG - Intronic
1170576261 20:17663861-17663883 ACCTTGTAGGGTCTGACCACAGG + Intronic
1171151738 20:22833556-22833578 ACTTTTTAGTGTTTTCCCAAAGG + Intergenic
1173015463 20:39221236-39221258 ACACTGTAAAGTCTTCCCACTGG + Intergenic
1175265833 20:57703080-57703102 GCTTTGTAGTGTCATCCAACGGG + Intronic
1180865649 22:19117880-19117902 ACTTTGTAGAGTTTGTCCACTGG - Intronic
1181549344 22:23628030-23628052 TCTGTGTTGTGTCTTCCCACAGG - Intronic
1181799273 22:25333850-25333872 TCTGTGTTGTGTCTTCCCACAGG + Intergenic
964034805 3:152182702-152182724 AATTTGTAGGGTCATCCCAGAGG - Intergenic
964184650 3:153928079-153928101 CCTTTGAAGACTCTTCCCACAGG - Intergenic
964300711 3:155282280-155282302 ACTCTCTAGAGTTTTCCCACTGG - Intergenic
965381320 3:167992375-167992397 ACTTTGTAGCTAGTTCCCAAAGG + Intergenic
969704321 4:8783789-8783811 ACTTGGTAGCTTCTGCCCTCGGG - Intergenic
971789448 4:31149588-31149610 ACTATTAAGCATCTTCCCACAGG - Intergenic
978194336 4:105953376-105953398 ACTTTGTAGATTCTTCCTATGGG + Intronic
980585243 4:134805438-134805460 ACTTTGTAGGGCCAACCCACTGG - Intergenic
982822325 4:159956778-159956800 AATTTCTTGCGTCTTTCCACAGG - Intergenic
982981325 4:162140263-162140285 ATTTTCTAGGGTATTCCCACAGG - Intronic
995088032 5:108138559-108138581 TCTTTGTCCCCTCTTCCCACCGG - Intronic
995134709 5:108668526-108668548 TATATGTAGCATCTTCCCACTGG + Intergenic
1004527552 6:16423553-16423575 ATTTTGCAGCTTCTTGCCACTGG + Intronic
1014682941 6:124455938-124455960 AGTGTGTAGTGACTTCCCACAGG + Intronic
1018974948 6:168557112-168557134 AATTTGTATCGTTTTCCCATAGG - Intronic
1024037218 7:45517594-45517616 ACCTTGTAGCATTATCCCACAGG - Intergenic
1034322853 7:150201041-150201063 ACTTTCTAGCTTATTCCCTCTGG + Intergenic
1034770332 7:153768082-153768104 ACTTTCTAGCTTATTCCCTCTGG - Intergenic
1037189093 8:16100191-16100213 ACTTTTTAGAGTCTACCTACAGG - Intergenic
1037695896 8:21223665-21223687 ACATTGTAATGTCTGCCCACTGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1047868396 8:129055113-129055135 ACTATGTAGCATCTTCTCTCTGG - Intergenic
1048882770 8:138884023-138884045 ACTTTCTAGCCATTTCCCACAGG + Intronic
1050429270 9:5545338-5545360 TCTTTGTAGCTTCTACCCATTGG - Intronic
1056453261 9:86736973-86736995 CCTATGTATCCTCTTCCCACAGG - Intergenic
1185545305 X:938552-938574 ACTTTCTTGGGTCCTCCCACCGG - Intergenic
1191786614 X:64923297-64923319 ACTTTGTAGCCCTTTCCCAGAGG - Intronic
1195419565 X:104658678-104658700 ACTTTTCAGTGGCTTCCCACTGG - Intronic
1195739927 X:108053456-108053478 TCTTTGTAGAGTTTTCCCAGTGG - Intronic
1199898013 X:152143083-152143105 ACTCTGTAGCCTTTTCCAACTGG + Intergenic