ID: 947794706

View in Genome Browser
Species Human (GRCh38)
Location 2:232886981-232887003
Sequence GTGGCCAACTGGTCTGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947794698_947794706 16 Left 947794698 2:232886942-232886964 CCTCACTAGGCACAGCGTGTAAC 0: 1
1: 1
2: 0
3: 2
4: 43
Right 947794706 2:232886981-232887003 GTGGCCAACTGGTCTGGGAAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
947794696_947794706 25 Left 947794696 2:232886933-232886955 CCAGCCTTTCCTCACTAGGCACA 0: 1
1: 0
2: 0
3: 42
4: 212
Right 947794706 2:232886981-232887003 GTGGCCAACTGGTCTGGGAAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
947794697_947794706 21 Left 947794697 2:232886937-232886959 CCTTTCCTCACTAGGCACAGCGT 0: 1
1: 0
2: 0
3: 10
4: 91
Right 947794706 2:232886981-232887003 GTGGCCAACTGGTCTGGGAAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
947794702_947794706 -9 Left 947794702 2:232886967-232886989 CCAGAGGAATTTTGGTGGCCAAC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 947794706 2:232886981-232887003 GTGGCCAACTGGTCTGGGAAAGG 0: 1
1: 0
2: 1
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947794706 Original CRISPR GTGGCCAACTGGTCTGGGAA AGG Intronic
900366272 1:2313137-2313159 GTGTCCAGCCGGGCTGGGAACGG + Intergenic
900518115 1:3092777-3092799 GTGGCAACCTGGGCTGGGATTGG + Intronic
900767316 1:4514012-4514034 CTGGCCTCCTGGGCTGGGAAAGG + Intergenic
900812683 1:4819732-4819754 GTGGCCATCTGGTCTGAGTTAGG + Intergenic
901444340 1:9298680-9298702 GTGGCCCACTAGTCAGAGAAGGG + Intronic
903154665 1:21435749-21435771 GTGTCCCACTGGTCGGGGGAGGG - Intergenic
905212583 1:36385105-36385127 GGGGCCAAGTGGCGTGGGAATGG + Intronic
906459062 1:46023496-46023518 GTGGGAATCTTGTCTGGGAAAGG - Intronic
906648745 1:47495175-47495197 GTTGCCAACCAGTGTGGGAAGGG - Intergenic
909635265 1:77810737-77810759 CCGGCCTACTGGTCTGGGTACGG + Intronic
911042091 1:93599089-93599111 GTGGCCAGCTGGCCCAGGAAGGG + Intronic
915585816 1:156843388-156843410 GTGGACAGGTGGTGTGGGAAAGG - Intronic
915721249 1:157987467-157987489 GTGGCAAAATGGTCTGTCAAAGG - Intergenic
917719466 1:177773099-177773121 TTGTTCAACTGGTCTGGGATGGG - Intergenic
918048897 1:180957397-180957419 GTGAGCAAGTGGGCTGGGAAGGG + Intergenic
918121739 1:181546527-181546549 GAGGACAACAGGTCTGGGAAGGG - Intronic
920565566 1:206969973-206969995 GAGCCCACCTGCTCTGGGAAGGG + Intronic
921398238 1:214691891-214691913 GTGGCTTGCTGGTCTTGGAAAGG - Intergenic
922121117 1:222669769-222669791 CCGGCCTACTGGTCTGGGTACGG + Exonic
922445961 1:225697608-225697630 ATGGCCAACAGCTGTGGGAATGG + Intergenic
1063215182 10:3918453-3918475 ATGGCCAACAGGTATGTGAAAGG - Intergenic
1070408197 10:76115125-76115147 GTGGCCAAATTGCCTGGAAATGG - Intronic
1072357608 10:94626589-94626611 GTGGTCAGCTGGTCTAGGCAGGG + Intergenic
1073575417 10:104618745-104618767 GTAGCCACCTGATCTGGCAAAGG - Intergenic
1073952749 10:108829559-108829581 GAGGCCAACAGGCCTAGGAAGGG - Intergenic
1075101594 10:119510095-119510117 TTGCCCAACTGGTATGGGACGGG + Intronic
1075682100 10:124340514-124340536 GTAGCCAAGTGGCCTGGGACAGG + Intergenic
1076164729 10:128272667-128272689 GTGGCCCCCGGGCCTGGGAAGGG + Intergenic
1076366812 10:129926586-129926608 GTGGCCAAGTGGCCAGGGAGGGG + Intronic
1076529507 10:131135236-131135258 GTGGCCAACTGAGCTGGGCTGGG + Intronic
1076664617 10:132079130-132079152 GTGGGCACCTGGCCTGGGAGCGG + Intergenic
1076986713 11:242015-242037 GTGGCCATTTGGTGTGGGAGGGG - Intronic
1078526508 11:12105545-12105567 CTAGCCAGCTGTTCTGGGAAGGG + Intronic
1080785017 11:35467233-35467255 GTGGGAAGCTGGCCTGGGAAGGG - Intronic
1080949208 11:37009374-37009396 ATGGCCAACAGGTTTGTGAAAGG - Intergenic
1083625819 11:64071523-64071545 GTGGGCCCCTGGTCTGGGATGGG - Intronic
1084106870 11:66986123-66986145 GTGGCCATCTGGTCTGGGGCTGG - Intergenic
1085115976 11:73932122-73932144 GTTGACAACTGGGCTGGGCACGG - Intergenic
1085405981 11:76262434-76262456 GTAGCCAAGGGGTCTGGGGAGGG - Intergenic
1090227363 11:125079735-125079757 GTTGGCAACTGGTTCGGGAAGGG + Exonic
1091140922 11:133233902-133233924 CTGGTCAATTGGTCTGGGCAGGG - Intronic
1091898887 12:4126911-4126933 GTGGCCAAAGAGTCTGAGAAAGG - Intergenic
1094813118 12:34161459-34161481 GTGGCCAGCATGTCTGTGAAGGG + Intergenic
1097199592 12:57266945-57266967 ATGGCAAATTGGTCTGGGAATGG - Intronic
1098364347 12:69686824-69686846 CTGACCAACAGCTCTGGGAATGG + Intronic
1101376715 12:104177753-104177775 GTGGCCAATTGGCCGGGGGAGGG + Intergenic
1105654880 13:22425493-22425515 GTGGCCTGCTGGCTTGGGAATGG + Intergenic
1107261477 13:38496817-38496839 GTTCCCAAGGGGTCTGGGAAGGG - Intergenic
1107407430 13:40127740-40127762 TTGTTCAACTGGTCTGGAAAGGG + Intergenic
1109146889 13:58790611-58790633 GAGTCCAAATGGTCTGGAAAAGG - Intergenic
1109536861 13:63732968-63732990 GTTGCCAACTTGTCTGGGTCTGG - Intergenic
1111927827 13:94481960-94481982 GTGGCCAACAGATCCGTGAATGG + Intergenic
1112008013 13:95270803-95270825 GTGGCCAAATGGGCCGGGCACGG + Intronic
1112850013 13:103694566-103694588 GTGGTCACCTGGGCTAGGAATGG + Intergenic
1115450514 14:33542360-33542382 GTGGATAACTGGGGTGGGAAAGG - Intronic
1116367584 14:44087151-44087173 GTGGCCAACAGGTATATGAAAGG - Intergenic
1117221267 14:53608887-53608909 GTGGCCATCTGGGCAGAGAAAGG - Intergenic
1119803831 14:77469067-77469089 GTGGCAAAGTGTCCTGGGAAAGG - Exonic
1122977502 14:105176938-105176960 GAGGCCAGCTGGGGTGGGAAGGG - Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1126067602 15:44837896-44837918 ATGGCCTAGTGGTCTGGGCATGG - Intergenic
1126092276 15:45062986-45063008 ATGGCCTAGTGGTCTGGGCATGG + Intronic
1127064971 15:55227541-55227563 GTGGCCAACTGACTTGAGAACGG + Intronic
1128375469 15:67071518-67071540 GTGGACAACTTGGCTGGGCACGG + Intronic
1129198503 15:73984878-73984900 GTGGCCAACAGGGTTGGGGAAGG + Intronic
1131667086 15:94581855-94581877 CTGGCCCTCTGGCCTGGGAATGG - Intergenic
1134187059 16:12092687-12092709 CTGACCATCTGTTCTGGGAAAGG + Intronic
1136172355 16:28496672-28496694 GTGGCCTACTGGGCGTGGAATGG + Exonic
1139437947 16:66947770-66947792 GCGACCAACTGGTCTGGGAACGG - Intergenic
1140049397 16:71466380-71466402 TTGGCCAACAGGGGTGGGAATGG + Intronic
1144120873 17:12151059-12151081 GAGTCCAAGTGGTCTGGGCAAGG + Intergenic
1144753403 17:17665604-17665626 CTGGCCACCGGGTCTGGCAAAGG - Intergenic
1144876639 17:18400555-18400577 CTGGCCAGGTGGGCTGGGAAGGG + Intergenic
1146302945 17:31705456-31705478 CTAGCCACCTGGTTTGGGAATGG - Intergenic
1147143021 17:38469679-38469701 GTGGCCAGCTGCTCTGGGGCAGG + Intronic
1148333546 17:46826313-46826335 GAGGCCCAGTGGGCTGGGAATGG + Intronic
1148843961 17:50517834-50517856 GTGTCCAACTATTCTGGGAGAGG - Intronic
1149989644 17:61375498-61375520 GTGGCAACCTGGTATGGGATGGG - Intronic
1150140736 17:62726272-62726294 GGGGCCATCTGGTCAAGGAAAGG + Intronic
1151494954 17:74453711-74453733 GCGGACAACCGGTCTGGGACCGG - Intergenic
1151826722 17:76527902-76527924 GTGGGGAGCTGGTCTGAGAAGGG + Exonic
1152125128 17:78442110-78442132 GTGGCCAGCTGGTCTCTGAAAGG + Intronic
1154036152 18:10804462-10804484 TTAGACAACTGGTCTAGGAAAGG + Intronic
1158703333 18:59769328-59769350 GTGGCCAAATGGGTTTGGAATGG - Intergenic
1161400362 19:4064537-4064559 TTGGCAAACTGGTCTGGGAGAGG - Intronic
1162128854 19:8513301-8513323 GTGGCCAGCATGTCTGGGATGGG + Exonic
1163242622 19:16073591-16073613 GTGGCCAGCTGATCAGGGCAGGG - Intronic
1165435340 19:35792039-35792061 GTGGCCACCGGGGCTGGTAACGG - Intergenic
925278587 2:2667846-2667868 GTGGCCAAGTGGGAGGGGAAGGG - Intergenic
925606530 2:5666271-5666293 GTGGGCAGCTGGTCAGGGAAAGG - Intergenic
926265099 2:11309043-11309065 CCGGCCTACTGGTCTGGGTACGG - Intronic
927452396 2:23220337-23220359 GTGGCTAAGTGTTCTGGAAAAGG + Intergenic
927826285 2:26312163-26312185 GTCGCACACTGGACTGGGAAGGG - Intronic
927843420 2:26459176-26459198 TTAGCCAACAGGTCTGGAAATGG - Intronic
928284136 2:29974250-29974272 GTGGCCAGTGGGTCTGGGAGAGG - Intergenic
931891878 2:66682276-66682298 GTGGGCCACTGGTGTAGGAAAGG + Intergenic
932379991 2:71273668-71273690 CTGGCAAACTGGGCTGGGCATGG + Intergenic
933113299 2:78432130-78432152 CTGGAGAACTGGTCTGGGGAAGG + Intergenic
934664334 2:96159170-96159192 GAGGAGAACGGGTCTGGGAAGGG - Intergenic
934902033 2:98167127-98167149 GTGGCCAGCGGGACAGGGAAGGG + Intronic
937225354 2:120365656-120365678 GTGGCCAAGGGGGCTGGGACAGG + Intergenic
939166204 2:138643689-138643711 GTGTTCACCTGGTCTGGGACTGG - Intergenic
940645095 2:156383263-156383285 GTGGCCAACAGGTCTCCCAAAGG - Intergenic
941391196 2:164917116-164917138 ATGGCCAACTTCCCTGGGAAGGG + Intronic
947794706 2:232886981-232887003 GTGGCCAACTGGTCTGGGAAAGG + Intronic
1170021809 20:11844920-11844942 GTGGCCAACAAGCCTAGGAATGG + Intergenic
1170717195 20:18842181-18842203 CTGGGGAAATGGTCTGGGAAGGG - Intergenic
1171228192 20:23458860-23458882 GAGGCCAAATGGTCTAGGGAAGG - Intergenic
1171376342 20:24696553-24696575 GTGGCCCAGTGGACTGGGCATGG + Intergenic
1173144483 20:40512810-40512832 GTGGCCAGCTGTCCTGAGAAGGG - Intergenic
1174405303 20:50298989-50299011 GAGTCCAACTGGTTTGGGGAGGG - Intergenic
1174559934 20:51423806-51423828 GTGGACAGCAAGTCTGGGAAGGG + Intronic
1175879206 20:62247016-62247038 GTCGCCGACTGCTCTGGGGAAGG + Intronic
1177678942 21:24338929-24338951 GTAGCCAAGGGGTCTGGGAGAGG - Intergenic
1179468920 21:41597650-41597672 CTGGGCAACTGGCCTGGGAGTGG + Intergenic
1179468929 21:41597686-41597708 GTGGGCAACTAGCCTGGGAGTGG + Intergenic
1181029877 22:20144547-20144569 GTGGCCAAGTGGCCTGGGCTGGG - Intronic
1181513389 22:23398760-23398782 GTGGCCAAGTGGCCTGGGCTGGG + Intergenic
1182483173 22:30622826-30622848 GTGGCCAGGTGGCCTGGGAAGGG + Intronic
1183492992 22:38126667-38126689 GGGGCCCACTGCTCTGGGAAGGG + Intronic
1185385198 22:50528730-50528752 GTGCCCAGCTGGTGAGGGAATGG + Intronic
950479323 3:13235013-13235035 GGGGCCCACGGGTCTGGGGACGG + Intergenic
951055775 3:18144972-18144994 GTGTCTGACTGTTCTGGGAAGGG + Intronic
952113299 3:30149420-30149442 CTGGGCATCTGGTCTGGTAAAGG - Intergenic
952322666 3:32292810-32292832 GTTGCCAAATGCTCTGTGAAGGG + Intronic
953454618 3:43031815-43031837 GTGGCCATGTGCTCTGGCAAAGG + Intronic
953492134 3:43361459-43361481 GTGGCCTTGTGTTCTGGGAAGGG + Intronic
956712257 3:72049004-72049026 CTGGCAGGCTGGTCTGGGAAAGG + Intergenic
959257302 3:104031443-104031465 TTTGCAAACTGGACTGGGAAGGG + Intergenic
959907902 3:111730900-111730922 GTGGCAAACAGTACTGGGAAGGG - Intronic
961058673 3:123810322-123810344 GTGGCCACCTTGATTGGGAAGGG - Intronic
962389951 3:134962874-134962896 GTAGACACCTGGTCAGGGAAGGG - Intronic
963900010 3:150725000-150725022 GTGTGCTCCTGGTCTGGGAAAGG + Intergenic
967233488 3:187363460-187363482 GTGGCCAACTGCTCTGTAAAAGG - Intergenic
967633479 3:191774569-191774591 GTGGCCAACTGCATGGGGAAGGG - Intergenic
968358189 3:198124211-198124233 GTGGCCAGCATGTCTGTGAAGGG - Intergenic
968726434 4:2250039-2250061 GTGGACAAGGGGTCTGTGAAGGG - Exonic
970343401 4:15130239-15130261 GTCTCCAGCTGGTCTGGGAAGGG - Intergenic
971595272 4:28519273-28519295 CTGGGCAGCTGGACTGGGAATGG + Intergenic
972695213 4:41438788-41438810 TTGGCCAACTGGCCTGGGCGAGG - Intronic
974070551 4:57119504-57119526 GTGGCCAGATGGGCTGGGAAAGG - Intergenic
976462078 4:85323419-85323441 TTGGGCAACTGTTCTGGGACAGG - Intergenic
982667132 4:158278778-158278800 CCGGCCTACTGGTCTGGGTACGG - Intergenic
985440255 4:189978844-189978866 GTGGCCAGCATGTCTGTGAAGGG + Intergenic
985590523 5:762133-762155 GTGGCCATCTGGGCTGTGAGTGG - Intronic
985590541 5:762217-762239 GTGGCCATCTGGGCTGTGAGTGG - Intronic
985692219 5:1319695-1319717 GTGGCCTCCTGGTCGGGGGAGGG + Intronic
986958543 5:13186584-13186606 GTGGCCAACTAGTCCAGGACTGG - Intergenic
989712599 5:44418028-44418050 GTGGGCAAATGGTCTGGGGTGGG - Intergenic
991630022 5:68647301-68647323 CTGGCCAAGTGGGCTGGGGATGG - Intergenic
995596770 5:113755808-113755830 GTAGCCAACTTTTCTGGCAAAGG + Intergenic
998919956 5:147057169-147057191 GTGGCATACTGGTGGGGGAATGG - Intronic
1000740572 5:164964712-164964734 TTGGCCAGCTGGTCAGCGAATGG - Intergenic
1000949755 5:167466165-167466187 GTGGCCCACTGCTCTCTGAAAGG + Intronic
1003310954 6:4969544-4969566 CAGGCCACCTGGTCTGGCAAAGG - Intergenic
1003840264 6:10112636-10112658 TTGGCCAACAGCTCTGGGACTGG - Intronic
1004483976 6:16048315-16048337 GCAGCCAACTCCTCTGGGAATGG - Intergenic
1004961985 6:20800426-20800448 GAGGCAAATTGGTCTGGGAGTGG + Intronic
1005267820 6:24131273-24131295 GTAGCAAACTGTTCAGGGAATGG + Intronic
1006373549 6:33659565-33659587 GTGGCCAGCTGGGCAGGGCAGGG - Intronic
1006418996 6:33921826-33921848 GTGCCCAGCAGCTCTGGGAACGG + Intergenic
1006843334 6:37046074-37046096 CTGGCCAGCTGGACTGGGAGGGG - Intergenic
1007102684 6:39260948-39260970 GTGGCCAGTGGGTCAGGGAATGG - Intergenic
1007725558 6:43913718-43913740 GTGGCCAGGTGGCCTGGGAAGGG + Intergenic
1007827214 6:44609704-44609726 TTTGAAAACTGGTCTGGGAAAGG + Intergenic
1008413996 6:51218008-51218030 GGGGTCAAGTGGTCAGGGAAAGG - Intergenic
1010607023 6:77903166-77903188 TTGACCAACTGCTCTGGCAAGGG + Intronic
1014945027 6:127487503-127487525 GTCTCCAACTTGTCTTGGAAGGG + Intronic
1018199360 6:161380939-161380961 GTGGCAAACTGGAGTGGGCATGG - Intronic
1020097696 7:5377745-5377767 GGGGCCACCTGGCCTGGGCAGGG + Intronic
1020097784 7:5378068-5378090 GGGGCCAATGGGTCTGGGATGGG - Intronic
1021589783 7:22248499-22248521 GTGTCCATCTGGTCTGGTTAGGG - Intronic
1021946035 7:25728238-25728260 CTAGGCAAGTGGTCTGGGAAAGG + Intergenic
1025997503 7:66537239-66537261 GTGCTCAGCTGGTCTGGGCATGG + Intergenic
1029159843 7:98543810-98543832 GTCCCCAGCTGGGCTGGGAAAGG - Intergenic
1029355691 7:100049889-100049911 GTGGCTGAATGGTCTGGGGAGGG + Intronic
1032344255 7:131105495-131105517 GGGTCCAATTGGTCTGGGATTGG + Intergenic
1035024065 7:155815120-155815142 GGGGCCAAATGGTCTGGGGGGGG - Intergenic
1035182151 7:157097299-157097321 CTGGCCAGCCCGTCTGGGAAGGG + Intergenic
1035559601 8:594533-594555 GTGGACAAATGGACTGGGGAAGG - Intergenic
1035561608 8:608399-608421 GGGGCCATCGGGACTGGGAAGGG - Intergenic
1036779210 8:11634227-11634249 GTGGCCGAATGGTCGGAGAAGGG - Intergenic
1037982076 8:23261532-23261554 GTGGCCTACTGCTCGGGGCAGGG + Exonic
1039902662 8:41764531-41764553 CTGGCCTCCTGATCTGGGAATGG - Intronic
1047770353 8:128025538-128025560 TGGCCCAAATGGTCTGGGAATGG - Intergenic
1049292152 8:141809782-141809804 GTGGCAAACAAGTCTGGGCAAGG - Intergenic
1053277624 9:36795173-36795195 TTCTCCAAATGGTCTGGGAATGG + Intergenic
1053350641 9:37411373-37411395 GAGGCCAAGCGGTCTGGGAGGGG + Intergenic
1053619746 9:39802996-39803018 ATGGCAAACTGGGCTGTGAAAGG + Intergenic
1053877922 9:42562311-42562333 ATGGCAAACTGGGCTGTGAAAGG + Intergenic
1053894737 9:42732054-42732076 ATGGCAAACTGGGCTGTGAAAGG - Intergenic
1054233773 9:62539383-62539405 ATGGCAAACTGGGCTGTGAAAGG - Intergenic
1054264413 9:62904447-62904469 ATGGCAAACTGGGCTGTGAAAGG - Intergenic
1054458499 9:65449520-65449542 TTGGCCCAGTGGTCTGGGAGGGG + Intergenic
1056972078 9:91213562-91213584 GTCGCCGACTGGCCTAGGAAAGG - Intergenic
1057150413 9:92791564-92791586 ATGGCAAACTGGGCTGTGAAGGG + Intergenic
1058723962 9:107784522-107784544 TTGGCCAGCTCGCCTGGGAAGGG + Intergenic
1058898618 9:109421749-109421771 GGGGCCTAATGCTCTGGGAAGGG - Intronic
1059629297 9:116102759-116102781 GTGACCATCTGGTTTGGGAATGG - Intergenic
1059729721 9:117044774-117044796 GAGGCACACTGGTCTGGGCATGG + Intronic
1060228642 9:121811461-121811483 GTGGCCATGTGGCCTGGGCAGGG + Intergenic
1061974836 9:134062789-134062811 GTCTCCCACGGGTCTGGGAAGGG + Intronic
1062721634 9:138047256-138047278 GTGGAAAACGGTTCTGGGAAGGG - Intronic
1062742060 9:138180749-138180771 GTGGCCAGCATGTCTGTGAAGGG - Intergenic
1185694726 X:2186426-2186448 GTGACCCACTTGCCTGGGAATGG - Intergenic
1185694943 X:2187249-2187271 GTGACCCACTTGCCTGGGAATGG - Intergenic
1185694994 X:2187454-2187476 GTGACCCACTTGTCTGGAAATGG - Intergenic
1187531966 X:20105394-20105416 GAGACAAGCTGGTCTGGGAAGGG + Intronic
1190049263 X:47137445-47137467 CTGGGCAACTGGGCTGGGCATGG - Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1190784235 X:53628584-53628606 GTGGCAAACTGGTGAGGGTATGG + Exonic
1192893184 X:75412000-75412022 ATGGCCAACAGGTGTGTGAAAGG + Intronic
1199602754 X:149552371-149552393 GTGGCTAACGAGGCTGGGAAAGG - Intergenic
1199647635 X:149927104-149927126 GTGGCTAACGAGGCTGGGAAAGG + Intergenic
1200986175 Y:9304967-9304989 GTGGGGAAGTGGTCTGTGAAAGG - Intergenic