ID: 947793571

View in Genome Browser
Species Human (GRCh38)
Location 2:232880880-232880902
Sequence GGCTGGGCCCACTGCGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947793561_947793571 15 Left 947793561 2:232880842-232880864 CCAGGGCCAGGGGAGGGGGACAC 0: 1
1: 0
2: 21
3: 98
4: 647
Right 947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 202
947793562_947793571 9 Left 947793562 2:232880848-232880870 CCAGGGGAGGGGGACACGAAGCC 0: 1
1: 0
2: 1
3: 32
4: 249
Right 947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947793571 Original CRISPR GGCTGGGCCCACTGCGAAGG AGG Intronic
900912748 1:5613367-5613389 GGCATGGCCCTCTGTGAAGGGGG - Intergenic
901771221 1:11531330-11531352 GGCTGGCCCCACAGCCAATGTGG + Intronic
902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG + Intergenic
902938308 1:19780686-19780708 AGCTGAGCCCACTGCAGAGGGGG - Exonic
902944147 1:19822145-19822167 GCCTGGGCCAAGTGCAAAGGTGG - Intergenic
904042212 1:27591480-27591502 GGCAGGGCCTAATGCTAAGGGGG - Intronic
904817528 1:33216811-33216833 GGATGGGCCCCCTGTGCAGGTGG + Intergenic
905209694 1:36365517-36365539 GGCTGGGCCTTCTGCCAAAGAGG + Intronic
905351046 1:37346670-37346692 GGCAGGACCCACTGAGAAGGTGG + Intergenic
906107562 1:43304056-43304078 GGCTGGGCCCAGAGCCAGGGAGG - Intronic
906482249 1:46206804-46206826 TGCTTGGCCCAGTGCTAAGGAGG - Intronic
906656131 1:47549614-47549636 ACCTGAGCCCACTGCAAAGGCGG - Intergenic
907159571 1:52360468-52360490 GGCTGCGGCCAGTGCCAAGGAGG - Exonic
907554578 1:55333446-55333468 GGCTTGGCCCAGTGAAAAGGAGG + Intergenic
915458914 1:156058085-156058107 GGCTGGGCCCAGGGCTATGGAGG - Intronic
915490439 1:156247423-156247445 GGCTGGGCCAGCTGGGCAGGCGG + Intronic
916022204 1:160802384-160802406 GGCTCAGCCCACTGCGTGGGAGG + Intronic
916572606 1:166040541-166040563 ACCTGGGCCCACTGAGAGGGTGG + Intergenic
919709280 1:200710299-200710321 GCCTGGGCCCTCTGAGAAGAAGG + Intergenic
922534964 1:226372891-226372913 GGGTGGGCTCACTGAGAATGAGG - Intronic
924800079 1:247322962-247322984 GGCTGGGACCACAGGGAAGGAGG + Intronic
924957720 1:248945176-248945198 GGCTGAGGGCACTGCGAGGGCGG + Intergenic
1063376620 10:5558097-5558119 GGCTGGGCTCATCGGGAAGGAGG + Intergenic
1063376633 10:5558132-5558154 GGCTGGGCTCATCGGGAAGGAGG + Intergenic
1063564471 10:7160985-7161007 GGCTGGGACCACTGCACAGGAGG - Exonic
1065636783 10:27742685-27742707 GGCTGGGCCCGCGGCGAACCCGG - Intronic
1065963948 10:30755580-30755602 GGATAGGCCCACTGGGAAGCAGG - Intergenic
1070311262 10:75275741-75275763 GGCTGGGGCCCCTGTGAAGAAGG + Intergenic
1070801651 10:79247520-79247542 GGCTGGGGCTACTGAGAGGGAGG - Intronic
1073129580 10:101178591-101178613 GGCTGGGCCCACTCCTCAGGAGG - Intergenic
1074533788 10:114314268-114314290 GGCTGAGGCCAGTGAGAAGGAGG - Intronic
1075017878 10:118924376-118924398 GGCTGGCCCCACCCAGAAGGTGG + Intergenic
1075389700 10:122083574-122083596 GGCTGGGGGCTCTGGGAAGGAGG + Exonic
1075999697 10:126905236-126905258 GGCTGGGCGCACTGGGACAGAGG + Intergenic
1076149311 10:128149958-128149980 GGCTGGGGGCACTGCGGAGGGGG - Intergenic
1076342336 10:129758343-129758365 GGCTGGAGCCCCTGCGATGGAGG + Intronic
1076963568 10:133786690-133786712 GGCTGAGGGCACTGCGAGGGCGG + Intergenic
1077349582 11:2086274-2086296 GGCTGGGCCCAGTCAGGAGGAGG - Intergenic
1081732848 11:45383821-45383843 GGCAGGCCCCAGTGCAAAGGAGG - Intergenic
1083323888 11:61863631-61863653 GGCTGGGCCCCCTGGGAATGAGG + Intronic
1083615401 11:64023674-64023696 GAATGGGCCCAGTGGGAAGGAGG - Intronic
1084012543 11:66360678-66360700 TGCTGGGTCTACTGGGAAGGAGG + Intronic
1084565974 11:69929257-69929279 TGCTGGGAACACTGAGAAGGAGG - Intergenic
1084960177 11:72712399-72712421 GGTTGGGCTCAGTGGGAAGGAGG + Intronic
1085349245 11:75788009-75788031 GGCTGGTCTCTCTGGGAAGGGGG - Intronic
1085399526 11:76227365-76227387 GGCAGGCCTCACTGAGAAGGGGG - Intergenic
1085423090 11:76380692-76380714 GGCAGCGCTCACCGCGAAGGTGG + Intronic
1086048679 11:82563516-82563538 TGCTGGGGCCTCTGAGAAGGAGG - Intergenic
1089161839 11:116444399-116444421 GGCTGGGGGCACTGCTATGGGGG + Intergenic
1089308426 11:117541792-117541814 GGCAGGGCCCAGGGGGAAGGTGG + Intronic
1089602384 11:119623863-119623885 TCCTGGGCCCACTGGGAGGGGGG - Intronic
1089608226 11:119654388-119654410 GGCTGTGCCCACTGTGTAAGAGG + Intronic
1090386374 11:126359756-126359778 GGGAGGGCCCACGGGGAAGGAGG - Intronic
1093972497 12:25387692-25387714 GCATGGGCCCACTGCAAAGCTGG + Intergenic
1094224385 12:28028670-28028692 GACTGGAGCCACAGCGAAGGAGG + Intergenic
1095448772 12:42307692-42307714 TGCTGGGACCACTGGGAAAGGGG + Intronic
1096242416 12:49966508-49966530 GGCTGGGCTCACTGCGAAGCTGG - Intergenic
1097263536 12:57733069-57733091 GGCTGGGTCCACTGGGGATGGGG + Intronic
1102766816 12:115440590-115440612 GGCCTGGACCACTGCCAAGGAGG - Intergenic
1102887515 12:116533336-116533358 GGCGGGGCCCACGCCGGAGGGGG - Intergenic
1103907298 12:124334430-124334452 GGCTCCCCCCACAGCGAAGGGGG - Exonic
1104703485 12:130925027-130925049 GGCTGGGCTCTCTGAGATGGGGG - Intergenic
1105545445 13:21347585-21347607 GGCTGTGCCCAGAGCCAAGGAGG - Intergenic
1106104400 13:26721659-26721681 GTCTGAGGCCACCGCGAAGGAGG - Intergenic
1113990003 13:114353569-114353591 GGCTGAGGGCACTGCGAGGGCGG + Intergenic
1118633788 14:67729203-67729225 GCCTGGGTGCACTGCGTAGGTGG - Exonic
1119434140 14:74586927-74586949 GGCTGGACCCACAGCCCAGGAGG - Intronic
1120872272 14:89348255-89348277 GGCTGGGTCCACTGTGATGCGGG - Intronic
1121005355 14:90487238-90487260 GGCTGGGCTCACTGAGCAGCTGG - Intergenic
1121535121 14:94685863-94685885 GCCTGGGCCCACTGGGAATGTGG - Intergenic
1122413553 14:101538017-101538039 GGCTGGGACCACTGCGAGAACGG + Intergenic
1202857952 14_GL000225v1_random:63379-63401 GGCTGCTCCCACTGCCCAGGCGG + Intergenic
1202861945 14_GL000225v1_random:88957-88979 GGCTGTTCCCACAGCAAAGGCGG + Intergenic
1125730534 15:41890442-41890464 GGCTGGGCCCTCAGAGCAGGAGG + Intronic
1129238857 15:74240079-74240101 GGCTGGGCCCAGGGCCAGGGAGG - Intronic
1130872058 15:87979281-87979303 GGCTGGGCCCTCTGAGAGGTTGG - Intronic
1132375934 15:101328155-101328177 CGCTGGGCCAGCTGCGAGGGTGG - Intronic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1132588796 16:717423-717445 GGGTGGGCCCACTGCTTTGGAGG + Exonic
1132859005 16:2060863-2060885 GGCTCGGCCCACTCAGAAGATGG + Intronic
1132933738 16:2471139-2471161 GGCTGGGCCAGCGGGGAAGGGGG - Intergenic
1135063383 16:19289805-19289827 GCCAGGGCTCACTGTGAAGGAGG + Intronic
1140128509 16:72137491-72137513 GGCTGGCCTCCCTGCGAAGGTGG + Intronic
1141196027 16:81861978-81862000 GGCTCTGCCCACTGGGAGGGAGG - Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1146454293 17:32997113-32997135 GGCTGGGCCCACGGAGGAGAGGG + Intronic
1147438727 17:40433775-40433797 AGCAGGGCCCACTGGGCAGGAGG + Intergenic
1147563097 17:41520897-41520919 GGCCAGGCTCACTGCGAAGATGG - Exonic
1147833754 17:43315422-43315444 GGCTGGGTCCCAAGCGAAGGCGG - Intergenic
1148201839 17:45754237-45754259 GGCTGGGGACACTGGGAAGGGGG + Intergenic
1148439169 17:47702895-47702917 AGCTGGGCCCAGAGAGAAGGGGG - Intronic
1148687637 17:49509510-49509532 GGCTGGGTCCCCTGCCAGGGAGG + Intronic
1150359551 17:64519286-64519308 GGCTGGGCCCTGAGTGAAGGAGG + Intronic
1150692664 17:67378566-67378588 GGCTGGGCCCACGGCCAGGACGG - Intronic
1153978211 18:10287819-10287841 GTCTGTGCCCACTTTGAAGGAGG + Intergenic
1154348402 18:13563387-13563409 AGCTTGGGCCACTGAGAAGGTGG + Intronic
1155877234 18:31102056-31102078 GTCTGGGCCCGCTGCTCAGGAGG + Exonic
1156353740 18:36323145-36323167 GGCTTGGCCCACTCAGAAAGGGG + Intronic
1157228341 18:45889070-45889092 GGCTGGGGCTCCTGGGAAGGAGG - Intronic
1157422556 18:47558883-47558905 GGCTGTGCTCACTGAAAAGGAGG + Intergenic
1158405354 18:57155119-57155141 GGCTGGGCTCACTGCAGAAGGGG - Intergenic
1158721960 18:59933020-59933042 GGCTGGCCCCACTGGGGATGGGG - Intergenic
1160730786 19:640804-640826 GGCGGGGGGCACTGGGAAGGGGG + Intronic
1160919391 19:1512813-1512835 GGCAGGGCCCATTGAGGAGGGGG - Intronic
1160943726 19:1631699-1631721 GCCTGTGCCCGCTGGGAAGGAGG - Intronic
1162328074 19:10010389-10010411 GGCGGGGCCCACGGGCAAGGCGG + Exonic
1162441718 19:10696376-10696398 GGCTGGGCTCACTGAGACGGTGG - Intergenic
1163117344 19:15196352-15196374 GGCTGGGGGGTCTGCGAAGGTGG - Intronic
1163585621 19:18161957-18161979 GGCTGGGCTCACTCCTTAGGGGG - Exonic
1163637944 19:18446069-18446091 AGCTGTCCCCACTGCAAAGGAGG + Intronic
1163830837 19:19546509-19546531 GGCTGGGCCCAGTGAAAAGGAGG + Exonic
1167153759 19:47725589-47725611 GGCTGGGGCCAGAGCGAGGGGGG + Intronic
1167506052 19:49871658-49871680 GGCTGGGGGCACTGAGCAGGTGG + Exonic
1167721253 19:51181948-51181970 GGCTGGGCCCAGGGCGACAGCGG - Intergenic
1168721082 19:58555387-58555409 GGGTGGGCCCACCGAGGAGGAGG - Intergenic
925084496 2:1097280-1097302 GGCAGAGCCCACGCCGAAGGGGG - Intronic
926141117 2:10369078-10369100 GGCAGGTTCCAGTGCGAAGGTGG - Exonic
926238502 2:11067841-11067863 GGCTTGGCCGACTGCGCAGATGG - Intergenic
930358112 2:50346387-50346409 GGCTGGGCCCCGCGGGAAGGGGG - Intronic
930651846 2:53971144-53971166 AGCCGGGCCCACGGCGAAGAAGG - Intronic
932757266 2:74417449-74417471 GGCTGGGGCCACTGCAAAGAGGG + Exonic
933230775 2:79804959-79804981 AGCTGGGCCAAATGGGAAGGAGG + Intronic
936569802 2:113603554-113603576 GGCTGAGGGCACTGCGACGGCGG - Intergenic
938763889 2:134447770-134447792 GGCTGGGACCACTGCGTAGGGGG - Intronic
939071114 2:137544423-137544445 GGCTGGGTTGACTGAGAAGGGGG + Intronic
941749393 2:169119249-169119271 GGCTGGGCCCACTCCTCAGCAGG - Intergenic
942444156 2:176067221-176067243 GGCGGGCCCCACCGCGAACGAGG - Intergenic
946167672 2:217875248-217875270 GGTCAGGCCCACTGAGAAGGTGG + Intronic
946180410 2:217945703-217945725 GGCTGGGCCGACGGCTAGGGAGG - Intronic
947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG + Intronic
947815597 2:233034378-233034400 CCCCGGGCCCACTGCAAAGGTGG - Exonic
948368469 2:237473477-237473499 GGCTGAGCCCATTGGGAAGCTGG - Intergenic
948452098 2:238082240-238082262 GGCAGAGCCTACTGCGCAGGTGG + Intronic
948539964 2:238683974-238683996 GGCTGGGCCCAATCCCACGGGGG + Intergenic
948900995 2:240956853-240956875 GGCAGGGCTCACAGCGAGGGTGG + Intronic
949089000 2:242182931-242182953 GGCTGAGGGCACTGCGAGGGTGG + Intergenic
1168832880 20:856600-856622 GGCTGGGCCACCCGCCAAGGTGG + Intronic
1169209099 20:3755760-3755782 GGCTGGGGCCACTGGGCTGGGGG - Intronic
1172184444 20:33022538-33022560 GGCTGGGTCAAGTGCCAAGGTGG - Intronic
1172273387 20:33667065-33667087 GGCTGGGCCGAGCCCGAAGGTGG + Exonic
1172884092 20:38219848-38219870 GGCTGGGGCCACAGAGATGGAGG - Intronic
1173616864 20:44408949-44408971 TCCAGGGCCCACTGAGAAGGAGG + Intronic
1175551784 20:59822264-59822286 GGGTGGGATCACTGCGGAGGGGG - Intronic
1175952537 20:62591060-62591082 GGCTGTGACCACTCTGAAGGTGG + Intergenic
1176054016 20:63134955-63134977 GGCAGGGCCCAGAGAGAAGGCGG + Intergenic
1176054239 20:63135467-63135489 GGCAGGGCCCAGAGAGAAGGCGG + Intergenic
1176083413 20:63285127-63285149 GGCTGGGGGCACTGCAAGGGAGG - Intronic
1177833837 21:26169719-26169741 GGCTCGGCCCACGGCGAGGGCGG + Intronic
1178351114 21:31873565-31873587 GGCTGGGCCCAGGGCGGCGGCGG + Exonic
1180264253 21:46699469-46699491 GGCTGAGGGCACTGCGAGGGCGG + Intergenic
1181734965 22:24874442-24874464 GGCAGGGCCCACAGAGACGGAGG - Exonic
1182073548 22:27479426-27479448 GGCTGGGCCCACAGAGAAATGGG + Intergenic
1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG + Intronic
1183471416 22:38008976-38008998 GGCAGGCCCCTCTGAGAAGGTGG + Intronic
1183676615 22:39302353-39302375 GTCTGGGCCCACTGCCTATGGGG + Intergenic
1184747836 22:46466257-46466279 AGCTGCTCCCACTCCGAAGGGGG + Intronic
1185348263 22:50320026-50320048 TGCAGGGCCCACTGGGAATGGGG - Intronic
1185430414 22:50807415-50807437 GGCTGAGGGCACTGCGAGGGCGG + Intergenic
950304915 3:11910130-11910152 GGCTGGGCACACTGAGATGCCGG - Intergenic
951803541 3:26623051-26623073 GGCTTGGCTCCCGGCGAAGGCGG - Exonic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954326746 3:49868224-49868246 AGCTGGGCCAACTGAGAAGAGGG - Intronic
954781592 3:53066069-53066091 GGCTGGGAGCACTGCTAGGGGGG - Intronic
956151812 3:66251517-66251539 GGCTGGGCCCACTGGCAAGATGG - Intronic
960573405 3:119206770-119206792 GGCTGGGCCTCCAGGGAAGGTGG - Intergenic
961065429 3:123871058-123871080 GGGTGGGACCAATGGGAAGGAGG - Intronic
962532899 3:136300346-136300368 GGCTGCCCACACTGGGAAGGAGG + Intronic
964444233 3:156741985-156742007 TGCTGGGCCCGCTGCCATGGAGG + Intergenic
968231728 3:197008513-197008535 GGCTGTGCCCCCTGGGAAGCTGG - Intronic
968542555 4:1175453-1175475 GCCTGGGCCCACCGCCAAGTGGG - Intronic
968871207 4:3243486-3243508 GCCTGGGCCTCCTGGGAAGGAGG + Exonic
969057313 4:4409945-4409967 GGCTGGGCCCACTTTCGAGGAGG - Intronic
979318940 4:119300631-119300653 GGCGCGGCGCACTGCGCAGGCGG - Exonic
985466821 4:190204133-190204155 GGCTGAGGGCACTGCGAGGGTGG + Intergenic
985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG + Intergenic
988779034 5:34502574-34502596 AGCTGGGGACACTGCGAAGGTGG + Intergenic
991927582 5:71719826-71719848 GGCTGGGCTCGCAGCCAAGGCGG + Intronic
992365379 5:76084451-76084473 GGCTGGGCCCACGGGGACTGCGG + Intronic
993879133 5:93342601-93342623 GCATGGCCCCACTGCGTAGGAGG + Intergenic
998872279 5:146564471-146564493 GGCTGGCCTCACTGAGCAGGAGG + Intergenic
999730566 5:154473938-154473960 TGCGGCGCTCACTGCGAAGGAGG - Intergenic
1001634249 5:173198377-173198399 GGCCGAGCCCAGTGCCAAGGGGG + Intergenic
1002451004 5:179318469-179318491 GACAGGGCCCACTGCAAAGTGGG + Intronic
1003406180 6:5828902-5828924 GGCTGTGCCCAGAGCCAAGGAGG + Intergenic
1006259769 6:32858108-32858130 GGCTGGGACCAACGTGAAGGAGG + Exonic
1007578416 6:42940644-42940666 GGCTAGGCCCAGTGGGTAGGAGG + Intergenic
1007840949 6:44715486-44715508 GGCTGTGGCCACAGCCAAGGAGG - Intergenic
1014326321 6:119999957-119999979 GACTGGGCCTACTGTGAAGTGGG - Intergenic
1015756051 6:136607986-136608008 GGCTGGTCTCACTGCAGAGGTGG + Intronic
1016388710 6:143553870-143553892 GGCAGGCCCCACTGAGAAGGTGG + Intronic
1017992907 6:159506018-159506040 GGCTGGGCCCACTGCTGTGGGGG - Intergenic
1018812622 6:167308616-167308638 GGCTGGGGCCCCTAAGAAGGCGG + Intronic
1019309934 7:355052-355074 GGCAAGGCTGACTGCGAAGGGGG - Intergenic
1019323293 7:425221-425243 GGCTGGGCACACAGTGAAAGGGG - Intergenic
1019445351 7:1068123-1068145 GGCTTTGCCCTCTGCTAAGGTGG - Intronic
1019594310 7:1851311-1851333 GGCTGAGCCCATGGAGAAGGTGG + Intronic
1020256983 7:6508050-6508072 GGCTGGTCTCACTGCGCCGGTGG + Exonic
1025207961 7:57004273-57004295 GGCTGGCCCTTCTGCGCAGGCGG + Intergenic
1025663989 7:63572602-63572624 GGCTGGCCCTTCTGCGCAGGCGG - Intergenic
1026271051 7:68837222-68837244 GGCAGGGTCCACAGAGAAGGGGG + Intergenic
1033756999 7:144403873-144403895 GGCTGGGGCAGCTGCGAGGGCGG + Intronic
1034652098 7:152699786-152699808 GGCTGGTCCCATTGAGAAAGAGG - Intergenic
1034713389 7:153217243-153217265 GGCTGCATCCACAGCGAAGGGGG + Intergenic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1041695670 8:60733508-60733530 GGCTAAGCCCACTGAGAAGGTGG - Intronic
1042618632 8:70678129-70678151 GGCAGGACTCACTGAGAAGGTGG - Intronic
1046860959 8:119091198-119091220 GACTGGGCCCATTGGGAAGAAGG + Exonic
1049033924 8:140060204-140060226 GGCCGGCCCCACTGCTAAGTAGG + Intronic
1049733137 8:144189404-144189426 GGCTGGGCCCCGGGTGAAGGGGG - Intronic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1057039447 9:91836818-91836840 GGCTGAGGCCACTGCCCAGGCGG - Intronic
1058836459 9:108862352-108862374 GGATGGGCCCACCAAGAAGGTGG + Exonic
1060724308 9:125997083-125997105 GGCTGAGCCAGCTGCGAGGGGGG - Intergenic
1060826666 9:126691817-126691839 GGCTGGGCCCTCTGTGCTGGAGG + Intronic
1060844522 9:126825539-126825561 GTATGGGCCCAGTGAGAAGGAGG - Intronic
1061860043 9:133463420-133463442 GGCGGAGCCCGCTGGGAAGGCGG - Intronic
1062057274 9:134475164-134475186 GCCTGGGCTCACTGAGCAGGTGG + Intergenic
1062309180 9:135926772-135926794 GGCAGGGCCCAGTGCCATGGTGG + Intergenic
1062720828 9:138043176-138043198 GGATGGGCCCTCGGGGAAGGAGG + Intronic
1203697608 Un_GL000214v1:113242-113264 GGCCGGGGGCACTGCGAGGGCGG - Intergenic
1185819668 X:3190316-3190338 AGCAGGGCCCACTGCAAAAGTGG - Intergenic
1187350651 X:18513302-18513324 GGATGGGCCCAGTGTGAAAGTGG + Intronic
1188156585 X:26749027-26749049 GGCTGGGGCCACTGCAAAGAGGG - Intergenic
1195259802 X:103121098-103121120 GGCTGGGTCCATGGGGAAGGAGG - Intergenic
1200088691 X:153624405-153624427 GGCTGGGGACACAGCCAAGGTGG + Intergenic