ID: 947795308

View in Genome Browser
Species Human (GRCh38)
Location 2:232890613-232890635
Sequence TTTTACCTTGAGCAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947795308 Original CRISPR TTTTACCTTGAGCAGTTTGG GGG (reversed) Intronic
900430007 1:2596920-2596942 CTTTACCCTGAGGAGTTGGGGGG + Intronic
902178017 1:14665886-14665908 ATTTTCCTTTGGCAGTTTGGAGG + Intronic
902875496 1:19338399-19338421 TCTTCCCTGGGGCAGTTTGGAGG + Intergenic
905210723 1:36372319-36372341 TTTTAGCTTGCTTAGTTTGGAGG + Intronic
908954552 1:69606739-69606761 TCTTTCCTTGAGCAATATGGGGG + Intronic
910092130 1:83478162-83478184 TTTTCTCTTGTGTAGTTTGGGGG - Intergenic
911119118 1:94277439-94277461 TTTTACCTTGAGCAGTAATGTGG - Intergenic
912016067 1:105037797-105037819 TTTTAGCTGATGCAGTTTGGAGG + Intergenic
912088588 1:106041693-106041715 TTTTTCATGCAGCAGTTTGGGGG - Intergenic
916270014 1:162930594-162930616 TTTTTCATTGAGCAATTTGATGG - Intergenic
916373681 1:164127581-164127603 TTTTACTTTGGGTAATTTGGAGG + Intergenic
916801973 1:168224502-168224524 TTTTCCCTTTAGTAATTTGGGGG - Intergenic
921588324 1:216974541-216974563 TTTTACCCTGAGAACTTTGGAGG - Intronic
921982232 1:221271427-221271449 TTTTACCTTGAGAAGGATGTGGG + Intergenic
923537418 1:234863753-234863775 TCATCCCTTGAGCAGTTTTGTGG - Intergenic
1064463053 10:15553510-15553532 TTTTAAAGTGTGCAGTTTGGTGG + Intronic
1065583049 10:27190892-27190914 TTCTGGCTTGAGCAGTTGGGTGG + Intergenic
1065736939 10:28762244-28762266 TTTTCACTTAAGGAGTTTGGAGG + Intergenic
1065887850 10:30094627-30094649 TTTTCCCTTATGCAGTCTGGAGG + Intronic
1066539602 10:36431319-36431341 TTTTAACTTTAGCTGTCTGGTGG + Intergenic
1066799631 10:39170663-39170685 CTTTTCATTCAGCAGTTTGGAGG + Intergenic
1067259551 10:44676498-44676520 TTTTTCAATGAGTAGTTTGGGGG + Intergenic
1068098627 10:52523194-52523216 TTGTACCTTGACCAGGATGGTGG - Intergenic
1068720620 10:60241676-60241698 TATTACCTTGAGTAGTTTGATGG - Intronic
1068916881 10:62442548-62442570 TGTTACCTTTAGAAGTTTGGAGG + Intronic
1069190961 10:65489100-65489122 TTTTATCTTGAGCAGTGTCTGGG - Intergenic
1073563254 10:104514943-104514965 TTTTAGCTTGACCAGACTGGGGG - Intergenic
1074206899 10:111290497-111290519 CTATACCTTGAGAATTTTGGGGG + Intergenic
1081020725 11:37945538-37945560 TTTGACCTTGAATAGTTTGATGG + Intergenic
1081474592 11:43414321-43414343 TAGTATCTTGAGCAGTGTGGCGG + Intronic
1082310842 11:50646331-50646353 CTTTTCATTCAGCAGTTTGGAGG + Intergenic
1082601564 11:55163733-55163755 CTTTTGATTGAGCAGTTTGGAGG - Intergenic
1084093679 11:66896038-66896060 TTTTTCCTTGACAAGTTTGAAGG - Intronic
1084375371 11:68773221-68773243 TTTTGTCGTGAGCACTTTGGGGG - Intronic
1086429045 11:86717533-86717555 TTTTAAAATGAACAGTTTGGTGG - Intergenic
1090050280 11:123371879-123371901 TTTTAACATCTGCAGTTTGGTGG + Intergenic
1091720164 12:2807465-2807487 TTTTAAATTCAACAGTTTGGTGG + Intergenic
1092497250 12:9009059-9009081 CCTTACCTTGAGAAGTTTAGAGG - Exonic
1094863412 12:34498205-34498227 CTTTTCATAGAGCAGTTTGGAGG - Intergenic
1095046814 12:37516286-37516308 TTTTAATTTGAGCCTTTTGGTGG - Intergenic
1095079143 12:37975969-37975991 TTTTTTATTGAGCAGTTTGGAGG + Intergenic
1095187402 12:39216694-39216716 TTGACCCTTGAGCAGTGTGGGGG - Intergenic
1096564665 12:52468653-52468675 TTTTAACTTAGGGAGTTTGGGGG + Exonic
1096653504 12:53074266-53074288 TTTTGACTTGAGCACTTTTGGGG - Intronic
1098783875 12:74723886-74723908 TTTTACCTTGAGTTTCTTGGTGG - Intergenic
1099617239 12:84951440-84951462 TCCTACCTTAAGCATTTTGGGGG + Intergenic
1099722852 12:86385776-86385798 ATTTAATTTGAGCAGTGTGGAGG - Intronic
1100489431 12:95064602-95064624 TTTTGGCTTGAGCAATTGGGAGG + Intronic
1101351258 12:103931172-103931194 TTTTGGCTTGATCAGTTGGGAGG + Intronic
1102980561 12:117237731-117237753 TGTTACCTTGAGCAGTTCACAGG - Intronic
1103026680 12:117579834-117579856 TGCAAACTTGAGCAGTTTGGAGG + Intronic
1103787742 12:123446045-123446067 TTTTATCTCAAGCAGTTTAGGGG + Intergenic
1104280423 12:127371784-127371806 TTTTGTCTTGAGCACTTGGGTGG - Intergenic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1104385723 12:128350203-128350225 TTTTTTCTTAAGCAGTTTGGGGG + Intronic
1105225351 13:18426612-18426634 TTTTACCTTGATGTGCTTGGAGG - Intergenic
1106005815 13:25769389-25769411 TGTGATCTTGTGCAGTTTGGAGG + Intronic
1106834098 13:33615185-33615207 TTTTGCCTGGAGCAATTTAGTGG + Intergenic
1107357937 13:39587912-39587934 CTTTTCCTTGTGCAGTTTCGTGG - Intronic
1108162169 13:47652087-47652109 TTCTTGCTTGAGTAGTTTGGTGG - Intergenic
1109348075 13:61141527-61141549 TTTTACTTTCAGCATTATGGTGG - Intergenic
1110810171 13:79803911-79803933 TTTTACCTGGAGAAGGTTGAGGG - Intergenic
1111419492 13:87993519-87993541 TTTTACTTTGAGTAGATCGGTGG - Intergenic
1111773363 13:92627234-92627256 TTTCACCTTTAGCAATTTGAGGG + Intronic
1114844281 14:26302183-26302205 TTTTGCCTTCAGAAGCTTGGAGG + Intergenic
1115286312 14:31716828-31716850 TTTTAGCCTGAGCAGCTAGGTGG - Intronic
1115340589 14:32289641-32289663 TATTAGCTTAAGGAGTTTGGGGG + Intergenic
1115625920 14:35191773-35191795 TTTTGGTTTGAGCAATTTGGTGG - Intronic
1115742414 14:36402647-36402669 TTTTGACTTGGGCAGTTGGGTGG - Intergenic
1116150276 14:41131399-41131421 ATTTACCTTGAACAGGTTGAAGG + Intergenic
1116375772 14:44198502-44198524 TTTTTCCTAGAAAAGTTTGGAGG - Intergenic
1116501831 14:45633614-45633636 TATTCCTTTGAGCATTTTGGAGG - Intergenic
1116910592 14:50459295-50459317 TTTTGACTTGAGCAGTTGGATGG - Intronic
1118414292 14:65517511-65517533 TGTTATCCTGAGCAGTTAGGAGG + Intronic
1118893149 14:69925334-69925356 TTTTTCCTTTAGTAGATTGGAGG + Intronic
1118909545 14:70049853-70049875 TTTTCCCATGAGATGTTTGGAGG - Intronic
1118953785 14:70460534-70460556 TTGTACCTGGTGCAGTTTGCTGG + Intergenic
1119033564 14:71211233-71211255 TTTTATTCTGAGCATTTTGGTGG - Intergenic
1119624761 14:76163237-76163259 ATTCACCTTGTGGAGTTTGGGGG + Intronic
1121360551 14:93254433-93254455 TTTTGTCTTGAGGAGTTGGGTGG - Intronic
1124707070 15:31975014-31975036 TTTAACCTTTAGCCGTTAGGTGG - Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126009762 15:44291311-44291333 TTTTACCTTCAACAGTATGTGGG + Intronic
1126838762 15:52695252-52695274 CTTTAGCCTGAGCAATTTGGTGG - Intronic
1128888326 15:71308539-71308561 TTTTACATTGTGCAGTTCAGTGG + Intronic
1128910109 15:71506340-71506362 CTTAACCCTGGGCAGTTTGGAGG - Intronic
1129556900 15:76519794-76519816 ATTTAGCTAGAGGAGTTTGGGGG - Intronic
1129633371 15:77287838-77287860 TTTTAGCTTGAGAAGTTAAGGGG - Intronic
1130627199 15:85527608-85527630 TTTCACCATGAGCATTTTAGAGG - Intronic
1131244019 15:90774387-90774409 TATTACCTTCAGCAGTGTGTGGG + Intronic
1131698326 15:94904336-94904358 TTTTCCCAGGAGCACTTTGGGGG + Intergenic
1135249181 16:20886012-20886034 TTTCACCTTTAGCAGTTTCCCGG - Intronic
1135265009 16:21017307-21017329 TTTTAGCTTGATGATTTTGGGGG - Intronic
1136932998 16:34435698-34435720 TCTTATATTGGGCAGTTTGGGGG - Intergenic
1136971574 16:34976116-34976138 TCTTATATTGGGCAGTTTGGGGG + Intergenic
1138433573 16:56984568-56984590 ATTTAACATGAGCACTTTGGGGG - Intergenic
1142628762 17:1209801-1209823 TTTTTCATTGAGCAGTTTGGAGG + Intronic
1147026306 17:37587684-37587706 CGTTACCAAGAGCAGTTTGGGGG - Intronic
1148658958 17:49312079-49312101 TTTTAGTTTGAGCTTTTTGGTGG - Intronic
1151502522 17:74500492-74500514 TTTTCACTTGAGCAATTGGGAGG + Intergenic
1153807269 18:8720042-8720064 ATTTAAATTTAGCAGTTTGGGGG + Intronic
1154528021 18:15312909-15312931 TTTTACCTTGATGTGCTTGGAGG + Intergenic
1155098566 18:22584894-22584916 TTTTTCTTTGAGGATTTTGGGGG - Intergenic
1160498267 18:79387845-79387867 TTTTAACTTGACCAGTTTCCCGG - Intergenic
1160988164 19:1849156-1849178 TTTAACCTGGTGCATTTTGGTGG + Intergenic
1162157618 19:8689946-8689968 TTTTACCTTGCGGAGTTTTTGGG + Intergenic
1168109508 19:54184097-54184119 TTTTGGCTTGAACAATTTGGTGG - Intronic
925595081 2:5547619-5547641 GTTTACTTTGTGCATTTTGGAGG - Intergenic
925937970 2:8785759-8785781 TTTCAATTTGTGCAGTTTGGAGG + Exonic
928055184 2:28045783-28045805 TTTTACCTTGAGAAGGTATGTGG - Exonic
928416697 2:31098623-31098645 TTGACCCTTGAGCAGTGTGGGGG + Intronic
928453475 2:31399123-31399145 TTTTGTCTTGAGCAATTGGGTGG + Intronic
929077104 2:38086924-38086946 TTTTTCCTTGAGCCATTTGAGGG - Intronic
930437005 2:51357340-51357362 TTTTATTTTGAGCAATTTGTGGG + Intergenic
930535846 2:52645072-52645094 TTTTACATTGAGTAACTTGGTGG + Intergenic
932231781 2:70089235-70089257 TTTTAGCCTGAGGTGTTTGGAGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933626131 2:84602378-84602400 TTTTTCCTTCAGTAATTTGGAGG + Intronic
934727668 2:96634886-96634908 TTCTGGCTTGAGCAGTTGGGTGG - Intronic
935401289 2:102663020-102663042 TTTTGCCTTTGGCTGTTTGGAGG + Intronic
937463050 2:122105899-122105921 CGTTCCCCTGAGCAGTTTGGCGG - Intergenic
937948260 2:127361987-127362009 TTTAACACTGAGCTGTTTGGAGG - Intronic
938368030 2:130750736-130750758 TTTAACCATTATCAGTTTGGGGG + Intergenic
940664646 2:156593544-156593566 TTCTTCCTTGAGCAGTCTGCTGG + Intronic
940892377 2:159047439-159047461 TTTTAGCTTTAGCGATTTGGGGG - Intronic
940994910 2:160137885-160137907 TTTCACCTCGTGCATTTTGGTGG - Intronic
941186135 2:162323987-162324009 AATTACCTTGGGCAGTATGGGGG + Intronic
942476859 2:176335720-176335742 TTTTATTTTGGGAAGTTTGGGGG + Intronic
943440989 2:187927928-187927950 TTTTTCCCTCAGCACTTTGGAGG + Intergenic
945465286 2:210162360-210162382 TTTTAGCTTGAGCAACTGGGTGG + Intronic
945944355 2:215980608-215980630 TTTTTTATTGAGCAATTTGGAGG + Intronic
947263736 2:228252979-228253001 GTTGACCTTGGGCAGTCTGGTGG + Intergenic
947795308 2:232890613-232890635 TTTTACCTTGAGCAGTTTGGGGG - Intronic
948869819 2:240792285-240792307 TTTTTCCTTGTGCAGGTTTGAGG + Intronic
1169041158 20:2496761-2496783 TTTTGCCTGGAGCAGTTGGAAGG + Intronic
1169830120 20:9815768-9815790 TTTTCCCCTGAGTAGGTTGGTGG - Intronic
1171844385 20:30256214-30256236 TTTTAATTTGAGTATTTTGGTGG - Intergenic
1173439086 20:43059334-43059356 TTTTACTCTGAGCAGTGAGGAGG + Intronic
1173688890 20:44943447-44943469 TTTTACCTTGAGTGCTTTGTGGG + Exonic
1174782208 20:53400259-53400281 TTTTACCTTTATCACTTTGAGGG + Intronic
1175309844 20:58004087-58004109 TTCAAACTTGGGCAGTTTGGTGG - Intergenic
1175718819 20:61273214-61273236 GAGTACCTTGTGCAGTTTGGGGG + Intronic
1175718843 20:61273335-61273357 GAGTACCTTGTGCAGTTTGGGGG + Intronic
1176429987 21:6569586-6569608 CTTTACCATGAGCAGTTTTGGGG + Intergenic
1176769404 21:13055635-13055657 TTTTACCTTGATGTGCTTGGAGG - Intergenic
1177186120 21:17799433-17799455 TTCTTCCTTGAGCAGTTAGTTGG - Intronic
1177949325 21:27514279-27514301 TATTATCTTAATCAGTTTGGAGG - Intergenic
1179705381 21:43177048-43177070 CTTTACCATGAGCAGTTTTGGGG + Intergenic
1182928954 22:34154670-34154692 TTTTGCCTTGAACAATTAGGTGG + Intergenic
951755865 3:26090513-26090535 TTTTTCCATAAGCAGTTTTGTGG - Intergenic
952109977 3:30111255-30111277 TTTTACCTGGCACATTTTGGTGG + Intergenic
952504160 3:33992557-33992579 TTTTGGCTTGAGTAGTTGGGTGG - Intergenic
952652678 3:35745245-35745267 TATTACCTTTATCATTTTGGTGG + Intronic
954498099 3:50983749-50983771 TTTTAGCCTCACCAGTTTGGCGG - Intronic
954817296 3:53292652-53292674 TTTCCCTTTGAGCAGTTAGGAGG - Exonic
956411612 3:68985502-68985524 TTTTAACTTGAGCAGATAAGTGG - Intronic
958257923 3:91346632-91346654 TTTTCACTAGAGCAGTTTGATGG - Intergenic
960550066 3:118965899-118965921 TTTTATATTCAGCAGTTGGGTGG + Intronic
960757931 3:121038035-121038057 TTTTACCTTGATCACTCTGGCGG + Intronic
961091580 3:124117329-124117351 TTTTCCCTTGAACATTCTGGGGG + Intronic
962402915 3:135077098-135077120 TTTTATCTTAAGCAGTTTTATGG - Intronic
963455273 3:145538649-145538671 TTTTACCTTTAGTATTTTGATGG - Intergenic
964250991 3:154717095-154717117 TTTTAACTTGAGCACATTAGAGG + Intergenic
965906280 3:173710725-173710747 TTTTACCTGGCACACTTTGGAGG + Intronic
966530437 3:180972690-180972712 TTGCAACTTGAGTAGTTTGGAGG + Intronic
969888504 4:10238085-10238107 TTTTCCCTTAAGCTGTATGGAGG - Intergenic
972705079 4:41534432-41534454 TTTGGACTTGAGCAGTGTGGAGG + Intronic
973533721 4:51859538-51859560 TCTTACCTAGAGTAGTTTGGGGG + Intronic
973742555 4:53932491-53932513 TTTTCCCTTGAGGAGTTGTGTGG - Intronic
973795517 4:54421524-54421546 TTTTACTTTGAGCTGTTCTGGGG + Intergenic
975464213 4:74691235-74691257 TTTTACCTAGAGCAGATAGTAGG - Intergenic
975735810 4:77379951-77379973 CTCTACCCTGACCAGTTTGGTGG + Intronic
976426138 4:84905413-84905435 TTTTGGCTTGAGCAGTTGGTTGG - Intronic
976961159 4:90976463-90976485 TTTTAGGTCAAGCAGTTTGGCGG + Intronic
979005535 4:115290389-115290411 TTTTAACTTGAGTAGTATGTGGG + Intergenic
980914131 4:139018559-139018581 TTTTAGCTTCAGCAGCTTGTTGG + Intronic
981781369 4:148434745-148434767 TTTTTCCTTTAGCTGTTTGCCGG - Intronic
984404411 4:179308626-179308648 TTTTTTCTTCAGCAGTTTGAAGG - Intergenic
984611145 4:181839648-181839670 TTTTAGATCGAGAAGTTTGGGGG + Intergenic
986427252 5:7646260-7646282 TTTTACCTTGAGAGGTATTGAGG + Intronic
989781546 5:45271231-45271253 TTTTACCTTTTGTAGTTTGTGGG + Intronic
992461754 5:76966931-76966953 TTTTTCATTAAACAGTTTGGAGG - Intronic
995427113 5:112037628-112037650 TTTTAGCTTAAGGAGTTTTGGGG - Intergenic
995712643 5:115050685-115050707 TTTCAACATGAGCATTTTGGGGG - Intergenic
996227161 5:121014153-121014175 TTTTTCCTTGAGTATTTTGTTGG + Intergenic
997102174 5:130981317-130981339 TATTGCTTTGAACAGTTTGGAGG - Intergenic
997696509 5:135865355-135865377 TTTGAGCTTGAGCAGGCTGGTGG - Intronic
997727873 5:136137034-136137056 TTTTGCCTTGGGCAGCTAGGGGG + Intronic
998767439 5:145503515-145503537 TTTTTCATAGGGCAGTTTGGAGG - Intronic
999464079 5:151784763-151784785 GTTTCCCTTGAGCTCTTTGGTGG + Intronic
1000981068 5:167817776-167817798 TTTTACCTTCAGCCTTGTGGGGG + Intronic
1001142372 5:169155435-169155457 TTATACCTTTAGCAGCTTGTGGG - Intronic
1003478572 6:6509387-6509409 TTTTACCGTAAGCAGTCAGGAGG + Intergenic
1004442192 6:15664024-15664046 TCTTACCTTGAGCAAATTGGTGG - Intergenic
1005192258 6:23238370-23238392 CTTTACCTTGAGCAGTTTGTGGG + Intergenic
1008832501 6:55783008-55783030 TTTCACCTTGAGAAGAATGGAGG + Intronic
1008856292 6:56091934-56091956 TTTTATCTTGGGCAGCTAGGTGG - Intronic
1010260605 6:73811709-73811731 TATTCCCTTGATCAGTTTTGTGG + Intronic
1011227099 6:85119676-85119698 CTTTAACGTGAGCAGTCTGGAGG - Intergenic
1011553636 6:88551878-88551900 TTTTACCTTTAGAAATTTCGAGG + Intergenic
1011768477 6:90649880-90649902 TTTATCCTTGAGCAGTATAGTGG - Intergenic
1015025089 6:128522360-128522382 TCTTACCTTGCCCATTTTGGGGG + Intergenic
1015201950 6:130592756-130592778 TTCTACCTTGAGCAGCTGAGGGG + Intergenic
1015633351 6:135252817-135252839 TTTTTCCTTGATCAGTTTGGAGG + Intergenic
1016393376 6:143597311-143597333 TTTTGCCTTGAGCAGTTGTACGG + Intronic
1018471896 6:164104969-164104991 ATAGACCTTGAGCAGCTTGGGGG + Intergenic
1019138564 6:169928372-169928394 TTTTAACTTGAGGAATATGGAGG + Intergenic
1019877808 7:3830443-3830465 CTTTAATTTTAGCAGTTTGGGGG + Intronic
1020402760 7:7796877-7796899 TTTTCCCCAGAGGAGTTTGGGGG - Intronic
1020598027 7:10236269-10236291 TTTCATCTTTAGAAGTTTGGAGG + Intergenic
1020717276 7:11690631-11690653 ATTCACCTTGAGCCCTTTGGCGG + Intronic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1022291354 7:29006795-29006817 TTTTGCCTTGTACAGTTTTGGGG - Intronic
1022845714 7:34207637-34207659 TTTGACCTTGAGAAGTCTGGAGG + Intergenic
1024575848 7:50763654-50763676 TTCTGCCTTGTGCAGTTTGGTGG - Intronic
1025550641 7:62243436-62243458 CTTTTGATTGAGCAGTTTGGAGG + Intergenic
1029608912 7:101616180-101616202 TATTCCCCTGAGCATTTTGGGGG + Intronic
1032160510 7:129505949-129505971 GTTTTCCTTAAGGAGTTTGGAGG + Intronic
1035488607 7:159252471-159252493 TTTTGACTTAAGCAGTTTGGTGG - Intergenic
1037236878 8:16730733-16730755 TTTTGGCTTGAGCAGTTGAGTGG - Intergenic
1037667793 8:20985342-20985364 TTATCCCTTGAGCAGTGTTGAGG - Intergenic
1037740333 8:21603880-21603902 TTTTTCCTTCAGAACTTTGGGGG - Intergenic
1037760890 8:21740833-21740855 TTCTGGCTTGAGCAGCTTGGTGG - Intronic
1037926538 8:22847816-22847838 TCTTTCCTGGAGCATTTTGGGGG - Intronic
1039655525 8:39400581-39400603 TTTTACCATAAGCAGTCAGGAGG + Intergenic
1041844472 8:62311897-62311919 TTTTACCATGGGATGTTTGGAGG + Intronic
1041989617 8:63970627-63970649 TTTTAACTTGAGAAATGTGGTGG - Intergenic
1043055327 8:75430646-75430668 TTTTACCTTTAGAGGTTTTGAGG - Intronic
1045770813 8:105737748-105737770 ATTCACCTTGAGCAGCATGGTGG + Intronic
1045951446 8:107855950-107855972 TTTTACCTTGAACATCATGGAGG - Intergenic
1046254229 8:111675159-111675181 TATTAGCTTAAGGAGTTTGGGGG + Intergenic
1046405335 8:113765228-113765250 TTTAGCCTGGAGCAGTCTGGGGG + Intergenic
1046519953 8:115311225-115311247 TTTTACCTTAAAAAGGTTGGAGG - Intergenic
1047068362 8:121313600-121313622 TTTTAACTTTATCATTTTGGTGG + Intergenic
1050471643 9:5998049-5998071 TTTTGGCTAGAGCAATTTGGTGG + Intronic
1050584845 9:7099958-7099980 ATTTATCTTGAGGAGTTTGGGGG + Intergenic
1051203116 9:14652442-14652464 TTTTACCATGTGAAGTTTTGAGG - Intronic
1056573975 9:87841090-87841112 TTTCAACTTCATCAGTTTGGTGG + Intergenic
1058765901 9:108182511-108182533 AATTTCCTTGAGCATTTTGGCGG + Intergenic
1058781060 9:108335993-108336015 AGTTACCTTGTGGAGTTTGGTGG - Intergenic
1059369904 9:113820821-113820843 TTTTACCATTAGCAGTCAGGAGG - Intergenic
1186083763 X:5963464-5963486 TTTTACTTTAAGCAGTCAGGAGG - Intronic
1189229147 X:39438578-39438600 TTTTACCTTTGGCTTTTTGGGGG - Intergenic
1190335475 X:49259186-49259208 TTTTAGCTTGAGCAGCTGGAAGG + Intronic
1192293459 X:69822323-69822345 TTTTACCTTCAAAAGTTTGTAGG + Intronic
1192360746 X:70437477-70437499 TTTCACTTTGAGCACCTTGGTGG + Intergenic
1193580337 X:83256808-83256830 TTTTACTTTCAGTAGTTTTGGGG - Intergenic
1195092579 X:101475414-101475436 TTTTACCTATAGTGGTTTGGAGG - Intronic
1197265179 X:124361801-124361823 TTTTACCATAAGCAGTCAGGAGG - Intronic
1197839410 X:130729526-130729548 TTATACTTTGAGCTGGTTGGAGG - Intronic
1198178748 X:134183188-134183210 TTTTGCCTGGAGCATTTTGCCGG - Intergenic
1198185859 X:134253720-134253742 TTTTATTTTTAGCACTTTGGGGG - Intergenic
1200000680 X:153058344-153058366 CTTTACCAAGAGCAGGTTGGAGG - Exonic
1201409485 Y:13684694-13684716 TATCAGCTTAAGCAGTTTGGGGG - Intergenic