ID: 947795482

View in Genome Browser
Species Human (GRCh38)
Location 2:232891388-232891410
Sequence CTGGAAAGGCAGGATGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 713}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947795476_947795482 2 Left 947795476 2:232891363-232891385 CCAACAGCTTGAGGCGTGTGATC 0: 1
1: 0
2: 3
3: 1
4: 46
Right 947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG 0: 1
1: 0
2: 4
3: 71
4: 713
947795475_947795482 8 Left 947795475 2:232891357-232891379 CCTGGACCAACAGCTTGAGGCGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG 0: 1
1: 0
2: 4
3: 71
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947795482 Original CRISPR CTGGAAAGGCAGGATGAGGA AGG Exonic
900138133 1:1127514-1127536 CTGGAGGGGCAAGATGGGGAGGG - Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902409659 1:16205568-16205590 CTGGAAGGGCAGGATAAGGAAGG + Exonic
903036020 1:20493109-20493131 CTGGCAGGGCTGGATGGGGAGGG - Intergenic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903259735 1:22124941-22124963 CTGGAAAGGCAGACTGGGCAGGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904400609 1:30254158-30254180 CAGGAAGGGCAAGATGAGGCCGG - Intergenic
904565804 1:31427685-31427707 CTGCAAAGTGAGGATGAGGATGG - Intronic
904600198 1:31668748-31668770 CTGGAAAGGGAGGAAGAGCTGGG - Intronic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
905343534 1:37295628-37295650 CAGGAGAGTCAGGATGAGTACGG + Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906142036 1:43539651-43539673 CTGGAAAGGTCAGATGGGGAGGG + Intronic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
907256002 1:53179669-53179691 TTGGTGAGGCAGGATAAGGAAGG - Intergenic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907765935 1:57410500-57410522 TTGGAAAGGCAGGCAGAGGCAGG + Intronic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
910059336 1:83069626-83069648 CTGTAAAGGCATGTTGAGGTAGG + Intergenic
910369219 1:86498239-86498261 GTGGAAAGACAAGATCAGGATGG + Intronic
910730054 1:90385286-90385308 CTGAGAAGGCAGCATGGGGAAGG + Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911175297 1:94811870-94811892 CAGGAAAGGCAAGATGGGGAAGG + Intergenic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
912496440 1:110094943-110094965 CAGGAGGGGCAGGACGAGGATGG + Intergenic
912711116 1:111950610-111950632 CTTGAAAGGCAGGCAGATGAAGG + Intronic
913158931 1:116128220-116128242 CTGGAACAGCTGGATGAAGATGG + Exonic
913321105 1:117589122-117589144 CTGGAAAGCCTTGCTGAGGATGG + Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913670380 1:121092769-121092791 CTGGAAAGGGAAGATAAGAAAGG + Intronic
914022147 1:143880210-143880232 CTGGAAAGGGAAGATAAGAAAGG + Intergenic
914447538 1:147762531-147762553 CCAGAAAGGCAGTATTAGGAAGG + Intronic
914660632 1:149788139-149788161 CTGGAAAGGGAAGATAAGAAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915497726 1:156293444-156293466 ATGCTAAGGCAGGATGAAGAGGG + Exonic
915585510 1:156841795-156841817 CTGGAAAGTGAGGGTGAGGGTGG + Intronic
915589247 1:156861230-156861252 CTGGTCAGGCAGGACGAGCACGG + Intronic
915601172 1:156924144-156924166 GTGGGAAGGGAGGCTGAGGATGG - Intronic
915690189 1:157681052-157681074 CTGGAAGGCCTGGACGAGGAAGG + Exonic
915715304 1:157939688-157939710 CTGGAAAGGGAGGATGACCCTGG - Intergenic
916248385 1:162710841-162710863 CTGGAAAGGCTGGAGTATGAAGG - Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
917920456 1:179745267-179745289 CTGGAAAGGCAAGGTGAGATGGG + Intronic
918014698 1:180622054-180622076 CTCAACAGGCAGGATCAGGAAGG - Intergenic
918392712 1:184083172-184083194 CTGGAATGGCAGGAATTGGATGG - Intergenic
919793730 1:201308719-201308741 CTGGACAGGCAGGGTGGGGCTGG + Intronic
920069384 1:203291277-203291299 CGGGAAAGGCAGGTTCTGGAGGG - Intergenic
920760568 1:208780138-208780160 CTGGAAAGACAGGTTTGGGAAGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920937512 1:210449399-210449421 CGGGAAAGGCATGATCAGAAAGG - Intronic
921035638 1:211375883-211375905 CTGGATAGGGAAGATGAGGGAGG - Intergenic
921890161 1:220345816-220345838 CAGGAGGGGCAGGATCAGGAAGG - Intergenic
921906310 1:220498797-220498819 CTGGAAAGACAGGCAGAGAAAGG - Intergenic
921913260 1:220576012-220576034 CTGAAAAGAAAGGATGAGGGAGG - Intronic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922058686 1:222066523-222066545 CTGGGAAGGCAGGAAAAGTAGGG + Intergenic
922360444 1:224816903-224816925 ATGGGAAGGCAAGATGTGGAAGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924278676 1:242413721-242413743 ATGGAAAGGTAGGAAGAGGCAGG + Intronic
1063065500 10:2604230-2604252 CTGGAAAGTCGGGGTGATGAAGG + Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1065565542 10:27004164-27004186 CTAGAAAGACAGGAGGAGAAGGG + Intronic
1065870551 10:29952688-29952710 ATGGCAAGGCAGGAGCAGGAGGG + Intergenic
1066045888 10:31595336-31595358 CTGGAAGGGAAGGAAGGGGAGGG + Intergenic
1066471636 10:35703491-35703513 CTGGAAAGTGAGCATGAAGATGG - Intergenic
1067249002 10:44571625-44571647 CTGAAAGGGCAGGATGTTGAAGG + Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1068042637 10:51845242-51845264 CTGGAAAGACAGCAAGAAGAGGG - Intronic
1068054097 10:51989394-51989416 CTGGAAGGGACGGATGAGGCAGG + Intronic
1068139139 10:52982743-52982765 CTGGAAATGCATGATGGTGATGG - Intergenic
1068222146 10:54058069-54058091 CTCAAAAGGCAGGAAGATGAGGG - Intronic
1069234438 10:66052388-66052410 CTTGAAATGAAGGATGGGGAAGG + Intronic
1069534387 10:69242135-69242157 TGGGAAAGCCAGGCTGAGGAGGG - Intronic
1069617308 10:69814277-69814299 CTGGAAAGGGAGGGTGAGTGAGG - Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070686832 10:78491191-78491213 CTGGACAGGTGGGAAGAGGAAGG + Intergenic
1071087447 10:81879054-81879076 CTTTAAAGGCAGGAGGAGAAAGG + Intronic
1071368766 10:84928715-84928737 CTGAGAAGGCAGGAAGGGGAAGG + Intergenic
1071450952 10:85791001-85791023 TGGGAAAGGCAGGATTAGAAGGG - Intronic
1071508888 10:86249149-86249171 CTGGAAAGCCACGATTAGGTGGG + Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071751252 10:88478642-88478664 CTGGAAAGGGCAGTTGAGGATGG - Intronic
1072039064 10:91590482-91590504 CTGGACCCGCAGGATGGGGAGGG + Intergenic
1072085657 10:92076876-92076898 AGGGAAAGGAAGGAAGAGGAAGG + Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073440196 10:103547976-103547998 CTGGATGGGGAGGGTGAGGAAGG - Intronic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1075021848 10:118957896-118957918 CTGGAACTGCAGGATGTCGACGG + Intergenic
1075340423 10:121643385-121643407 CAGCAAGGGCAGGGTGAGGATGG - Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075592858 10:123705029-123705051 CTGGGCAGGCGGGATGGGGAAGG + Intergenic
1075595178 10:123724037-123724059 CTGGGAAGGGAGCATGAGGGAGG - Intronic
1075614594 10:123882291-123882313 CTGTAAAGGCCAGAGGAGGAAGG + Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075918221 10:126188039-126188061 CTGGAAAGCCAGGCTGTGAAGGG + Intronic
1076005012 10:126941852-126941874 CTGCAAAGGCGGGCTGAGAAAGG - Intronic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076323613 10:129602736-129602758 CTGGAAAGGAAGGAGGGGGAGGG - Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076519654 10:131073648-131073670 CTGGATGGGCAGGATGTGGATGG + Intergenic
1076542688 10:131224122-131224144 CTGGAAAGAGAGGGAGAGGATGG - Intronic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077351530 11:2095306-2095328 CTGGAGAGGGAGGTTGAGGTGGG - Intergenic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1078174110 11:8955880-8955902 CTGGAAAGGCAAGGAGAGGAGGG + Intronic
1078417877 11:11180513-11180535 CTGGAAAGGTGGGAGGAGGTAGG + Intergenic
1078461167 11:11516157-11516179 CTGGAAGGGAAGGATGTGTAGGG + Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078938884 11:15977970-15977992 ATGGAAAGGCAGGCAGAGAATGG - Intronic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079884682 11:25972471-25972493 CCAGAAAGGCAGGATGGGGGTGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080820654 11:35802952-35802974 AGGGAAAGGCAGGAGGAGGCAGG + Intronic
1083339374 11:61949156-61949178 CAGGAAAGGGAGGATGAGAGTGG + Intergenic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083682594 11:64358329-64358351 AGGGAAAGGCAGGAAGAAGACGG + Intergenic
1083796987 11:65022631-65022653 CAGGACAGGCATGATGAGCAAGG + Intronic
1083904287 11:65660061-65660083 CAGGAAAGGCGGGCTGGGGAGGG + Intronic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1083990025 11:66241317-66241339 CCGGGAGGGCAGGCTGAGGAAGG - Intronic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1085041494 11:73328927-73328949 CTAGAGAGGCAGGATGGAGAAGG + Intronic
1085240895 11:75054249-75054271 CTGAAAAGTCAGGAGTAGGATGG - Intergenic
1085324000 11:75592840-75592862 CAGGAAAGGCAGGAAGGAGAGGG - Intronic
1086139377 11:83477911-83477933 CTAGCTAGGCAAGATGAGGAAGG - Intronic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087126385 11:94630366-94630388 CTGAGAAGGAAGGAAGAGGAGGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1089166242 11:116478875-116478897 CTGGAAAGACAAGATGATAAAGG + Intergenic
1089667966 11:120032349-120032371 CAGGAAAGGGACGATGAGGGAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090183034 11:124717711-124717733 CTGGAAAGGAAGGGTGAGTCGGG + Intergenic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090653580 11:128825973-128825995 CTGGCATGGAAGGAGGAGGAAGG + Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091406024 12:210014-210036 CTGGGTGGGCAGGATGACGAGGG + Exonic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091608787 12:1984683-1984705 CTGGAATTGCAGGATGAAGTAGG - Intronic
1091670316 12:2447721-2447743 CTGGCTAGGCAGGAGGAGGTGGG + Intronic
1091838221 12:3600953-3600975 CTGGAAATGCAGCATGGTGAGGG - Intergenic
1092511233 12:9159006-9159028 GTGGAAGGGCAGGATGATGGAGG - Intronic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1093582411 12:20797922-20797944 CTAGAAAGGGAGGCTGAGGCAGG - Intergenic
1093976486 12:25427522-25427544 ATAGAAGGGCAGCATGAGGAAGG - Intronic
1095180751 12:39144779-39144801 CGGGAAAGGCAGTAGGAGGGAGG + Intergenic
1095211450 12:39499600-39499622 TTGGAAAGCAAGGATGAGAAAGG - Intergenic
1096848293 12:54419512-54419534 CTGGAAAGGAATGGGGAGGAAGG - Intergenic
1096849766 12:54428102-54428124 CTGGACAGGCTGGAGGAGGTTGG + Intergenic
1097284060 12:57864370-57864392 ATGGAAAGGCAGGGTGGAGAAGG - Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1099241234 12:80141965-80141987 CAAGAAAGGAAGGTTGAGGATGG - Intergenic
1101722923 12:107366118-107366140 CTGGGAAGGCAGGGTGTGGCAGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102726443 12:115069702-115069724 TTGAAAAGGCAGGAAAAGGAGGG - Intergenic
1103235383 12:119368192-119368214 GGGGAAGGGCAGGAGGAGGAGGG + Intronic
1104944525 12:132409706-132409728 CTGGAAAGCCAGGGTGGAGATGG - Intergenic
1105484615 13:20814791-20814813 CTGGAAATGCAGGGTGGAGAAGG + Intronic
1105548725 13:21371624-21371646 CTGGAAAGGCAGGATGCCTGTGG + Intergenic
1105635137 13:22209206-22209228 CTGGAAAGGTAGGCTGGGGCTGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106356621 13:28989648-28989670 CTGGATGGGGAGGATGAGGGTGG + Intronic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107303359 13:38991299-38991321 CTGGAAAGGGAGGAAGGGGCAGG - Intergenic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1114266891 14:21077966-21077988 CTGTAAAGTCAGGATAAGAAAGG - Intronic
1115514632 14:34173327-34173349 CTGGAAAGGTGGTATGAAGATGG - Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118700356 14:68426904-68426926 CTGGAAAGTCAGCCTGTGGATGG - Intronic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1118793949 14:69122625-69122647 CTGGAAAGACAGGAACAGGGTGG - Intronic
1119030773 14:71190716-71190738 CTGAGAAGGCTGGGTGAGGAAGG + Intergenic
1119122054 14:72088779-72088801 GCAGAAAGGCATGATGAGGAGGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119800212 14:77437709-77437731 ATGGATAGGCAGGAAGGGGAGGG - Intronic
1121066277 14:90969085-90969107 ATGGAAAGGCAGGTAGAGAATGG + Intronic
1121123207 14:91389306-91389328 CGGGAAGGCCAGGAGGAGGATGG - Intronic
1121316554 14:92964392-92964414 CAGGAAAGTCAGGGTGGGGAGGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121622982 14:95363065-95363087 CAGGGAAGGTTGGATGAGGACGG - Intergenic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122569425 14:102684498-102684520 GCGAGAAGGCAGGATGAGGACGG + Intronic
1122731658 14:103804187-103804209 CAAGAAATGCAGGATGAGGCAGG + Intronic
1122819375 14:104333499-104333521 CTGGAAAGGCCTGTTGATGATGG + Intergenic
1123184615 14:106504977-106504999 CTCGAAAGTCAGGAAGACGACGG - Intergenic
1124129195 15:26970121-26970143 CTGGATAGGCATGAAGTGGAGGG - Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125716177 15:41821197-41821219 CTGCAAAGCCAGGATGGGGGTGG + Intronic
1125731320 15:41894158-41894180 CGGGGAAGGGAGGATGATGAAGG - Intergenic
1126683157 15:51223734-51223756 CTTGGAAGGAAGGTTGAGGAAGG + Intronic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127197275 15:56601806-56601828 CTGGAAAGGCAGTTTGAGCTTGG + Intergenic
1127921448 15:63497639-63497661 CTGGCAAGGTAAGATGATGAAGG - Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128568138 15:68714656-68714678 CTGGAAAGGTAGTAGGAGGTGGG + Exonic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128775104 15:70314172-70314194 CTGCCATGGCAAGATGAGGAAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129292753 15:74581003-74581025 CTGTCAAGGCAGGATGGGGTAGG + Intronic
1129450208 15:75647449-75647471 CGGAAAAGGCAGGAGGATGACGG + Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130779238 15:87017221-87017243 CTGGACAGTCCAGATGAGGAAGG + Intronic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1131422079 15:92315301-92315323 CTGGAAAGGCAGGAGGGAGGAGG - Intergenic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132758191 16:1496129-1496151 CGGGAAAGGCAAGAGAAGGAAGG - Intronic
1132970109 16:2682974-2682996 CTGGGAGGGGAGGGTGAGGATGG + Intronic
1132981468 16:2740451-2740473 CTGGAAAGGGCAGGTGAGGAAGG - Intergenic
1133618673 16:7504944-7504966 CTGGAAAGGCATGCTGCGTAGGG - Intronic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1134102345 16:11461092-11461114 CTGGAGAGGAAGGAGGAGAATGG - Exonic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135977494 16:27118592-27118614 CTGGAATGCAAGGAGGAGGATGG + Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137495895 16:48969095-48969117 CTTAAAAGCCAGGATGAGGCAGG + Intergenic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1138310586 16:56020195-56020217 ATGGCAGGGCAGGATGACGAAGG + Intergenic
1138441939 16:57040569-57040591 GTGGAAGGCCAGGCTGAGGATGG + Intronic
1138499816 16:57433498-57433520 AGGGATAGGAAGGATGAGGATGG + Intronic
1138519894 16:57565011-57565033 CTGGAAGGGCAGCAGGAGAAGGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139535624 16:67571232-67571254 CTGCAAAGTCAGTTTGAGGAGGG - Exonic
1139749378 16:69099952-69099974 CTTGAAGGTCAGGATTAGGAGGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140965986 16:79966515-79966537 AAGGAAAGGAAGGTTGAGGAAGG - Intergenic
1141010447 16:80392049-80392071 CTAGAATGGCAGAATGATGAGGG + Intergenic
1141072761 16:80973168-80973190 ATGGAAAGGCAGGATGTACAGGG + Exonic
1141615610 16:85207892-85207914 CTGGAAAGGCACGATGTTGCTGG + Intergenic
1141822692 16:86458034-86458056 CTGGAAAGGAAGGAAGGAGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142001725 16:87668151-87668173 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142308069 16:89296743-89296765 CCGGAAGGCCGGGATGAGGAAGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142601749 17:1056398-1056420 CAGGATAGGCAGGATTTGGAGGG - Intronic
1142682099 17:1556088-1556110 CTGTTAAGTCAGGATGGGGATGG + Intronic
1143298114 17:5886493-5886515 CTAGAAAGCCAGGATGGTGATGG + Intronic
1143318552 17:6052425-6052447 CCTGAAGCGCAGGATGAGGAGGG + Intronic
1143496003 17:7312958-7312980 CCGGAAAAGCAGGATTAGGTAGG - Intronic
1143659553 17:8316096-8316118 CTGGAAGGGCAGTAGCAGGAAGG - Exonic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1144212267 17:13025653-13025675 CTGGAAAGAGAGGGAGAGGATGG - Intergenic
1144644636 17:16963848-16963870 CTTGAAAGACTGGATGAGAAAGG - Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1145777398 17:27539005-27539027 CTGGAAGGGAGGGATGGGGAAGG - Intronic
1146173746 17:30651692-30651714 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146347202 17:32067713-32067735 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146457195 17:33017326-33017348 CTGGCAGGGAAGGATGGGGAGGG - Intronic
1146886574 17:36474780-36474802 CTGGGAGGGAAGGGTGAGGAGGG + Intergenic
1146972988 17:37087440-37087462 CTGGAAAGGAAGATTGAGAATGG + Intronic
1147164118 17:38584414-38584436 GGGGAAGGGCAGGGTGAGGAAGG + Intronic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147402670 17:40190555-40190577 CTGGAATGGAGGGCTGAGGAGGG + Intronic
1147510706 17:41066537-41066559 TTGGATTGGAAGGATGAGGAGGG - Intergenic
1147548819 17:41423742-41423764 CAAGTAAGTCAGGATGAGGAGGG - Exonic
1147556943 17:41485665-41485687 CTGGCATGGCTGGCTGAGGATGG + Intergenic
1147795885 17:43042462-43042484 CTGGAAAGGAAGGAGGAGAAAGG - Intergenic
1148091085 17:45022862-45022884 GTGGCCAGGCAGGATGAGGGTGG - Intergenic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148793520 17:50186591-50186613 CTGGCATGGCAGGAGTAGGAGGG + Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149461836 17:56834706-56834728 CCGGAAAGGCAGGAAGGGGGCGG + Intronic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1150006224 17:61470597-61470619 CTTGGAAGGCAGGTTCAGGAGGG + Intronic
1150226425 17:63527076-63527098 CAGGAAAGGCAGGCTGGGGTGGG - Intronic
1150227308 17:63531038-63531060 CAGGCAGGGCAGGATGAGGCTGG + Intronic
1150259539 17:63777406-63777428 CTGGAAAGGGAGTTTGAGGAAGG + Intronic
1150647031 17:66985143-66985165 CAGATAAGGCAGGATGAGGGCGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151825058 17:76519402-76519424 CGGGAGAGGGAGGATTAGGAAGG - Intergenic
1151858682 17:76741980-76742002 CGGGAAAGGCTGGATGAAAACGG - Exonic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1156497729 18:37537033-37537055 CGGGAAAGCCAGGCTGAGGATGG - Intronic
1156704154 18:39859600-39859622 CTGGGATGACAGGGTGAGGAAGG + Intergenic
1157120792 18:44909163-44909185 ATTGAAAGGAAGGATGAGTAAGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157322675 18:46646572-46646594 CTGGAAGGCCAGGCTGAAGAAGG - Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157658229 18:49414229-49414251 CTGGAAAGGGATGGTGGGGATGG + Intronic
1157729133 18:49988711-49988733 CTGGGAAGGAAAGAGGAGGATGG + Intronic
1157854941 18:51097003-51097025 AGGGAAAGGCAGGAGGAGGGAGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158278204 18:55791910-55791932 GTGGGAGGGCAGGATGGGGAGGG - Intergenic
1158580934 18:58682091-58682113 TTGGAAAGGCAGGTTGAGCTTGG + Intronic
1158686210 18:59616837-59616859 CAGGAAAGTCAGGATGAGAAAGG - Intronic
1158807917 18:60997606-60997628 CTGAGAAGGCAGGATCAGGTGGG + Intergenic
1159010728 18:63057071-63057093 TGGGAAGGGAAGGATGAGGATGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1160389904 18:78522083-78522105 CTGGATGGGGAGGTTGAGGATGG - Intergenic
1160799541 19:961293-961315 CCGGAAGGGAAGGAGGAGGAGGG + Intronic
1161015611 19:1981401-1981423 CCGGACAGGCAGGATGGGGATGG - Intergenic
1161130643 19:2586515-2586537 CTGAAAGGGAAGGATGGGGAGGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162563309 19:11430660-11430682 CTGGAAATGAAGGAGGAGGTGGG + Intronic
1162988671 19:14288348-14288370 CGGGAGAGGCAGGCTGAGCAGGG + Intergenic
1163340801 19:16705593-16705615 CTGGGAAGGGAGGCTGAGGCAGG + Intergenic
1163421180 19:17214554-17214576 CTGGAGTGACAGGATGAGGGTGG - Intergenic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1164485745 19:28654576-28654598 CTGGAAAGCCAGCATAGGGAGGG + Intergenic
1164521370 19:28982606-28982628 GTGGAAAGGAAGGATGATGGAGG + Intergenic
1164533465 19:29065571-29065593 GTGCACAGGCAGGCTGAGGAGGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166167656 19:41003743-41003765 ACAGAAAGGAAGGATGAGGAAGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166376629 19:42331091-42331113 CTGGTGAGACAGGATGAGGCCGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167143412 19:47667706-47667728 CTGGCATGGAAGGAGGAGGAAGG - Intronic
1167982187 19:53284433-53284455 CTGGAAAGTCTGGGTGGGGACGG - Intergenic
1167983957 19:53299540-53299562 CTGGAAAGTCTGGGTGGGGACGG + Intergenic
1168277924 19:55287323-55287345 CTGGAGAGGGAGGATGGGGTAGG - Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
1168667472 19:58215255-58215277 CTTGCAAGACAGGAAGAGGAAGG + Intergenic
1168669621 19:58230704-58230726 CAGGATGGGCAAGATGAGGAGGG + Intronic
925142364 2:1558982-1559004 CGGGAAGAGCAGGGTGAGGAGGG + Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925260783 2:2526693-2526715 TTGCAAAGGCAGGAACAGGAAGG - Intergenic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
926383908 2:12317299-12317321 AGGGAAAGGCAAGATAAGGATGG + Intergenic
926678124 2:15643420-15643442 CTGTTAAGGCAGTATGATGATGG + Intergenic
927250037 2:20989143-20989165 GAGGAAAGGCAGGGTGAGGCGGG - Intergenic
927674368 2:25093746-25093768 CAGGACAGGTTGGATGAGGATGG - Intronic
927889306 2:26738523-26738545 CTGGGAAGGGAGGATCAGGAAGG - Intergenic
927899957 2:26812065-26812087 CTGGAAGACCAGGATGAGGTTGG + Intergenic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
929613851 2:43292753-43292775 CTGGAATGGTAGGATCATGAAGG - Intronic
930664426 2:54088112-54088134 CTGGAAAGGTGAGAAGAGGAGGG + Intronic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
931267583 2:60674195-60674217 CTGCAAAGGGAGGCTGAGGCAGG + Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931937745 2:67217002-67217024 GTGAAATGGCAGGATGAGGGTGG + Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932323413 2:70838316-70838338 ATGGAAATGCAGGCTGAGGTAGG + Intergenic
932509736 2:72273706-72273728 CTGGAAAGGCAGGCAGGGGCTGG + Intronic
934540132 2:95166889-95166911 TTGGAAATGCAGGATGAGTCTGG + Intronic
934553740 2:95276894-95276916 CTGGGGAGGCAGGATGGGAATGG + Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
937494932 2:122408452-122408474 CTGGAAAGGAAGGAGCAAGAGGG + Intergenic
938556609 2:132430356-132430378 CTGGAAAGGCAGGCTGGGGGTGG + Intronic
938985558 2:136571982-136572004 CTGGAAAGGGAGGAAGGGGCCGG - Intergenic
939010297 2:136838620-136838642 TTTGAAAGGGAGGATGGGGAAGG - Intronic
939070049 2:137528245-137528267 TTGGAAAGGAAGCATGATGAAGG + Intronic
939238363 2:139526674-139526696 CTAAAAAGGCAAGAAGAGGAAGG + Intergenic
939505989 2:143047805-143047827 CTGTAATGGGAGGCTGAGGAGGG - Exonic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940500684 2:154489884-154489906 CGGGGAAGGCAAGGTGAGGAGGG - Intergenic
940656798 2:156496971-156496993 GTGGAAAGGCATGATGAAAATGG + Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941147993 2:161876577-161876599 CTGAAATGGAAGGATCAGGATGG + Intronic
941216124 2:162711505-162711527 CTGAAAATGCAGGATGAAGATGG - Intronic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
942235680 2:173902318-173902340 CTGCCAAGGCAGGATTGGGAGGG + Intergenic
942507354 2:176657062-176657084 ATAGAAAGGGAGGAGGAGGAGGG + Intergenic
944301855 2:198132590-198132612 CTGGATAGGAAGGATTAGGGAGG + Intronic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
945221140 2:207485481-207485503 CTGGAAAGGAAGGTAGAGGAAGG + Intergenic
945350239 2:208769042-208769064 CTGGAAAGGCAGAATGATTTTGG - Intronic
946009079 2:216550298-216550320 CTGGAAAGCCAGGCAGAGGCAGG - Intronic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946322368 2:218961340-218961362 ATGGAAAGGCAGGGAGAGGGAGG - Exonic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946693238 2:222325759-222325781 CTACAAAGGGAGGCTGAGGAGGG + Intergenic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
947724700 2:232389544-232389566 CTGGAAAGGCAGTCTGCGGGGGG - Intergenic
947730042 2:232422952-232422974 CTGGAAAGGCAGTCTGCAGAGGG - Intergenic
947790779 2:232867653-232867675 CTGGGGAGGCAGGACGAGGCAGG - Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948461024 2:238130098-238130120 CAGGAAGGGCAGGGTGAGCAGGG - Intronic
948715718 2:239860524-239860546 CCAGAAAGACAGGATGAAGATGG + Intergenic
948766501 2:240224515-240224537 CTGGAGAGGATGGATGAGGGAGG - Intergenic
948874124 2:240818367-240818389 CTGGACCGGAGGGATGAGGAGGG - Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
1169146673 20:3257141-3257163 CCTGAAAGGCAGGATGAGAAAGG + Intronic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170296545 20:14832436-14832458 ATGGAATGGCAGTTTGAGGAAGG + Intronic
1170363886 20:15579175-15579197 CTAGACAGGCAAGATGAGGCTGG - Intronic
1170693556 20:18636966-18636988 CTGGAGTGTCTGGATGAGGAAGG + Intronic
1170702284 20:18714119-18714141 AAGGAAAGGCAGGATGAGAAAGG + Intronic
1171283038 20:23917417-23917439 CTAGAAAGCCAGGAGGAGAATGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171886513 20:30656331-30656353 CTGGAATTGCAAGATGAAGATGG + Intergenic
1172105802 20:32516742-32516764 CTGGCAAGGAGGGATGTGGAGGG + Intronic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1173043917 20:39491413-39491435 CGAGAAATGAAGGATGAGGATGG + Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173568012 20:44055643-44055665 CTGGAACGGCAGCATAAGGCAGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174377810 20:50138234-50138256 CTGGAAGGTCAGGATGGGGTGGG - Intronic
1174934949 20:54857250-54857272 TGGGAAAGGCAGGATGGGGTAGG - Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1175939942 20:62533291-62533313 CTGGACAGGCTGGACGTGGAGGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176954488 21:15085507-15085529 ATGGAAAGGAAGGATGATCAAGG - Intergenic
1177608599 21:23415971-23415993 CTGGAGAGGAAGGAATAGGAAGG + Intergenic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1178225542 21:30713381-30713403 CTGGAGAGGAAGGATAAAGAAGG + Intergenic
1178427885 21:32493451-32493473 CTGGAAAGGCGGGAGTAGGCGGG - Intronic
1178845330 21:36169756-36169778 AAGAAATGGCAGGATGAGGATGG - Intronic
1178873808 21:36397081-36397103 CAGGTCAGGCAGGATGAAGAGGG - Intronic
1178966847 21:37128231-37128253 CTGGTATGGCAGGAGGAGCAGGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179942142 21:44647233-44647255 CTGGACTGGCAGGAGGAGGTGGG - Exonic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180743071 22:18067264-18067286 CTGGAGAGGGGGGATCAGGAAGG - Intergenic
1180927881 22:19568572-19568594 GGGGAAGTGCAGGATGAGGAGGG + Intergenic
1181283771 22:21737575-21737597 CTGGAGAGGGATGATGATGATGG - Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181751683 22:24993249-24993271 CTAGGGAGGCAGGGTGAGGAAGG + Intronic
1182790961 22:32952312-32952334 GTGGACAGGCAGGGTGGGGAGGG + Intronic
1183498877 22:38166242-38166264 GTGGAAGGGCAGGATGCAGAAGG - Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183679107 22:39316782-39316804 AAGAAATGGCAGGATGAGGATGG - Exonic
1183878236 22:40802705-40802727 CTGGAAAGACTGGATCAAGAGGG + Intronic
1184122296 22:42459912-42459934 CTGGCAAGGCAGGGTGGGGAGGG - Intergenic
1184190023 22:42888182-42888204 CTGGACAGCCAGGCTGAGTAAGG - Intronic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184702854 22:46188483-46188505 TTGCAAAGGCAGCATGATGAGGG - Intronic
1184797857 22:46742192-46742214 CTAGATGGGCAGGTTGAGGATGG - Intergenic
1184892599 22:47389016-47389038 CTGGGAAGGCTGGGTGTGGATGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185373347 22:50470842-50470864 CTGGAAAGGCAGGCCATGGAGGG + Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949934479 3:9106319-9106341 TTGGAAAGGCAGGATGTGAGGGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950689390 3:14643602-14643624 TTGGAATGGAAGGATGAAGAAGG + Intergenic
950764136 3:15260748-15260770 CTGGAGAGGCAGGGTGGGCATGG + Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951668549 3:25154672-25154694 ATGGAAAGGAAGGATCTGGATGG - Intergenic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952384827 3:32832778-32832800 CTAGGAAGGGAGGAAGAGGAGGG - Intronic
952729121 3:36620536-36620558 CTGGAAAGTCAGGAGCAGAAAGG - Intergenic
953005738 3:38977636-38977658 CTGGAAAGGCAGGTGAAGGTAGG - Intergenic
953241791 3:41155967-41155989 CTGGAATAGCAAGGTGAGGAAGG + Intergenic
953540342 3:43812571-43812593 CTGGAAAAGCCTGATTAGGATGG + Intergenic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954201834 3:49027917-49027939 CTGGAAAGGGATGGTGAGAAAGG + Intronic
954462179 3:50633636-50633658 ATGGCAAGGCTGGAGGAGGAAGG - Intronic
954632582 3:52055449-52055471 CTGGAAGGCCAGGATCAGGAAGG - Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955373853 3:58377530-58377552 CTCGAGAGGCAGGCTGAGGTGGG + Intronic
955943976 3:64173564-64173586 CTTGCAAGGCAGTATGAGGCCGG + Intronic
956168326 3:66413133-66413155 CTGGGAAGCCAGGATGTGTAGGG + Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957834356 3:85567918-85567940 GTGGAAGGGCAGGAGGAGAAGGG + Intronic
958636192 3:96750319-96750341 CTGCAAAGGCAGAGTGAGGGAGG - Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959063126 3:101633708-101633730 CAGAAAAGGCAGGATGCGGAAGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960324048 3:116273251-116273273 CTTGGAAGCCAGGATGAGAATGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961044044 3:123696606-123696628 TTGGAAGGGCAGGATGGGGGTGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961155909 3:124679435-124679457 CTTGATTGGCAGCATGAGGAAGG - Intronic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
962849240 3:139295574-139295596 CTGGCAGGGCCAGATGAGGATGG - Intronic
962852482 3:139318413-139318435 CTGGAAGGGCTGGATGGGGAGGG + Intronic
963938287 3:151076479-151076501 CTGCTAGGGCAGGATGAGGGAGG - Intergenic
963963701 3:151340889-151340911 CAGGAAATGTGGGATGAGGATGG + Intronic
964202746 3:154136454-154136476 CTGGAATTGCAGGATGAGAAAGG + Intronic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965516238 3:169624468-169624490 ATGGAAAGACAAGTTGAGGATGG + Intronic
965858773 3:173121462-173121484 TTGGAAAGGTAGAATGAGGTGGG - Intronic
965885276 3:173437858-173437880 TAGGGAAGGCAGGATCAGGAAGG - Intronic
966265142 3:178031359-178031381 TTGGAGAGGTAGGATAAGGAAGG - Intergenic
966735421 3:183182960-183182982 CTGGAAGGCCTGGGTGAGGAAGG - Intronic
967522662 3:190452646-190452668 CTGGAAAGTCAAGCTGAAGATGG + Intergenic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968817963 4:2831548-2831570 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
968890706 4:3367066-3367088 CTGGAAACCCAGGGTGAGCAGGG - Intronic
969092620 4:4706600-4706622 CTGCAAGGGAAGGATGAGCAAGG - Intergenic
969130156 4:4985173-4985195 CAGGGATGGCAGGATGGGGAGGG + Intergenic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
969554623 4:7898057-7898079 CTGGTTGGGAAGGATGAGGAAGG - Intronic
969990707 4:11259759-11259781 CTGGTGAGGCATGATAAGGAAGG + Intergenic
971145615 4:23973164-23973186 CAGGAAGGGCAGGAAGAAGAAGG + Intergenic
972169826 4:36332458-36332480 CTGGGAAGGCACTATGATGATGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973573706 4:52265234-52265256 CTGGAACAGCAGGATGTGAAGGG + Intergenic
974311369 4:60214608-60214630 CTTGAAAGGAAGGCTGAGGTGGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975927119 4:79470536-79470558 CTGGAGATGCATGGTGAGGATGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976382318 4:84413666-84413688 CTGGGAAGACAGCATGAAGAGGG + Intergenic
976411076 4:84714230-84714252 CTGTAATGGCAGGTTGAGGTGGG - Intronic
977432688 4:96952066-96952088 GAGGAAGGGCAAGATGAGGAAGG + Intergenic
977525501 4:98141318-98141340 CTGGAAAGGAAGGAAAACGAAGG - Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978809943 4:112838532-112838554 CTGGAAACCAAGGATGAGGTAGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
980889213 4:138796411-138796433 CTGGAAAGGCTGGGTGCTGATGG - Intergenic
980999130 4:139811283-139811305 CTGGAAACACAGGATGATGGAGG - Intronic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982248421 4:153379461-153379483 CTGGGAGGCCAAGATGAGGATGG + Intronic
982290754 4:153780139-153780161 CTGGAATGCAAGGAGGAGGAAGG - Intergenic
983472677 4:168176052-168176074 TTGGAAAGAAAGGAGGAGGATGG - Intronic
983935854 4:173502157-173502179 AGGGAAAGCCAGGTTGAGGAAGG - Intergenic
984797048 4:183671399-183671421 CTGAAAAGGCTGGAGGAGAAAGG + Intronic
984841078 4:184068135-184068157 GGGGAAGGGCAGGATGGGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986442248 5:7792691-7792713 AAGGAAAGGCAAGATGGGGAAGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987367087 5:17158504-17158526 CTGGCTAGGAAGGATGTGGAGGG - Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988493586 5:31726105-31726127 AAGGAAAGGCAGGCTCAGGACGG - Intronic
988537790 5:32084384-32084406 CTGCATTGGAAGGATGAGGACGG - Intronic
988588154 5:32525746-32525768 CTTGAAGGGTAGGATGAGCAAGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989255403 5:39361271-39361293 CTGTAGAGGTAGGATGAGGTGGG + Intronic
989349211 5:40465789-40465811 CTGGAAAGGTGGGATGAAGTGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990376272 5:55173575-55173597 CTGCAAAGGCAGGGTGTGGTTGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992763125 5:79969435-79969457 GTGGAAAGGTAGGAAGAGAATGG - Intergenic
993419234 5:87679817-87679839 CTGGAAGGGGAGGATGGGCATGG + Intergenic
993919595 5:93784279-93784301 CTAGAAAGGGAGTTTGAGGATGG + Intronic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995189892 5:109309043-109309065 CTGGAGTGCCAGGATGGGGATGG + Intergenic
995484855 5:112629796-112629818 CTGGATAGGCATTATGTGGATGG - Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996530800 5:124524935-124524957 CTGGAAAGGCAAGACAAAGAAGG - Intergenic
996543062 5:124649561-124649583 CTGCAAAGAGAGGATGGGGAAGG + Intronic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998660131 5:144227402-144227424 CTGGTAAGGGAGGAAGAGGCTGG + Intronic
999328971 5:150660120-150660142 CTGGAAGGGGAGGAGCAGGAGGG - Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999640468 5:153667300-153667322 CAGCACAGGCAGGATGATGAGGG + Intronic
999755065 5:154658188-154658210 CTGGTAAGGGAGGCTGAGGCAGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001048971 5:168399132-168399154 CAGGAAAGGGAGGCTCAGGATGG + Intronic
1001483712 5:172105298-172105320 CTTGTAAGGGAGGATAAGGAAGG - Intronic
1001487088 5:172127545-172127567 CTCCCAAGGCAGGAGGAGGAAGG - Intronic
1001516198 5:172356775-172356797 CTGGATAGGCAGCATGTGGGAGG + Intronic
1001970826 5:175953784-175953806 CGGGGCAGGCAGGGTGAGGATGG - Intronic
1002213549 5:177612163-177612185 CTGGAAAGGGCAGATGGGGAGGG + Intergenic
1002246612 5:177889980-177890002 CGGGGCAGGCAGGGTGAGGATGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1004170915 6:13294961-13294983 TTGCAAAGGCAGGAAGAGAAGGG + Intronic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1004881133 6:20009624-20009646 CTTGAAAGGGAGGATGAAGAGGG - Intergenic
1006044216 6:31280710-31280732 AAGAAATGGCAGGATGAGGATGG + Intronic
1006832919 6:36979648-36979670 CTGGAAGGAGAGGAGGAGGAGGG + Intronic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007358101 6:41335421-41335443 AGGGAAAGGCAGGCTGAGGGTGG - Intergenic
1007546527 6:42698711-42698733 CTGGAAAGGGAGGAGGAGAGGGG - Intronic
1007615185 6:43175651-43175673 CTGCAAAGGCAGGATCTGGTAGG + Intronic
1007719007 6:43874422-43874444 CTGGAAACCCATGATGAGGGCGG - Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009441440 6:63684398-63684420 CTTGAAATGAAGGATGAAGATGG + Exonic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1009518855 6:64656731-64656753 CTGGATTGGGAGGATGAGAAGGG + Intronic
1009955522 6:70448177-70448199 CTGGAAAGGAAAGATCTGGAGGG + Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1012207625 6:96480168-96480190 CAGGAAAGGCAGGATGGGCAAGG - Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013249563 6:108320783-108320805 CTGGGGTGGTAGGATGAGGAAGG + Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013412940 6:109897820-109897842 CGGGAAAGGCAAGATGGGGGTGG + Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015143977 6:129965275-129965297 CTGGAAATGGATGATGATGATGG + Intergenic
1015190192 6:130463976-130463998 ATGGAAGGGAAGGAAGAGGAGGG - Intergenic
1015195490 6:130521007-130521029 GTCGGAAGGCAGGAAGAGGAGGG - Intergenic
1015681605 6:135814695-135814717 CTGGAAAGGCAGGACATCGAGGG + Intergenic
1016811532 6:148265789-148265811 CTGGAAAGGCAGGGTTAGTTAGG + Intergenic
1017849102 6:158287866-158287888 CTTGAATGCCAGGCTGAGGAGGG + Intronic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1018058350 6:160071105-160071127 CTGGGAGGGAAGGATGAGGGTGG + Intronic
1018671051 6:166177755-166177777 CTGGACAGGTTGGATGTGGAGGG + Intergenic
1019020394 6:168913080-168913102 TTGGATAGGCAGGAACAGGAGGG - Intergenic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019464713 7:1181366-1181388 CTGAAAAGAAAGGGTGAGGAGGG - Intergenic
1020545029 7:9517074-9517096 CTGGAATGGCTGGCTGAGGTGGG - Intergenic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1021256665 7:18400570-18400592 TTGAAAAGACTGGATGAGGAAGG + Intronic
1022089501 7:27098240-27098262 CTGCAAACCCAGGCTGAGGAGGG - Intergenic
1022497628 7:30862997-30863019 CTGGATTGGCAGGCTGGGGAGGG - Intronic
1022628678 7:32064849-32064871 CTGGAAAGGAAGGCAGAGGCTGG - Intronic
1023214112 7:37842667-37842689 ATGGAAATGTAGGATGAGTATGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1024357779 7:48433606-48433628 CTGGAAATGGATGATGATGATGG - Intronic
1024377488 7:48656036-48656058 CTGGTAAGGCATGATCAGGAAGG + Intergenic
1024743663 7:52382923-52382945 CTGGAAGGGCAGGATATGCAAGG - Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025030940 7:55556220-55556242 CTAGCAAGGCAGGAGGAGGTGGG + Intronic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026603970 7:71800224-71800246 ATGAAAAGGCTGGATGATGATGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1026941176 7:74289022-74289044 CTGGACAGAAAGGATGAGGAGGG - Intergenic
1028022759 7:85797358-85797380 CTGGGAAGGGAAGGTGAGGATGG + Intergenic
1028288837 7:89040773-89040795 CTGGAAAGGCTGACTGATGAAGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1030745537 7:113161094-113161116 CTGGAATGGTAGAATGAGGATGG - Intergenic
1031211203 7:118828819-118828841 CTGGAAGGTCATGATAAGGAAGG + Intergenic
1031497250 7:122465636-122465658 GTGGAACGGTAGGATGGGGATGG - Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032635215 7:133699470-133699492 CTGTAAAGGCAAAATGAGGGAGG + Intronic
1032720848 7:134549932-134549954 CAGGAAAGGCAGGACTGGGATGG - Intronic
1033283031 7:140019060-140019082 CTGGACAGGCAGGCATAGGAAGG + Intronic
1033653049 7:143356394-143356416 CTGGAAATGGAGGACCAGGATGG - Exonic
1033707839 7:143905863-143905885 CTGGAAAGGATGGATGGAGAGGG + Intergenic
1035228564 7:157446934-157446956 CCTTAAAGCCAGGATGAGGAGGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036137424 8:6174938-6174960 ATGGATGGGCAGGATGGGGAAGG - Intergenic
1036544828 8:9757564-9757586 CTGGGAAGGAAGGAGCAGGAAGG - Intronic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037572607 8:20171421-20171443 CAGGAAGGCCAGGATGAGGAAGG + Exonic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037933014 8:22894855-22894877 CTGGAAAGGGAGGCTCAGCAGGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1039427177 8:37495523-37495545 TTGGGAAGACGGGATGAGGAAGG - Intergenic
1039521136 8:38173008-38173030 CTAGCAAGGCAGTATGATGAAGG + Intronic
1039548679 8:38428255-38428277 CTGAAAGGGGAGGAAGAGGAGGG - Intronic
1039757530 8:40539372-40539394 CTGAAAATGCAGGATGGGAATGG - Intronic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1039869470 8:41533399-41533421 CTTGAAAGGCAGCTAGAGGATGG + Intronic
1040873419 8:52124688-52124710 CTGGAAAGACTGGAAGAGGCAGG + Intronic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1042945253 8:74147667-74147689 CTGGAAAGAAAGGCAGAGGAAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044801638 8:95963267-95963289 CTGGAAAGACAAGATAGGGATGG - Intergenic
1044899832 8:96932589-96932611 CTGGAAAGGCAGTTTGGGGCTGG - Intronic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1045543688 8:103109546-103109568 CTGGGAAGGAAGGATGAAGAAGG + Intergenic
1045791242 8:105987289-105987311 CTTAAAAGACAGGATGATGAGGG + Intergenic
1048292711 8:133192697-133192719 CTGGGAGGGCAGGGAGAGGATGG + Intronic
1048302595 8:133262501-133262523 ATGGAAAGAGAGGATCAGGAGGG - Intronic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048619806 8:136119219-136119241 CCATAAAGGGAGGATGAGGAGGG - Intergenic
1048805290 8:138235655-138235677 CTGGCAGGGCAGGGTGGGGAGGG - Intronic
1049018109 8:139935919-139935941 CTGGAAATGCAGTGTCAGGATGG + Intronic
1049372193 8:142273217-142273239 CTGGGACGGCAGGAGGACGATGG - Intronic
1049747154 8:144267807-144267829 CCGGAAAAGCAGGGTGAGCAGGG + Intronic
1049816551 8:144605777-144605799 CTGGCTGGGCAGGATGACGATGG + Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1050085100 9:1957141-1957163 CTGGGAAGGCAGGAAGCGGAAGG - Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1051147337 9:14041441-14041463 AAGAAATGGCAGGATGAGGATGG - Intergenic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053161846 9:35818797-35818819 CTGGAAGGGATGGTTGAGGATGG + Intronic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1054343871 9:63895086-63895108 CTGAAAAGTCAGGAAAAGGAGGG - Intergenic
1054754566 9:68944710-68944732 CTGTAATGGCAGGAAGAAGAGGG - Intronic
1055014603 9:71602623-71602645 AGGGAAAGGCAAGATGGGGAGGG - Intergenic
1055074413 9:72198695-72198717 CTGGTAGGGCAGGCTGATGATGG + Intronic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1055353325 9:75412114-75412136 CTGGAAGGGAAGGGTGAGGAAGG + Intergenic
1055509764 9:76984601-76984623 CTGGGCAGTCTGGATGAGGAGGG - Intergenic
1055637938 9:78296561-78296583 TTGGAAGCGCAGGATGAAGAAGG - Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059404795 9:114093029-114093051 CTGACAGGGCAGGGTGAGGAGGG + Intronic
1059550621 9:115225359-115225381 GGGGATAGGGAGGATGAGGAAGG + Intronic
1059740660 9:117146307-117146329 CAGGAAAGGGAGGGAGAGGAGGG + Intronic
1060074223 9:120577593-120577615 CTGCAAAGGCAGGGAGATGAGGG + Intronic
1060194414 9:121614236-121614258 CTAGAAAGGTAGGATGGGAAGGG - Intronic
1060196283 9:121625635-121625657 ATGGGATGGCAGGATCAGGAGGG + Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060543734 9:124448536-124448558 CAGGAAGGGCACGGTGAGGAGGG + Intergenic
1060548607 9:124474964-124474986 CTGGAAAGGGGAGATGAGGCCGG - Intronic
1061484152 9:130911889-130911911 CTGCAAAGGGAAGATGGGGATGG + Intronic
1062133917 9:134914763-134914785 CTGGAAAGGCAGGACCAGTGGGG - Exonic
1062231375 9:135483742-135483764 CTGGCAGCGCAGGATGAGAAGGG + Intronic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1186032184 X:5380313-5380335 AGGGAAAGGCAGGATGGGGGTGG - Intergenic
1186195870 X:7110030-7110052 CTGCAAGGGCAGCATGGGGAGGG + Intronic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187558299 X:20374197-20374219 CTGGAAAGGCAGGAGTATGAAGG - Intergenic
1187564562 X:20435586-20435608 CTGGAGAGGCACGGTGAGGGTGG + Intergenic
1187916083 X:24153310-24153332 CAGGAAAGGCATGAAGGGGAAGG - Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189160339 X:38803961-38803983 CTGGGCAGGCCAGATGAGGAGGG - Exonic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1189367383 X:40399311-40399333 CAGGAAAGGCATGATGAGTGGGG - Intergenic
1189630037 X:42943066-42943088 CAGGAAAGGCAGGCAAAGGAGGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189984722 X:46544084-46544106 CTGCAAAGGCGGGATGAGGCTGG - Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190841711 X:54151374-54151396 CTAGAAAGGCAAGATAAGCAAGG + Intronic
1191861091 X:65667391-65667413 CTGGAAGGCCAGGACGTGGAAGG + Intronic
1191912341 X:66164293-66164315 CTGGGATGGGAGGATGAGGGAGG - Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192167850 X:68836998-68837020 CAGGAAAGGCAGGATGAAAGTGG - Intronic
1192452415 X:71252589-71252611 CTGGCAAGGAAGGATGTGCAGGG + Exonic
1193632359 X:83905538-83905560 CTGGTAAGGTGGGATGAGAATGG - Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1195382440 X:104283522-104283544 CTGGAAGGGCAGGTGTAGGAGGG + Intergenic
1195707241 X:107746482-107746504 CTGGAGAGTCAGGATGACCAAGG - Intronic
1196164083 X:112519271-112519293 GTGGAAAGTCAGGATGAAGAGGG - Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198112407 X:133513514-133513536 CTGGAAAGGGAGGAGGAAGGAGG + Intergenic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198233594 X:134716109-134716131 CTGGAAAGGAAAGGGGAGGAGGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1199096384 X:143745808-143745830 CTAGAAAGGCAGAATGAGTTTGG - Intergenic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1199892631 X:152102053-152102075 CTGGAAAGGCAGAATAAAGCTGG + Intergenic
1200045101 X:153396949-153396971 CCGGAAAACGAGGATGAGGATGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic