ID: 947802190

View in Genome Browser
Species Human (GRCh38)
Location 2:232936591-232936613
Sequence TCTGGACACCAAGGCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947802187_947802190 -10 Left 947802187 2:232936578-232936600 CCTCAATAAGAACTCTGGACACC 0: 1
1: 22
2: 60
3: 160
4: 286
Right 947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG 0: 1
1: 1
2: 1
3: 27
4: 268
947802183_947802190 13 Left 947802183 2:232936555-232936577 CCAACCACATCTTTGTGACCAAG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG 0: 1
1: 1
2: 1
3: 27
4: 268
947802184_947802190 9 Left 947802184 2:232936559-232936581 CCACATCTTTGTGACCAAGCCTC 0: 1
1: 0
2: 2
3: 16
4: 150
Right 947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG 0: 1
1: 1
2: 1
3: 27
4: 268
947802185_947802190 -5 Left 947802185 2:232936573-232936595 CCAAGCCTCAATAAGAACTCTGG 0: 1
1: 0
2: 2
3: 16
4: 157
Right 947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG 0: 1
1: 1
2: 1
3: 27
4: 268
947802182_947802190 22 Left 947802182 2:232936546-232936568 CCTGGGCAGCCAACCACATCTTT 0: 1
1: 0
2: 0
3: 20
4: 197
Right 947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG 0: 1
1: 1
2: 1
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947802190 Original CRISPR TCTGGACACCAAGGCACAGG TGG Intronic
900489501 1:2939960-2939982 TCTGGACAAGGAGGCAAAGGAGG - Intergenic
900648726 1:3720734-3720756 TCTGGCCATCAAGGGACATGAGG - Intronic
900871383 1:5306222-5306244 TGAGGACACAAAGGCACAAGAGG + Intergenic
900926557 1:5709781-5709803 GCTGGAAACCAAGGCACTTGGGG - Intergenic
901133297 1:6976408-6976430 TCTGAAAGGCAAGGCACAGGTGG - Intronic
901594071 1:10370852-10370874 TCAGGAAGCCAGGGCACAGGAGG + Intronic
904992156 1:34601734-34601756 TCTGGGCCCCAAGGAAGAGGTGG - Intergenic
905143739 1:35870147-35870169 TATGGACTCCCAGCCACAGGCGG - Intronic
905185943 1:36196967-36196989 ACTGGGCACCATGGAACAGGGGG + Intergenic
906248454 1:44293429-44293451 TCTGGCCAGGAAGGCACAGCTGG - Intronic
908755859 1:67468308-67468330 TCAGGACACCAAGGAGCAGGGGG - Intergenic
911454309 1:98104117-98104139 TGTGGATAGCAAGGCACAGTCGG + Intergenic
914991996 1:152506867-152506889 TGTGGACATCTATGCACAGGAGG + Intergenic
915695840 1:157740262-157740284 TCTGGACCCCTAGTTACAGGGGG - Intergenic
919333537 1:196203344-196203366 TCTAGATACCAAGGCTCAAGTGG - Intergenic
919521623 1:198596523-198596545 TCTGGACACCAAGGAAGAGACGG + Intergenic
920793063 1:209111006-209111028 TCTGGTCACCAAAACACATGGGG - Intergenic
921045526 1:211474539-211474561 TCTAGAATCCAAGGCAAAGGGGG - Intergenic
921484244 1:215697366-215697388 CCTGGAAACCAAGCTACAGGTGG - Intronic
922546781 1:226464066-226464088 AGTGGACGCCAAGGCCCAGGAGG - Intergenic
922793123 1:228321553-228321575 TGGGGACACCGAGGCACAGGTGG + Exonic
923047748 1:230367975-230367997 GCTGGACACCAAGGAGCTGGGGG + Intronic
923438138 1:233988482-233988504 TCTGAAGGCAAAGGCACAGGTGG - Intronic
923492741 1:234498941-234498963 TGTGGAAAGCAAGGCACAGAGGG + Intergenic
1063218112 10:3942341-3942363 TCTAGAAACAAAGGCAGAGGAGG - Intergenic
1063848907 10:10162326-10162348 TCTGGACACAACGGCACTGATGG + Intergenic
1063880506 10:10526880-10526902 TCTGGACACCTAAGCAAAGAAGG + Intergenic
1063957770 10:11282219-11282241 AATGGATACCAATGCACAGGAGG + Intronic
1064350319 10:14570310-14570332 TGTGTACACCAAGGCCCAGCAGG + Intronic
1064793721 10:18988293-18988315 TCTGGAAGTCCAGGCACAGGAGG - Intergenic
1066180308 10:32956226-32956248 TGTGGACATCAAGGCCCAGAGGG - Intronic
1069346554 10:67476944-67476966 TCTGCACAGCAAGGCTGAGGCGG - Intronic
1070750572 10:78961813-78961835 CAGGGACACCAAGGCACAGTGGG + Intergenic
1071499201 10:86191561-86191583 TCAGGAGACTCAGGCACAGGAGG + Intronic
1072548262 10:96457191-96457213 TGTGGTCACCAAGATACAGGAGG - Intronic
1073282364 10:102363827-102363849 ACTGGACACCCAGACAGAGGTGG - Intronic
1074436913 10:113442053-113442075 TCTGGACTCCAAGGCTAAGCTGG + Intergenic
1074443002 10:113495116-113495138 GCTGGACACCAAAACAAAGGAGG + Intergenic
1075062865 10:119268959-119268981 TCTGGGCCCCAAGGCCCATGGGG - Intronic
1075147326 10:119893146-119893168 TCTGGACAACTCGGAACAGGGGG - Intronic
1076757246 10:132579007-132579029 TGTGGAAACCGAGGCACAAGAGG - Intronic
1077079796 11:720205-720227 GCTGGACATCGAGTCACAGGTGG + Exonic
1077266571 11:1653700-1653722 TCTGGACACACAGGCACACATGG - Intergenic
1077372585 11:2190347-2190369 TGTGGACAACAAGCCAGAGGGGG - Intergenic
1077483526 11:2827700-2827722 TCTGGCCTCCAAGCCACATGTGG - Intronic
1077490723 11:2859712-2859734 GCTGGAAACCCAGGCGCAGGAGG + Intergenic
1077921000 11:6641626-6641648 GCTGGAGCCCAAGGCACAGCTGG - Exonic
1080502448 11:32883732-32883754 CCTGGACACCAAGGCTTAGGTGG - Intergenic
1081701667 11:45156361-45156383 TCTGGACCCCAGAGCACAAGGGG - Intronic
1083147755 11:60771635-60771657 TCTGCTCACCAAGGCCCAGCAGG - Intronic
1085524712 11:77157520-77157542 TCTGGACACCAAGGAGAAGTGGG + Intronic
1086001159 11:81987166-81987188 AGTGGACACCAAGGCTGAGGAGG + Intergenic
1086552429 11:88068920-88068942 TCTGGCCACCGAGGCCGAGGAGG - Intergenic
1088053978 11:105553199-105553221 TCTGGACAACAAACCAGAGGAGG + Intergenic
1091352781 11:134910875-134910897 TTAGGAAACCAAGGCGCAGGTGG - Intergenic
1091988359 12:4932850-4932872 TTTGGACACAAACGCACAGGGGG - Intergenic
1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG + Intergenic
1092927697 12:13287126-13287148 CCTGGACACCAAAGCTCGGGTGG + Intergenic
1096004905 12:48161636-48161658 TCTGGACACCCAGATTCAGGAGG + Intronic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1096782098 12:53997463-53997485 TCTGGACACAAAGGCGGAAGAGG - Intronic
1096785891 12:54017117-54017139 TCTGGCCCCCAAGGGGCAGGAGG + Intronic
1100670074 12:96802296-96802318 TCTGGTCACAAAGCCACAGCTGG + Intronic
1101605277 12:106243745-106243767 TCTGGAGAACAAGAGACAGGTGG + Intronic
1101912008 12:108867060-108867082 ACTGGACACCCTGGCCCAGGTGG - Intronic
1103564450 12:121808437-121808459 TTTGGAGACCAAGGCCTAGGAGG + Intronic
1103783339 12:123414143-123414165 ACTGGACACCATGGAGCAGGGGG + Exonic
1103943912 12:124516015-124516037 AGTGGACACCAAGGCCCTGGGGG + Intronic
1103984747 12:124759884-124759906 TCTGCCCCCCATGGCACAGGTGG + Intergenic
1104898019 12:132173713-132173735 TCTGGACACCCAGAAACAAGAGG + Intergenic
1105281042 13:18962775-18962797 ACAGGGCACCAAGGCACAGGCGG - Intergenic
1105290244 13:19048787-19048809 ACAGGGCACCAAGGCACAGGCGG - Intergenic
1105595689 13:21835895-21835917 TCTGGACTCCAAGTCAGAAGTGG + Intergenic
1105701574 13:22939005-22939027 TGTGGAGAAAAAGGCACAGGTGG - Intergenic
1106080543 13:26496958-26496980 TCTGGTCACCAAAGCAAAGAGGG + Intergenic
1106359242 13:29014693-29014715 TGTCGACAGCAAGGCAAAGGTGG + Intronic
1107217049 13:37934295-37934317 TCTGGAGACCAGGACACTGGAGG + Intergenic
1108228577 13:48316243-48316265 TCTGGCCTCCAAGGACCAGGGGG + Intronic
1110847681 13:80208308-80208330 TGGGGACAGCATGGCACAGGGGG - Intergenic
1112138436 13:96610567-96610589 TCTGGACACCAAGGTATACATGG - Intronic
1112154152 13:96798952-96798974 TCTGGACACAAAGGGACACTGGG - Intronic
1115921339 14:38377683-38377705 CCTGGACACCAAAGTTCAGGTGG - Intergenic
1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG + Intronic
1120129870 14:80794035-80794057 TTTGGAAACTAAGGCTCAGGAGG - Intronic
1126546266 15:49877682-49877704 TGAGGAAACCAAGGCTCAGGCGG - Intronic
1127747811 15:61998570-61998592 TCAGGAAACTAAGGCACAGAGGG + Intronic
1128729987 15:70014546-70014568 TCTGGTGCCCAAGGCACAGGAGG - Intergenic
1129176713 15:73845488-73845510 TATGGATTCCAAGGGACAGGTGG + Intergenic
1130781651 15:87046129-87046151 TCTGGACACCTACAGACAGGCGG + Intergenic
1130934839 15:88460041-88460063 TCTGGACTCCATGGGCCAGGAGG - Intronic
1132339698 15:101070340-101070362 CCTGGGCACCAAGTCCCAGGGGG + Intronic
1132671882 16:1105481-1105503 GGTGGACACCATGGCACAGATGG - Intergenic
1132679440 16:1133723-1133745 TGAGGAGACCAAGGCTCAGGAGG + Intergenic
1133279688 16:4658161-4658183 GCTGGAAAACAAGGCAAAGGGGG - Intronic
1133367639 16:5223586-5223608 TGGGGAAACCAAGGCACAGAAGG + Intergenic
1133637510 16:7682686-7682708 TCTAGACACAGGGGCACAGGAGG - Intronic
1135303380 16:21349618-21349640 TGTGGAGACCAACGGACAGGAGG - Intergenic
1135827427 16:25741798-25741820 TAAGGACACCAAGGCTCAGAGGG + Intronic
1136300126 16:29328812-29328834 TGTGGAGACCAACGGACAGGAGG - Intergenic
1137747705 16:50835243-50835265 AGGGGACACCAAGGCACTGGGGG - Intergenic
1139872749 16:70120606-70120628 CCTGCCCACCCAGGCACAGGTGG + Exonic
1140359040 16:74329433-74329455 TGTGGCCTCCATGGCACAGGGGG - Intergenic
1140363028 16:74360724-74360746 CCTGCCCACCCAGGCACAGGTGG - Intergenic
1140373991 16:74430111-74430133 TGTGGCCTCCATGGCACAGGGGG - Intergenic
1142048593 16:87942756-87942778 TCTGGGCACCATGGCCCAGCCGG - Intergenic
1142061859 16:88035582-88035604 TGTGGAGACCAACGGACAGGAGG - Intronic
1142950193 17:3472100-3472122 TCTGGACCCTAAGGGCCAGGGGG - Exonic
1143509560 17:7388003-7388025 AGTGGACACCAAGGCCTAGGCGG - Intronic
1144482520 17:15639597-15639619 TCTGGACAACAGGGCTCCGGAGG - Intronic
1144649781 17:17000062-17000084 GCTGGTCAGGAAGGCACAGGAGG + Intergenic
1145252602 17:21304689-21304711 CCTGGGCAGCAAGACACAGGTGG - Intronic
1145323963 17:21783220-21783242 CCTGGGCAGCAAGACACAGGTGG + Intergenic
1146306392 17:31732920-31732942 ACTGGCCACCAAGGTATAGGCGG + Intergenic
1147153657 17:38532550-38532572 ACTGGACGGCAAGGCCCAGGAGG + Exonic
1148743849 17:49907732-49907754 TCTGGACATCAAGGAGCAGGAGG + Intergenic
1148776936 17:50101331-50101353 TCTGTACACCCAGGCCCATGAGG + Intronic
1148795600 17:50195257-50195279 TCTGGACCCCAGGGCCCCGGCGG - Exonic
1150276073 17:63898709-63898731 TCTGGGCACCAGGAGACAGGAGG - Intergenic
1150367142 17:64599210-64599232 TGAGGAAACCAAGGCACAAGGGG + Intronic
1151200992 17:72467950-72467972 TCTGGGCACCAAGGCTCATCTGG + Intergenic
1151217593 17:72588225-72588247 TTTGAACACCAGGGGACAGGTGG + Intergenic
1151522329 17:74639272-74639294 TCTGGGCACCAAGAGACAGAGGG - Intergenic
1151828907 17:76538300-76538322 TCTGGACGCCCAGGCTCTGGGGG + Intronic
1151887967 17:76934288-76934310 TGAGGACACCAGGGCACAGTGGG + Intronic
1152065224 17:78108688-78108710 CCTGGACACCCAGGCCCACGAGG - Exonic
1152513045 17:80803281-80803303 TCTGGAAACCGAGGCAAGGGAGG + Intronic
1152792642 17:82290186-82290208 TCAGGACATGAAGGCACATGAGG + Intergenic
1153651039 18:7240495-7240517 CCTGGACAGCAAGGCTCAGGGGG + Intergenic
1154293605 18:13131324-13131346 TCTGGGCACCAAGGCTTTGGGGG - Intergenic
1155685518 18:28543906-28543928 TCTGAATGCCAAAGCACAGGTGG + Intergenic
1155799744 18:30086530-30086552 TCAGGACACCAAAGCAAATGTGG + Intergenic
1156486595 18:37470034-37470056 TCTGGTGGCCAAGGCACAGAGGG - Intronic
1158424413 18:57326218-57326240 TCTGCCCACCAAGGCCCATGGGG + Intergenic
1158551294 18:58438292-58438314 CCTGGCCACCAAGGGACAGTGGG + Intergenic
1159147849 18:64477942-64477964 TTAGGACACAAAGGCACAGTTGG + Intergenic
1161777698 19:6272673-6272695 TCTTGAAACCACGGGACAGGAGG + Intronic
1162262981 19:9547693-9547715 GGTGGACACCAAGGCTGAGGAGG - Intergenic
1162380251 19:10327680-10327702 TGAGGATACCAAGGCACAGAGGG - Intronic
1162830932 19:13283834-13283856 TGAGGGCACCAAGGCACAGAGGG - Intronic
1164128363 19:22339021-22339043 TCTGAACATCAAGGCACAATTGG - Intergenic
1164171118 19:22726305-22726327 TCTGAACATCAAGGCACAATTGG + Intergenic
1165336380 19:35172965-35172987 TCTGGACGCCAAGGCTCGAGTGG - Intergenic
1165697546 19:37912381-37912403 TCAGGACACTAAGGCTCAGAAGG - Intronic
1166795149 19:45421333-45421355 TGTGGACACCTCGGCCCAGGCGG - Exonic
1167640997 19:50681355-50681377 TCTGGACACAGAGGGAAAGGAGG + Intronic
1167820527 19:51923423-51923445 CCTGGACACCCAGGCTCAAGTGG + Intronic
1168485479 19:56758820-56758842 GCTGGTCACCAAGGAACGGGGGG + Intergenic
925078176 2:1037248-1037270 TTGGGACACCAAGGCAGTGGGGG + Intronic
926172282 2:10560004-10560026 TGTAGACACCAAGGCACGGACGG + Intergenic
927596519 2:24402730-24402752 AGTGGACACCAAGGCCAAGGAGG - Intergenic
927997726 2:27497582-27497604 TCTGACCACCATGGTACAGGTGG + Exonic
929824171 2:45297093-45297115 ACTGTCCACTAAGGCACAGGTGG + Intergenic
929919499 2:46162206-46162228 TCTAGACATCCAGGCAGAGGTGG - Intronic
930715415 2:54589362-54589384 TGTGGAGACCAAGGCACTGCAGG - Intronic
932663012 2:73673271-73673293 TCTGGAGACAAGGGCACAGGAGG + Intergenic
934609280 2:95722699-95722721 TCAGGACCACAAGGCACATGGGG - Intergenic
935939717 2:108225501-108225523 TTTGGACACAAATGCACAGAAGG - Intergenic
936077825 2:109412952-109412974 CATGGAGACCACGGCACAGGCGG + Intronic
936542609 2:113364276-113364298 TCAGGACCACAAGGCACATGGGG - Intergenic
944420533 2:199525313-199525335 ACTGGACAGCAAAGCTCAGGTGG + Intergenic
947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG + Intronic
949009623 2:241671104-241671126 TCTGACCACCACGGCAGAGGGGG - Intronic
1170303725 20:14915015-14915037 TCTGGACAATAAGGCACACATGG + Intronic
1170939995 20:20840825-20840847 TCTGGAGAACAAGGGACATGTGG + Intergenic
1172114429 20:32565144-32565166 TCTGGATGACAAGGCACTGGGGG + Intronic
1172648195 20:36484556-36484578 TCTTGGCACCAGGACACAGGTGG - Intronic
1172705917 20:36881750-36881772 GGGGGACACCAAGGCAAAGGTGG + Intronic
1173033731 20:39388799-39388821 TCTGGACACCATGTCAAATGTGG - Intergenic
1173837416 20:46134963-46134985 GCTGGGCACCAAGGCCCAGAGGG - Intergenic
1173968718 20:47133802-47133824 CCTGGACATCAAGGCTCAAGTGG - Intronic
1174219351 20:48940672-48940694 TGAGGAAACCAAGGCACAGGAGG - Intronic
1175110807 20:56646613-56646635 TCTAGAAACCAAGGCACAGAGGG - Intergenic
1175632413 20:60552774-60552796 GCAGGACTTCAAGGCACAGGTGG + Intergenic
1175753222 20:61513488-61513510 GATGGAAACCAAGGCACAGAAGG + Intronic
1176167421 20:63681395-63681417 TGGGGAAGCCAAGGCACAGGTGG + Intronic
1176217394 20:63954747-63954769 TGTGGTTACCAAGGGACAGGAGG - Intronic
1176843739 21:13860645-13860667 TCTGGACAGCAAAGCTCAAGGGG - Intergenic
1177371699 21:20213009-20213031 TGTGGACACCAAGGGTGAGGTGG + Intergenic
1179071569 21:38076199-38076221 GATGGACCCCAAGGCACACGCGG + Intronic
1179317859 21:40260918-40260940 ACAGAACACCAAGGCCCAGGTGG - Intronic
1179801169 21:43812081-43812103 TCTGGAAACTGAGGCACAGGAGG + Intergenic
1180071471 21:45438848-45438870 TCTGGATGCCAAGTCACATGTGG - Intronic
1180119063 21:45734454-45734476 TCAGGACCCCACAGCACAGGAGG - Intronic
1183062835 22:35346337-35346359 TCTGGGCACCAAGGCCCACATGG + Intronic
1183293275 22:37015790-37015812 TGGGGACACAAAGGCACATGAGG - Intronic
1183676965 22:39304612-39304634 CAGGGACACCGAGGCACAGGTGG + Intergenic
1183700303 22:39447378-39447400 TCTGGAAACCATGTCATAGGAGG + Intergenic
1184766134 22:46573476-46573498 ACAGGACGCCAAGGCACAGAGGG - Intergenic
1184897982 22:47423398-47423420 ACTGGAGTCCAAGGCGCAGGGGG - Intergenic
949946271 3:9192472-9192494 CCTGGACACCAAGGGGCAGTTGG + Intronic
950453044 3:13076213-13076235 GCTGGAGACTAAGGCACAGTGGG + Intergenic
950610822 3:14125523-14125545 TCAGGGCCCCAAGGTACAGGAGG - Intronic
951295824 3:20933596-20933618 TCTGCACACCCAGGGAAAGGAGG - Intergenic
953025166 3:39141002-39141024 TGAGGACACCCAGGCACAGAGGG + Intergenic
953679837 3:45030867-45030889 TCTGGACACCCTGGCCCAGGAGG + Exonic
954262164 3:49447331-49447353 TCGGGAGACCGAGGCACAAGAGG + Intergenic
954453978 3:50587035-50587057 TGAGGACACCAAGGCTCAGCAGG + Intergenic
956621992 3:71230460-71230482 CCTGGAAACAAAGGAACAGGAGG + Intronic
958533587 3:95366377-95366399 ACTGAACACCAAGGCTCAGCAGG + Intergenic
959749161 3:109812821-109812843 TCTGGATCCCAGGGCAAAGGAGG - Intergenic
961477803 3:127159436-127159458 GCTGGACTTCAGGGCACAGGTGG + Intergenic
961666528 3:128496462-128496484 GCGGGACACCAAGGCGCGGGCGG + Intergenic
963781579 3:149491968-149491990 TCAGGACATCAGGGCACAGCAGG + Intronic
967933645 3:194708936-194708958 TCAGGAAACCAAGGCACAAAGGG - Intergenic
968040781 3:195587540-195587562 AATGGCCACCAGGGCACAGGAGG - Intergenic
968058563 3:195711514-195711536 TCTGGGAACACAGGCACAGGTGG + Intergenic
968216975 3:196900827-196900849 TTGGGAGACCAAGGCAGAGGTGG - Intronic
968767831 4:2483328-2483350 TGTGGACACTGAGGCACAGAAGG + Intronic
968882042 4:3306063-3306085 TCAGGACCCCAAGGCAGAGCAGG - Intronic
969105383 4:4803550-4803572 TCTGGGCAGCAATGCCCAGGAGG - Intergenic
969302001 4:6302556-6302578 TCTGCACACGTGGGCACAGGCGG - Exonic
969635827 4:8369128-8369150 TCTGCAGAGCAAGGCACAGCAGG + Intronic
969665203 4:8553436-8553458 GCTGGGCACCAACGCTCAGGTGG - Intergenic
970359317 4:15292509-15292531 TCTGGAAACAAATGCACAGGGGG - Intergenic
971655185 4:29335226-29335248 TGTTGGCACCAAGGCAGAGGGGG - Intergenic
974750686 4:66136869-66136891 TCTGGAGCCCAAGCCACACGAGG - Intergenic
976754489 4:88483452-88483474 TCGGGAGACCAAGGCCCAGGTGG - Intronic
976829414 4:89297550-89297572 TCTGCGCTCCAAGGCAAAGGAGG + Intronic
986136840 5:4987893-4987915 CCTGGACTCCAAGGCCCAGGTGG + Intergenic
986721066 5:10562422-10562444 GCGGGTCACCAAGGCCCAGGTGG - Intergenic
988605998 5:32678764-32678786 ACTGGACACCAAGGCTGAGGAGG + Intergenic
989209755 5:38846791-38846813 TCTGGAAACCTAGGCACGGAGGG + Intronic
990480477 5:56205743-56205765 TCAGGAGACCAAGGCACTAGGGG - Intronic
990636442 5:57733260-57733282 TCTGTACACCAAGTCAAGGGAGG - Intergenic
991565140 5:67997225-67997247 TCAGGAAACCAAGGCAGAAGAGG + Intergenic
991738752 5:69650697-69650719 TATGGACAACAAGGTCCAGGCGG + Intergenic
991759445 5:69905730-69905752 TATGGACAACAAGGTCCAGGCGG - Intergenic
991787890 5:70212388-70212410 TATGGACAACAAGGTCCAGGCGG + Intergenic
991790327 5:70230438-70230460 TATGGACAACAAGGTCCAGGCGG + Intergenic
991815076 5:70505529-70505551 TATGGACAACAAGGTCCAGGCGG + Intergenic
991818211 5:70526814-70526836 TATGGACAACAAGGTCCAGGCGG + Intergenic
991838674 5:70780796-70780818 TATGGACAACAAGGTCCAGGCGG - Intergenic
991880336 5:71212752-71212774 TATGGACAACAAGGTCCAGGCGG + Intergenic
991882776 5:71230778-71230800 TATGGACAACAAGGTCCAGGCGG + Intergenic
992751403 5:79866024-79866046 TGAGGACACTAAGGCACAGAAGG - Intergenic
992776976 5:80097360-80097382 ACTGGCCAAGAAGGCACAGGTGG - Intergenic
993650247 5:90511141-90511163 TTTGGAATCCAAGGCACATGGGG - Intronic
994776833 5:104045517-104045539 TGTGGTCTCCAAGGCACAGATGG + Intergenic
995678839 5:114695326-114695348 ATTGGACACCAAGGCTGAGGAGG - Intergenic
996386640 5:122915793-122915815 ACTGGAGCTCAAGGCACAGGAGG - Intronic
999099681 5:149012917-149012939 TAAGGAAACCAAGGCACAGAAGG - Intronic
999433226 5:151541771-151541793 TGTGGAAACCAAGGCCCAGATGG - Intronic
1000026957 5:157367490-157367512 TTTGGACTCCAAGGCACATCTGG - Intronic
1001445836 5:171782216-171782238 TCTGGACACAGAAGGACAGGAGG + Intergenic
1001981983 5:176044162-176044184 GCTGGACACAAAGTCACAGGTGG - Intergenic
1001982658 5:176047291-176047313 GTTGGACACCAAGTCACATGGGG - Intergenic
1002234805 5:177796766-177796788 GTTGGACACCAAGTCACATGGGG + Intergenic
1002235481 5:177799895-177799917 GCTGGACACAAAGTCACAGGTGG + Intergenic
1003048992 6:2763757-2763779 AGTGGACGCCAAGGCAGAGGAGG + Intergenic
1004074145 6:12329765-12329787 TCTGAGCACCACAGCACAGGAGG - Intergenic
1004536244 6:16505170-16505192 GCTGGACACCTAGGCACACATGG + Intronic
1006419476 6:33924312-33924334 TCTGGCCAGCAAAGCAAAGGAGG - Intergenic
1006450272 6:34101973-34101995 CCTGGCCACTAGGGCACAGGTGG - Intronic
1006592550 6:35169096-35169118 TGTGGACACCAAGGCCCACCAGG - Intergenic
1006816635 6:36855609-36855631 TCTGGCAACCTAGGCACTGGGGG + Exonic
1006915469 6:37591211-37591233 TCTGGTCACCACAGCACTGGTGG + Intergenic
1011277014 6:85642165-85642187 CCTGAACACCGAGGCACCGGCGG + Intronic
1013480184 6:110546370-110546392 TTGGGAGGCCAAGGCACAGGGGG - Intergenic
1015573348 6:134644953-134644975 TCTGGGTTACAAGGCACAGGTGG + Intergenic
1019025033 6:168953330-168953352 AATGGACACCAAGGAACATGAGG - Intergenic
1019513371 7:1429366-1429388 TCTGGAGCCCAAGACGCAGGGGG - Intronic
1019577441 7:1744339-1744361 TCAGGACACCCAGGCCCATGGGG + Exonic
1024579602 7:50791526-50791548 TCTGAAAACCAAGGCTCAGGAGG - Intronic
1026117528 7:67508597-67508619 TGTGGAAACTAAGGCACAGAGGG + Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1030505770 7:110420363-110420385 TCTGGAAACCAAGACACCGTGGG + Intergenic
1031675186 7:124601383-124601405 CCAGGACACCAATGAACAGGGGG + Intergenic
1033281370 7:140008917-140008939 CCTGGTCACCAAGCCACAGCTGG - Intronic
1034398445 7:150845796-150845818 GCTGGATCCCAAGGCACATGAGG - Intronic
1034866711 7:154648346-154648368 ACTAGACAGCAAGGGACAGGTGG - Intronic
1034967530 7:155400392-155400414 TCTGGACACCATGGGACAGTTGG + Intergenic
1035983979 8:4404956-4404978 TATGGAAACCGAGGCACAAGAGG + Intronic
1037446514 8:18971255-18971277 GCCGGACACCCAGGCTCAGGCGG + Intronic
1039285057 8:36030303-36030325 TCTGGACACAAAGGGATGGGGGG + Intergenic
1039488740 8:37931776-37931798 TCTGGACACCAAGGCTTAGGGGG - Intergenic
1039700275 8:39954958-39954980 TTTGGACACAAAGAGACAGGGGG - Intronic
1040323997 8:46332021-46332043 ACTGGGCACCATGGAACAGGGGG - Intergenic
1042009307 8:64222087-64222109 TGTGGAGACCAAGGGCCAGGTGG + Intergenic
1043841140 8:85106251-85106273 TTTAGACACCCAGGCACAGGAGG - Intergenic
1046568959 8:115938086-115938108 TAAGGACACAAAGGGACAGGAGG + Intergenic
1048315995 8:133362589-133362611 TCTGGGCATCCAGGCACAGAAGG + Intergenic
1048432920 8:134387195-134387217 CCTGGACTCCAGGGCACAGCTGG - Intergenic
1048449366 8:134519975-134519997 TCTGGAATGCAAGGCACAAGTGG - Intronic
1049037278 8:140086485-140086507 GCTGGGCACCAGGGCACAGGTGG - Intronic
1049780074 8:144424850-144424872 TCAGGACAGCAAGCCCCAGGTGG + Intronic
1049969244 9:807235-807257 TAAGGAAACCAAGGCACAGAAGG + Intergenic
1051549841 9:18315819-18315841 AGTGGACACCAAGGCCAAGGAGG + Intergenic
1056457926 9:86781372-86781394 CCTGGCCACCAGGGCAGAGGCGG + Intergenic
1057522632 9:95772187-95772209 GCTGGACACTAGGCCACAGGAGG + Intergenic
1059077590 9:111210363-111210385 TCCGAAGACCAAGGAACAGGTGG + Intergenic
1059596837 9:115730070-115730092 TCTTGAAACCAAGACACAGAGGG - Intergenic
1060157418 9:121329297-121329319 TCTGGACACCTGGGACCAGGTGG + Exonic
1061938237 9:133870593-133870615 GCTGGTCCCCAAGGCTCAGGTGG - Intronic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1186889758 X:13948447-13948469 TCTGGGCTACAAGGAACAGGTGG + Intergenic
1190082430 X:47366820-47366842 GCTGGACATCAAGACACAGCAGG - Intergenic
1195331991 X:103810173-103810195 TCTGGACACCAAGAAAAAGAAGG + Intergenic
1199875198 X:151922935-151922957 TCGGAAGACCTAGGCACAGGTGG + Intronic