ID: 947795977

View in Genome Browser
Species Human (GRCh38)
Location 2:232894264-232894286
Sequence CTGTGGAAAACGCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947795969_947795977 19 Left 947795969 2:232894222-232894244 CCAGGCTTCACACAGTCCCTGCT 0: 1
1: 0
2: 0
3: 32
4: 300
Right 947795977 2:232894264-232894286 CTGTGGAAAACGCACTCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 101
947795972_947795977 2 Left 947795972 2:232894239-232894261 CCTGCTGGAAGCACAGCTCCCAG 0: 1
1: 0
2: 8
3: 41
4: 319
Right 947795977 2:232894264-232894286 CTGTGGAAAACGCACTCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 101
947795971_947795977 3 Left 947795971 2:232894238-232894260 CCCTGCTGGAAGCACAGCTCCCA 0: 1
1: 0
2: 4
3: 41
4: 298
Right 947795977 2:232894264-232894286 CTGTGGAAAACGCACTCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 101
947795968_947795977 20 Left 947795968 2:232894221-232894243 CCCAGGCTTCACACAGTCCCTGC 0: 1
1: 0
2: 2
3: 40
4: 499
Right 947795977 2:232894264-232894286 CTGTGGAAAACGCACTCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947795977 Original CRISPR CTGTGGAAAACGCACTCAGG AGG Intronic
901184174 1:7361585-7361607 CTGTGGAAAAGTTGCTCAGGTGG - Intronic
904929962 1:34079053-34079075 GTGTGGAAAATGCACTGGGGTGG - Intronic
905792495 1:40797714-40797736 CTCTGGAGGAGGCACTCAGGAGG - Intronic
916230190 1:162534035-162534057 CTTAGGAGAACGAACTCAGGAGG + Intergenic
920055672 1:203189498-203189520 CTGTGAAGAACTGACTCAGGAGG + Intergenic
923851189 1:237797097-237797119 CTGTGTAAGACTCACTCAGGAGG + Intronic
924383643 1:243484063-243484085 CTGTGGAACACGCACCCACCAGG - Intronic
1063658452 10:8014856-8014878 CTGTGGATAAAGAACCCAGGAGG + Exonic
1068126832 10:52851164-52851186 CTGGGGAAAACCCACTCATCGGG + Intergenic
1073290403 10:102410590-102410612 CTCTGGAAAACGCGAGCAGGCGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1098483817 12:70997400-70997422 CTGTGGAAAATGCACACATCTGG + Intergenic
1099987839 12:89688679-89688701 CAGTGGAACAGGCACTAAGGTGG + Intronic
1106798852 13:33235136-33235158 CTGTAGCAAACTCACACAGGAGG + Intronic
1107596911 13:41972904-41972926 CTGGGGCAAAAGCTCTCAGGTGG - Intergenic
1108280925 13:48860814-48860836 CTCTGGAATACGCACTCACTTGG + Intergenic
1115461197 14:33662980-33663002 ATTTAGAAAACCCACTCAGGAGG - Intronic
1123089539 14:105736274-105736296 CGGTGGAAAACACGGTCAGGAGG - Intergenic
1123476069 15:20593201-20593223 TTCTGGAAGCCGCACTCAGGAGG + Intergenic
1123641943 15:22407163-22407185 TTCTGGAAGCCGCACTCAGGAGG - Intergenic
1124016444 15:25880366-25880388 GTTTGGAAAATGCCCTCAGGTGG - Intergenic
1124370466 15:29101855-29101877 CTGTGGAAACCACCCTCAGGTGG + Intronic
1124590919 15:31052119-31052141 CTGTGGAAAATGCACTGGGTGGG - Intronic
1127710041 15:61588106-61588128 CTTTGGAAAAGGCAAGCAGGGGG + Intergenic
1128541866 15:68541632-68541654 CACTGGACAAAGCACTCAGGAGG - Intergenic
1128547512 15:68578398-68578420 CTCTGCAAAACTCACTAAGGCGG + Intergenic
1128760071 15:70210547-70210569 CTGTGGAAAACCCAATTATGGGG + Intergenic
1131776160 15:95801147-95801169 ATGTGCAAAAAGCAGTCAGGAGG - Intergenic
1131975367 15:97940571-97940593 CTGTGGAAAACTGACTAAGAAGG + Intergenic
1134093064 16:11401878-11401900 CTGTGGGAAAGGCACTGGGGGGG - Intronic
1134189516 16:12110411-12110433 CTGTGCAAAACCCACTCACCTGG - Intronic
1137484258 16:48878435-48878457 CTGTGGAAAAGGGACTCAAAGGG + Intergenic
1152052416 17:77991377-77991399 ATGGGGAGAACGCATTCAGGGGG - Intergenic
1161097058 19:2398373-2398395 CTGTGGAAAACCAAGGCAGGTGG + Intronic
1162019167 19:7860918-7860940 CTGGGGGAAACACACACAGGTGG - Intronic
1165454406 19:35902412-35902434 CTTTGGTGAACGAACTCAGGGGG - Intergenic
1167652331 19:50739167-50739189 CTGTGGAACACGCACAGATGCGG - Intergenic
925002632 2:418055-418077 ACGTGGAAAACTCACTCATGTGG - Intergenic
929007693 2:37411755-37411777 TTATGGATAACCCACTCAGGAGG + Intergenic
929046331 2:37794143-37794165 CTCTGGGAAACAGACTCAGGGGG + Intergenic
929458337 2:42082852-42082874 GTGTGGAAAAACCACTGAGGTGG - Intergenic
930057148 2:47260804-47260826 CTGGGGAAAAGGCACTCTGAAGG + Intergenic
936418386 2:112341000-112341022 CTGTGGAAAACGAAGTCAAAGGG - Intergenic
937236189 2:120433106-120433128 CTGTGGGACCCGCAGTCAGGGGG + Intergenic
938923249 2:136014763-136014785 GTATGGAAAAGGCACTCACGAGG + Intergenic
939341821 2:140905688-140905710 CTAAGGAAAAGGCACTAAGGGGG - Intronic
941373516 2:164698234-164698256 CTGTGAAAAACTGACTCAAGTGG + Intronic
943962969 2:194291015-194291037 CTGGGGAAAATGCAACCAGGAGG - Intergenic
944134454 2:196383466-196383488 CTGTGGAACACCAACTAAGGTGG + Intronic
944153222 2:196584228-196584250 CTGTGGTAAAAGTACTGAGGTGG + Intronic
944443866 2:199769784-199769806 CTGAGGAAAACCAACACAGGTGG - Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
947501721 2:230675745-230675767 CTGGGGAAAAGGGACCCAGGTGG - Intergenic
947795977 2:232894264-232894286 CTGTGGAAAACGCACTCAGGAGG + Intronic
948829757 2:240592790-240592812 CTGTGGCAAACCCGCTCATGGGG - Intronic
1175447279 20:59032051-59032073 CTGTGGGCAAAGCGCTCAGGCGG - Intronic
1175516972 20:59576308-59576330 CTTTAGAAAACTCACTGAGGAGG - Intergenic
1177361273 21:20075423-20075445 CTGTGGAAAACGGATGCAGTAGG + Intergenic
1180214508 21:46315836-46315858 CTGTATGAAATGCACTCAGGAGG - Intronic
1180708449 22:17823873-17823895 CTGTGGACAACCCCCTCAGCTGG - Intronic
1181459998 22:23080218-23080240 CTGAGGAACACTGACTCAGGAGG - Intronic
952320148 3:32269571-32269593 CTGTGGAACAAGAACTCAGGTGG + Intronic
956504077 3:69919142-69919164 CTTTGGAAAATGCACTGTGGTGG - Intronic
966509823 3:180749448-180749470 CTCTGGGAAAAGCTCTCAGGAGG + Intronic
971480536 4:27110708-27110730 CTCTGGGAATCCCACTCAGGAGG - Intergenic
973248566 4:48037502-48037524 CTGTGGAAAACTCACTCTTTAGG - Exonic
975297576 4:72751602-72751624 TTGTAGAAAACTCACTGAGGTGG - Intergenic
978363277 4:107953831-107953853 CTGTGGAAAAAGCTGGCAGGGGG - Intergenic
978462892 4:108977152-108977174 CTGTGGAAAATGCACTAGGGAGG - Intronic
985657111 5:1137895-1137917 CTGTGGAAGACACCCTAAGGGGG + Intergenic
987091145 5:14508813-14508835 CTGGGGAAGACGCACCTAGGTGG + Exonic
990760471 5:59124055-59124077 CTTTGGAAAATGTAATCAGGGGG + Intronic
991146096 5:63306257-63306279 CTGTGGAAAGTGCACTCATTTGG + Intergenic
996022398 5:118605684-118605706 CTTTGGGAAACGGACACAGGAGG - Intergenic
997486624 5:134236411-134236433 TAGTGGAAAACAGACTCAGGGGG - Intergenic
998258031 5:140604270-140604292 CTGTAGTAACAGCACTCAGGAGG + Intergenic
999770231 5:154770098-154770120 CTGTGGAAAATGGACAGAGGAGG + Intronic
1001155795 5:169271594-169271616 CTGTGGAAAACACAAGCACGTGG + Intronic
1002979717 6:2124585-2124607 CAGTGGAAAACACACTCAGGAGG + Intronic
1003099553 6:3166724-3166746 AGGTTGAAGACGCACTCAGGGGG - Intergenic
1005837879 6:29721540-29721562 CTGTGGAGAGAACACTCAGGTGG + Intergenic
1006424931 6:33958081-33958103 CTGTGGCTATGGCACTCAGGAGG - Intergenic
1007189618 6:40002543-40002565 GTGTGGAAAACCCACACAGCTGG + Intergenic
1008580016 6:52898204-52898226 ATGTGGAAAATGCAAGCAGGTGG - Intronic
1019994440 7:4714860-4714882 CTGGAGAAATCGGACTCAGGTGG - Intronic
1021898794 7:25262865-25262887 CTGTGGAAAGCGCATTCCTGTGG - Intergenic
1022318576 7:29266735-29266757 CTGTGGAAAATGCACTACAGTGG - Intronic
1023103264 7:36739981-36740003 CTGTGGAAATCTCACTGGGGAGG + Intergenic
1024049625 7:45610445-45610467 TTGTGGAAAATCCTCTCAGGGGG - Exonic
1027801521 7:82757206-82757228 TTGTGGAAAAAACACTCAGCAGG - Exonic
1032909562 7:136413770-136413792 CTGGGGAAAACACACACTGGTGG - Intergenic
1033271910 7:139939643-139939665 CTGTGCAGATGGCACTCAGGTGG + Intronic
1033768232 7:144518818-144518840 CAGTGTAAAATGCAGTCAGGTGG + Intronic
1038795817 8:30708340-30708362 CAGTGGAGAACACACTCAGTTGG + Intronic
1039502872 8:38030883-38030905 GTCTGGAAGACGCACTCAGAGGG - Intronic
1042337193 8:67640790-67640812 CTGGGGAAAATGCAGACAGGAGG - Intronic
1049028694 8:140015958-140015980 CTGTGGAACATGCAGCCAGGTGG - Intronic
1049184912 8:141245027-141245049 CTGTGGAAAAGTCACTCAGTGGG - Intronic
1052825215 9:33169150-33169172 CTGTGGAAAACAGACTAGGGAGG - Intergenic
1053312676 9:37029406-37029428 CTGCGGAAAACGGCCCCAGGCGG + Intronic
1054743771 9:68834046-68834068 CTGTGGAAAAGGATCTTAGGAGG - Intronic
1060413747 9:123416406-123416428 CGGTGGAAAGAGCACTCAAGCGG - Intronic
1061619045 9:131799027-131799049 CTCTGGCAAAGGCACCCAGGGGG + Intergenic
1187777484 X:22778585-22778607 CTTTGGAAAACTGACGCAGGAGG - Intergenic
1188748893 X:33881597-33881619 GTGTAGAAAATGAACTCAGGGGG - Intergenic
1188887732 X:35570834-35570856 ATGTGGAAATCTGACTCAGGAGG + Intergenic
1192350762 X:70354745-70354767 CCCTGGAAAAGGCCCTCAGGAGG - Intronic
1195856496 X:109338135-109338157 GTGTGGATAAAGCACTTAGGGGG + Intergenic
1197693908 X:129530513-129530535 CTGTGGAAGACAAACACAGGTGG + Intergenic