ID: 947810198

View in Genome Browser
Species Human (GRCh38)
Location 2:232999360-232999382
Sequence CTGGGTCAGAGACAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 1, 3: 90, 4: 542}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947810198_947810205 6 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810205 2:232999389-232999411 ACATCTATGCTGCATTGTGTCGG 0: 1
1: 0
2: 1
3: 18
4: 166
947810198_947810208 13 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810208 2:232999396-232999418 TGCTGCATTGTGTCGGGGACTGG 0: 1
1: 0
2: 1
3: 8
4: 87
947810198_947810210 17 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810210 2:232999400-232999422 GCATTGTGTCGGGGACTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 218
947810198_947810207 8 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810207 2:232999391-232999413 ATCTATGCTGCATTGTGTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 54
947810198_947810209 16 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810209 2:232999399-232999421 TGCATTGTGTCGGGGACTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 171
947810198_947810211 20 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810211 2:232999403-232999425 TTGTGTCGGGGACTGGTGGGTGG 0: 1
1: 0
2: 2
3: 36
4: 511
947810198_947810206 7 Left 947810198 2:232999360-232999382 CCCTCCCCTTGTCTCTGACCCAG 0: 1
1: 0
2: 1
3: 90
4: 542
Right 947810206 2:232999390-232999412 CATCTATGCTGCATTGTGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947810198 Original CRISPR CTGGGTCAGAGACAAGGGGA GGG (reversed) Intronic
900090258 1:917191-917213 GTGGGTCTGAGACCAGGAGAAGG + Intergenic
900318409 1:2070641-2070663 CTGGGGCAGATAGCAGGGGAAGG + Intronic
900540006 1:3197839-3197861 CTGGGTCAGGGACGAGGGTCAGG + Intronic
900547657 1:3237464-3237486 CTGGGGCAGACACAATGGGTAGG - Intronic
900734042 1:4283736-4283758 CTGGGTCAGAGAGGTGGGGTGGG - Intergenic
900927159 1:5712924-5712946 CTGGTTCAGAGACAAGGAGCAGG - Intergenic
901063498 1:6484667-6484689 TTGGGTCTGAGAGAAGGGGCTGG - Intronic
901150803 1:7099958-7099980 CTGGGGCAGAGGCCAGGGGGTGG + Intronic
901324369 1:8358152-8358174 GTGGGACAGAGGCACGGGGAGGG - Intronic
902375194 1:16027170-16027192 CAGGGACAGACAGAAGGGGAGGG - Intronic
902535737 1:17118549-17118571 CTTGGACAGAGAGAAGGGGAGGG + Intronic
903262977 1:22141436-22141458 CTGGGTCACAGAGCTGGGGAGGG - Intronic
904008705 1:27377831-27377853 CTGGGGGAGAAACAAGGGCAGGG + Intergenic
904865743 1:33577575-33577597 CAGTGGCAAAGACAAGGGGATGG - Intronic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905284855 1:36872724-36872746 CTGGGTTAGAGAGAAGCAGATGG - Intronic
905359895 1:37412008-37412030 CTGGGACATAGGAAAGGGGAGGG - Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
906015143 1:42569976-42569998 GTGGGTGGGGGACAAGGGGAGGG + Intronic
906687520 1:47772076-47772098 CTGGGCCAGGGAGAGGGGGAAGG + Intronic
906880390 1:49583082-49583104 CTGGGTCAGAAACCAGGGCCAGG - Intronic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907861870 1:58361617-58361639 CAGGGTCAGAAAAAAGGGCAAGG - Intronic
908592640 1:65650547-65650569 CTTGGTCAGACACAGTGGGATGG - Intergenic
908735976 1:67277430-67277452 GGGGGTCAGGGGCAAGGGGAGGG + Intergenic
908816584 1:68041729-68041751 AGGGAACAGAGACAAGGGGATGG - Intergenic
910444920 1:87290495-87290517 CAGGGACAGGGAGAAGGGGATGG + Intergenic
912684285 1:111749753-111749775 CTGGGTGAGAGACAAATGGCAGG - Intronic
912711450 1:111952821-111952843 GAGGGAAAGAGACAAGGGGATGG + Intronic
913971612 1:143421678-143421700 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
914044780 1:144082151-144082173 CTGAGTCAGAGAGATGGGGATGG - Intergenic
914065989 1:144247291-144247313 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
914113162 1:144719063-144719085 CTGGGTCAGAGGCCAGGGGCTGG + Intergenic
914133330 1:144878535-144878557 CTGAGTCAGAGAGATGGGGATGG + Intergenic
914705079 1:150163572-150163594 CTAGGTCAGAGGCAACGGGTTGG - Intronic
914707072 1:150179156-150179178 CTGGGGCAGAGGCAGTGGGAAGG - Intergenic
915121379 1:153631626-153631648 CTGAGTCAGAGGCAAGGGGGTGG - Intronic
915529346 1:156494452-156494474 CAGGTTCTGAGACAAGGAGACGG + Intronic
915549255 1:156623328-156623350 CTGGGGCAGAGAAAAGGGGTTGG - Intronic
915914413 1:159932404-159932426 GTGGGGCAGACACATGGGGAGGG - Intronic
915943246 1:160132270-160132292 CTGGGTCAGAGCCAGTTGGAAGG + Intronic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
916621649 1:166504307-166504329 GGGGGTTAGGGACAAGGGGAGGG + Intergenic
917242278 1:172961373-172961395 GAGGGTGAGAGGCAAGGGGAGGG - Intergenic
917364608 1:174216164-174216186 ATGGGTAAGGGACATGGGGATGG + Intronic
917693732 1:177495999-177496021 CTGGGAGAGACCCAAGGGGAGGG - Intergenic
918410396 1:184252426-184252448 GTGGGTGGGGGACAAGGGGAGGG + Intergenic
918705042 1:187649634-187649656 CTTGGACAGAAACATGGGGATGG + Intergenic
919653330 1:200172575-200172597 TTGGGTCAGAGACTTGGGGATGG + Intronic
919839689 1:201599748-201599770 CAGGCTCAGGGACAGGGGGAGGG + Intergenic
920252192 1:204629122-204629144 CTGGGACAGAGGCAAGGGCGGGG + Intronic
921026256 1:211285542-211285564 TTGGTTCAGAATCAAGGGGAAGG + Intronic
921266479 1:213424913-213424935 CTGGGACAGAGGCAAGCTGAGGG - Intergenic
921315355 1:213885325-213885347 CTGGGTGAGAAATAAGGAGAGGG - Intergenic
921728688 1:218552717-218552739 CTGGAAGAGAAACAAGGGGAAGG - Intergenic
922692454 1:227705613-227705635 CGGGGTCGGGGGCAAGGGGAGGG + Intergenic
923369512 1:233296030-233296052 GAGGATCAGAGAGAAGGGGAAGG - Intergenic
924822143 1:247503607-247503629 CTGGGGCAGAGAAGAGGAGAGGG + Intergenic
1063281555 10:4634641-4634663 CTGTGGCAGAGAAAAAGGGAAGG + Intergenic
1063852995 10:10214275-10214297 CTGCATCTGAGACAAGGAGAAGG - Intergenic
1064172161 10:13043211-13043233 CTGGGTCAGGGAGAGGGAGAGGG - Intronic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1064848529 10:19683919-19683941 GGGGGTGAGGGACAAGGGGAGGG - Intronic
1064849929 10:19699041-19699063 GGGGGTGAGGGACAAGGGGAGGG + Intronic
1066627645 10:37425595-37425617 GGGGGTCAGGGACAAGGGGAGGG - Intergenic
1066707143 10:38192812-38192834 GGGGGTCAGAGGCAAGGGGAGGG + Intergenic
1066956902 10:42181830-42181852 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1067067732 10:43113126-43113148 CAGGGTCAGGGACAGGGGGAAGG + Intronic
1067097289 10:43310351-43310373 AGGGGTGAGAGACAAAGGGAGGG - Intergenic
1067946587 10:50693213-50693235 GGGGGTCAGGGTCAAGGGGAGGG - Intergenic
1067964886 10:50900151-50900173 CTGGGTCATTAACAAGGGGGTGG - Intergenic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1068404152 10:56568698-56568720 GTGGGTGGGGGACAAGGGGAGGG - Intergenic
1068516328 10:58030416-58030438 CTGGGGCTGAGACAAGGAGGAGG - Intergenic
1068689930 10:59905421-59905443 CTGGGGCCGAAACCAGGGGAAGG - Intronic
1069983873 10:72270865-72270887 CTGGTTCAGAGGCCAGGAGATGG + Intergenic
1070239594 10:74665399-74665421 CTGGGTCAGAGGCAGTGGCAGGG + Intronic
1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG + Intergenic
1070504904 10:77104546-77104568 TTGGGACAGAGAGAATGGGATGG - Intronic
1070707436 10:78650755-78650777 CAGGGTTAGAGACAAGGAGTTGG + Intergenic
1070790882 10:79188638-79188660 CTGGGTAAAAGACTGGGGGAGGG - Intronic
1070831208 10:79419089-79419111 GTGGGTCAGGGAGAAGGAGAGGG + Intronic
1070858470 10:79629001-79629023 CAGGGCCAGGCACAAGGGGAAGG - Intergenic
1070881901 10:79858214-79858236 GGGGGTCAGGGTCAAGGGGAGGG - Intergenic
1071648478 10:87374528-87374550 GGGGGTCAGGGTCAAGGGGAGGG - Intergenic
1072443382 10:95477205-95477227 CTAGGTCAGAGACGAAAGGAAGG - Intronic
1072766418 10:98098311-98098333 CTGAGTCACAGAGACGGGGATGG - Intergenic
1072901133 10:99407952-99407974 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1073794899 10:106976685-106976707 GGGGGTGAGAGGCAAGGGGAAGG - Intronic
1074146589 10:110721997-110722019 CAGGGGCAGAGACAAGGAGAAGG - Intronic
1074433116 10:113410189-113410211 TTGGGTCTGAGACAATGCGAAGG + Intergenic
1074447891 10:113535245-113535267 GTGAGTGAGGGACAAGGGGAGGG - Intergenic
1074667347 10:115743365-115743387 CAGAGTCAGAGGCAAGGGCAGGG - Intronic
1075641540 10:124068145-124068167 CAGAGGCAGAGCCAAGGGGATGG + Intronic
1076243586 10:128928671-128928693 ATGGGCCAGAGACTGGGGGAAGG - Intergenic
1076263927 10:129094201-129094223 CTGGATCAGAGAAAAAGGGAGGG + Intergenic
1076568081 10:131412370-131412392 CTGGGACAGAGGCAGGGGCAGGG + Intergenic
1077308262 11:1877348-1877370 CTGGGTCAGAGGCCAGGGGCTGG + Intronic
1077353346 11:2103216-2103238 GTGGGTCAGAGAGAGGGGCAAGG - Intergenic
1077403157 11:2368928-2368950 CTGGGTGGGAGACAGGAGGAAGG - Intergenic
1077411296 11:2405112-2405134 CTGGCTCAGAGGCAAGGGCCAGG + Intronic
1078106466 11:8361199-8361221 CAGGGCCAGAGGGAAGGGGAGGG + Intergenic
1078263992 11:9739341-9739363 GTGGTTCAGAGAAAAGAGGAAGG + Intronic
1078734540 11:14007882-14007904 TTGAGACAGAGACAAGGAGAAGG - Intronic
1079443016 11:20534304-20534326 AGGAGGCAGAGACAAGGGGAAGG - Intergenic
1080819414 11:35791052-35791074 CTGGGCCAGGGACAGTGGGAGGG - Intronic
1081095519 11:38929018-38929040 CTTTGTCAGAGACAATAGGAAGG + Intergenic
1081456515 11:43228640-43228662 CAGGGTCAGAGAGTGGGGGAGGG - Intergenic
1081671440 11:44944918-44944940 CTGGGAAAGAGACAGGGGGTTGG - Intronic
1081745291 11:45468581-45468603 CTGGGTCTGTGAAAAGGAGAAGG - Intergenic
1082100616 11:48170020-48170042 GTTGGTCAGAGGCAAGAGGAGGG + Intronic
1082705176 11:56486011-56486033 CTGGGACAGAGGCAAGGGAAGGG - Intergenic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG + Intergenic
1083397334 11:62400904-62400926 CTGGTCCAGAGACGAGGGGCAGG - Intergenic
1085521314 11:77140529-77140551 CTCGGTGAGAGAGAAGGGGTGGG - Intronic
1085618915 11:78022852-78022874 GTGGGGAAGAGACAAGGGAAAGG + Intronic
1085899681 11:80684050-80684072 GTGGGTAGGGGACAAGGGGAGGG - Intergenic
1086337659 11:85814804-85814826 TTGGGTCAGAAACAGAGGGAAGG - Intergenic
1086582214 11:88412251-88412273 GAGGGTGAGGGACAAGGGGAGGG - Intergenic
1087904124 11:103675753-103675775 CAGGGTGAGGGACAAGGGGAGGG + Intergenic
1087906923 11:103709231-103709253 CTGGATCACAGAGAAGGGGTTGG + Intergenic
1088326758 11:108608843-108608865 CTGTGTGAGAGAGAGGGGGAGGG + Intergenic
1089196520 11:116696708-116696730 CAAGGTCAGAGAGAAGGGGTGGG + Intergenic
1089233882 11:117006140-117006162 CTGTGCCAAAGACCAGGGGAAGG - Intronic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089514874 11:119026132-119026154 CTGTGTCAGAGTCCAGGGGTGGG - Intronic
1089680587 11:120116917-120116939 CTGTGGGAGAGAAAAGGGGAGGG + Intronic
1089701313 11:120245790-120245812 CTGGCTCAGTGAGAAAGGGATGG - Intronic
1090619253 11:128547073-128547095 CTGTCTCAGAGACAATGGAATGG + Intronic
1091891068 12:4055000-4055022 CCAGGTGAGAGACAAGGCGAAGG + Intergenic
1093839347 12:23876993-23877015 GGGGGTCAGGGGCAAGGGGAGGG + Intronic
1094527036 12:31238190-31238212 GTGGGTCAGGGAATAGGGGAGGG + Intergenic
1096644953 12:53027736-53027758 TGGTGTCAGAGAAAAGGGGATGG + Intronic
1096975566 12:55697631-55697653 CGGGGTCAGAGTCACAGGGAGGG + Intronic
1096977754 12:55708907-55708929 CTGGGACAGAGGCAAGGGGGTGG + Intronic
1096996227 12:55839951-55839973 CTGGGTCAGAGAGCAGGGAGTGG - Intronic
1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100671194 12:96814696-96814718 GTGGGTTGGGGACAAGGGGAAGG - Intronic
1101039410 12:100739263-100739285 TAGGGTCTGAGACATGGGGAAGG - Intronic
1101516365 12:105439317-105439339 GGGGGTGAGAGGCAAGGGGAGGG - Intergenic
1101549334 12:105747598-105747620 GTGGGTCAGAAACAAGAGAATGG + Intergenic
1102014403 12:109638195-109638217 CTGGCTCAGAGACCTGGGAATGG - Intergenic
1102633476 12:114302195-114302217 CTGAGTCTGAGACAAGGAGGAGG - Intergenic
1102730405 12:115103995-115104017 CTGGGGCAGGGCCAAGGGCAGGG - Intergenic
1102826265 12:115950169-115950191 CTGGGTAAGAGGTGAGGGGAAGG + Intergenic
1102969051 12:117151714-117151736 CTATGGCAGAGACAAGGGCAGGG + Intronic
1103228629 12:119309187-119309209 CTGGGTCAGAGGGGAGGGGAAGG + Intergenic
1103524350 12:121557912-121557934 CTGGGAGGGAGGCAAGGGGAGGG - Intronic
1103568121 12:121827225-121827247 CTGGGTGAGAGCCAAGGAGGGGG + Intronic
1104515159 12:129418560-129418582 GTGGGTGGGGGACAAGGGGAGGG + Intronic
1105831434 13:24165638-24165660 CTGGGACAGATGCACGGGGAGGG + Intronic
1105949156 13:25213965-25213987 ATGGCTCAGAGTCAGGGGGAGGG + Intergenic
1106345411 13:28872160-28872182 CTGGGTAAGAGACAGTGGTATGG + Intronic
1106430154 13:29673258-29673280 CAGGGTCGGGGGCAAGGGGAGGG + Intergenic
1107225336 13:38042703-38042725 GGGGGTCAGGGACTAGGGGAGGG - Intergenic
1107313275 13:39103575-39103597 CTGGGTCAGGGAGGTGGGGATGG - Intergenic
1108576961 13:51799134-51799156 TGGGGTGAGAGACAAGGGGAGGG - Intronic
1110394972 13:75019179-75019201 CGGGGTAGGGGACAAGGGGAGGG + Intergenic
1111378837 13:87419050-87419072 ATAGGTCAGAGATAAGTGGATGG - Intergenic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1113445800 13:110365621-110365643 CAGGTTCAGAGAGAAGGGTAGGG - Intronic
1113521082 13:110941526-110941548 TTGAGTCAGAGAAAAGGAGAAGG - Intergenic
1113678756 13:112227154-112227176 CTGGGTCAGACCAAAGGGGCAGG - Intergenic
1114455293 14:22849785-22849807 CTGGGTCAGCGGGAAGGGAAGGG + Intergenic
1114519611 14:23324992-23325014 CTGAGTGAGAGACAGGGGCAAGG - Intronic
1114593421 14:23891255-23891277 CTTGGTCAGAGACCAGGGAGTGG - Intergenic
1114593846 14:23894276-23894298 CTTGGTCAGAGACCAGGGGGTGG - Intergenic
1115328273 14:32166411-32166433 CTGGGGCAGAGACATGTGGATGG + Intergenic
1115546512 14:34469264-34469286 CAGGGACAGAAACAAGGGGTGGG - Intergenic
1115866554 14:37754229-37754251 AGGGGTCAGGGGCAAGGGGAGGG - Intronic
1116551411 14:46244225-46244247 GTGTGTTGGAGACAAGGGGAAGG - Intergenic
1116974626 14:51101726-51101748 GTGGGTGAGAGACAAGGAGGAGG - Intergenic
1117416926 14:55505393-55505415 CTTGCTCAGATGCAAGGGGAAGG + Intergenic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1118325863 14:64779928-64779950 CTCGCTGAGACACAAGGGGACGG + Exonic
1120207099 14:81598684-81598706 GTGAGTTGGAGACAAGGGGAAGG - Intergenic
1121174191 14:91878432-91878454 CAGGGTCAGAGACAGAGGAAGGG - Intronic
1121337646 14:93086967-93086989 CTGGGTCAGGGTCAAGGTCAAGG - Intronic
1121445589 14:93976868-93976890 GTGGGTCAGAGACAGAGGCAGGG + Intergenic
1122148341 14:99707545-99707567 CTGGGGGAGAGAGAAGGGCAAGG - Intronic
1122215301 14:100199682-100199704 CTGAGTCAGAGACTCTGGGAGGG - Intergenic
1122675491 14:103409295-103409317 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1122730412 14:103793063-103793085 CTCTGTCATAGAAAAGGGGAAGG + Intronic
1122887861 14:104718488-104718510 CTGGGTCTCAGACAGGGGGTGGG + Intronic
1123173498 14:106396654-106396676 CTGTGTGAGAGACATGGTGAGGG - Intergenic
1123199160 14:106645259-106645281 CTGGGGCAGATACAACTGGATGG + Intergenic
1202936209 14_KI270725v1_random:89950-89972 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1124205753 15:27718698-27718720 GTTGGGCAGAGACAAGGGGTGGG - Intergenic
1124802138 15:32843273-32843295 CTGGGTAAGATTCAAGGGGTGGG - Intronic
1124956667 15:34364822-34364844 CTGGGACAGAGAGAAGGTGTTGG - Intronic
1125336131 15:38627953-38627975 CTGGGGCGGAGACTAGGGGTGGG + Intergenic
1125599642 15:40908167-40908189 CTTGGGCAGAGAAAAGGGAAAGG + Intergenic
1125665821 15:41429314-41429336 CAGGGACAGAGAGAAGTGGAAGG - Intronic
1126050385 15:44679903-44679925 CTGGGACTGGGACAAGAGGATGG + Intronic
1126065331 15:44822214-44822236 CCAGGTCAGGCACAAGGGGAAGG + Intergenic
1126094502 15:45078369-45078391 CCAGGTCAGGCACAAGGGGAAGG - Intergenic
1126646352 15:50878811-50878833 ATGGGACAGAGACAAAGTGAAGG + Intergenic
1126993299 15:54408980-54409002 CTGGGGCACAGACAAGAGAAGGG + Intronic
1127190868 15:56529162-56529184 CAGGGACTGGGACAAGGGGAGGG + Intergenic
1128358901 15:66946767-66946789 CCTGGCCAGAGACAAGGGGTTGG + Intergenic
1128723542 15:69971057-69971079 CTGGGGCAGGGACAAGGGAACGG - Intergenic
1128773421 15:70301031-70301053 CTGGGACAGAGACTTGAGGAGGG - Intergenic
1128823894 15:70691672-70691694 CTGGCACAGAGAAAAGGGAAAGG + Intronic
1128928392 15:71680182-71680204 CTGCTTTAGAGACAAGGGAAGGG - Intronic
1129185827 15:73905881-73905903 CTGGGACAGAGGCCAGGGAAGGG - Intergenic
1130185452 15:81677187-81677209 CTGGGACAGAGAACAGGGAAGGG + Intergenic
1132411710 15:101583857-101583879 GGGGGTCGGGGACAAGGGGAGGG - Intergenic
1133371729 16:5250414-5250436 GGGGGTGAGGGACAAGGGGAGGG - Intergenic
1134304900 16:13023160-13023182 CAGGGTCAGGGACTTGGGGAGGG - Intronic
1134450082 16:14357927-14357949 CTGGTTCAGAGACATGAGAAGGG + Intergenic
1134847387 16:17451413-17451435 GTGAGTCAGGGAGAAGGGGAGGG - Intronic
1135190817 16:20353036-20353058 CTTGGTCACTGACAAGGGCAGGG + Intronic
1135617070 16:23920704-23920726 CTGGGGCAGAGCCCAGGGGAAGG + Intronic
1135863908 16:26082817-26082839 CTTGGTAAGATGCAAGGGGATGG - Intronic
1136313188 16:29429524-29429546 TTGGGGCAGAGAAAAGGTGAGGG + Intergenic
1138322752 16:56131274-56131296 CTGGGGTAGAGGCAAGGGAAAGG + Intergenic
1138428140 16:56950285-56950307 CTCAGGCAGAGCCAAGGGGAGGG - Intergenic
1138942731 16:61809432-61809454 AAGGGTCAGGGGCAAGGGGAGGG + Intronic
1139656014 16:68387601-68387623 CTGGGCCTGAGACAGGGGGCGGG - Intronic
1140327360 16:74017829-74017851 CTGGGGTAGAGATATGGGGAAGG - Intergenic
1140409747 16:74734532-74734554 CTGCCTTAGAGAGAAGGGGAGGG + Intronic
1140715488 16:77722421-77722443 CTGGGGCGGAGACAGGGGGCGGG - Intergenic
1140940941 16:79721357-79721379 CGGGGTCACAGAGAAGGGCAAGG + Intergenic
1141206897 16:81939619-81939641 CAGGATCAGGGACAAGGGAACGG - Intronic
1141383415 16:83596692-83596714 GTAGGTCAGAGGCAAGTGGAAGG + Intronic
1141471482 16:84241511-84241533 CTGGGGCAGTGACAACGGGGAGG + Intergenic
1142080108 16:88144394-88144416 GTAGGGCAGAGATAAGGGGATGG + Intergenic
1142090326 16:88206586-88206608 CTGGACCAGAGACAAGTGTAGGG - Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142373258 16:89694528-89694550 CTGGGTCAGGGACACTGTGAAGG - Intronic
1142512969 17:409488-409510 CTGGGTAAGGGACAAGGGAGAGG + Intergenic
1143864946 17:9917004-9917026 CAGCCTCAGAGACAAGGGCAGGG + Exonic
1144122751 17:12172307-12172329 CTGGGTCGGGGGCAGGGGGATGG - Intergenic
1144584039 17:16477326-16477348 CTAGGTCAGAGGCAAGGCCAAGG + Intronic
1144692377 17:17276367-17276389 CAGGGTCAGAGAGAAGTGGGAGG - Intronic
1144833231 17:18143376-18143398 GTTGGCCAGAGAAAAGGGGAGGG - Intronic
1145275512 17:21427023-21427045 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1145711811 17:26984873-26984895 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1146461015 17:33046188-33046210 CTGGATGAGTGACAAGGGCAGGG + Intronic
1146518334 17:33507036-33507058 CTGGGGCAGGGTCAAGGGGCCGG + Intronic
1146789135 17:35741788-35741810 CAGGATCTGCGACAAGGGGATGG - Exonic
1146816981 17:35950271-35950293 CCAGGTCAAAGCCAAGGGGAAGG - Intergenic
1147516769 17:41125548-41125570 GGGGGTGAGGGACAAGGGGAGGG + Intergenic
1147654099 17:42078723-42078745 CTGGGGCAGAGGCAGGGGCATGG + Intergenic
1147904897 17:43816386-43816408 CTGGATAGGAGACAAGGGGTGGG - Intronic
1148243068 17:46012731-46012753 CTGGGACAGGGACCAGGGAACGG - Intronic
1148359303 17:46998622-46998644 CCAGGTCAAAGCCAAGGGGAAGG + Intronic
1148793323 17:50185654-50185676 GTGGGGCGGAGACAACGGGAGGG + Intronic
1148795947 17:50196771-50196793 CTAGCTCAGAAACAAAGGGATGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149146175 17:53496438-53496460 CTGTGTCAGAAACTAGGGGGCGG - Intergenic
1149269981 17:54967601-54967623 CTGAGTCAGAAACACGGGGTGGG - Intronic
1149382091 17:56104603-56104625 CTGGGGCAGGAACCAGGGGAAGG - Intergenic
1150787392 17:68174117-68174139 CTGAGTCAAAGCCAAGGGGAAGG - Intergenic
1151354359 17:73549751-73549773 GGGGGGCAGAGACAAGGAGAGGG + Intronic
1151419087 17:73985662-73985684 CTGGGTGAGAGGCAAGGGGCTGG - Intergenic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1152111702 17:78360510-78360532 CGGGGTCCGGGAAAAGGGGAAGG - Intergenic
1152290254 17:79436279-79436301 CTGGGTAACAGACCAGGGCAGGG + Intronic
1152510712 17:80785683-80785705 CTCAGTCAGAGTCAAGGGGCCGG - Intronic
1152650489 17:81490302-81490324 CTGGGACAGAGAGACAGGGAAGG - Intergenic
1153408350 18:4765876-4765898 GTGGGTGGGGGACAAGGGGAGGG - Intergenic
1153579919 18:6562625-6562647 CTGGGAGAGAGACAAAAGGATGG - Intronic
1157519716 18:48337147-48337169 CAGGGTCAGAGCCAAGGGATGGG - Intronic
1157913928 18:51645836-51645858 GTGTGGCAGAGAAAAGGGGAAGG - Intergenic
1158477589 18:57793823-57793845 CTGGGACCGAGAGAATGGGAGGG - Intronic
1158680256 18:59560449-59560471 GTGGGTGGGAGACAAGGGGAGGG + Intronic
1159689528 18:71468735-71468757 CTGGGTCAGGGAGAAGGGATGGG + Intergenic
1159802805 18:72921663-72921685 TTGGGGCAGAGGCGAGGGGAGGG + Intergenic
1160217354 18:76944165-76944187 CTGCGTCAGAGTCACAGGGAAGG - Intronic
1160234237 18:77073380-77073402 CTGGGTCAGAGACAAAGGGTGGG + Intronic
1160387215 18:78503904-78503926 AGGTGTCAGAGCCAAGGGGAAGG - Intergenic
1160749526 19:727363-727385 CTGGGTCAGAGTCAAGGTCAGGG - Intronic
1160774831 19:850658-850680 CTGGCTCCAGGACAAGGGGAGGG - Intergenic
1160812103 19:1017369-1017391 CTGGGTCAGGGACAGGGTCATGG - Intronic
1160827056 19:1085492-1085514 ATGGAGGAGAGACAAGGGGAGGG - Intronic
1160827079 19:1085594-1085616 ATGGAGGAGAGACAAGGGGAGGG - Intronic
1160939775 19:1614810-1614832 CTGAGTCAGAGACAGGGGATGGG + Intronic
1161136978 19:2625677-2625699 CTGGGTCAGAGAGGAGATGAGGG + Intronic
1161295958 19:3520273-3520295 CTGGGCGAGGGAGAAGGGGATGG + Intronic
1161776984 19:6269006-6269028 CAGGGACAGAGAAAAGGGGAGGG + Intronic
1162395021 19:10412909-10412931 CTGAGTCAGAGTCAGGGGGATGG - Intronic
1163267381 19:16229134-16229156 CTGGTTCACAAACAAGAGGAAGG - Intronic
1163529447 19:17841321-17841343 CTGAGGCATAGAGAAGGGGAGGG + Intronic
1163745342 19:19043395-19043417 CTGGGGCAGAGGCAGGGGGCTGG + Intronic
1165343997 19:35232247-35232269 CTGGGTGAGGGTCAAGGGCAGGG + Intergenic
1166019407 19:40012170-40012192 TTGGGACAGAGACAAAGAGAAGG + Intronic
1166546782 19:43639054-43639076 AGGGGACAGAGACAAGGGGATGG + Intronic
1166802243 19:45465439-45465461 CTGTGGCAGAGCCAAGGCGATGG - Intronic
1166804529 19:45477379-45477401 ATGGGACAGAGAGGAGGGGAAGG + Intronic
1167483624 19:49747473-49747495 CTGGGTCAGACACCAGGGCGAGG + Intronic
1168294272 19:55370957-55370979 CTGAGACAGAGACAGGGAGATGG + Intergenic
1202684338 1_KI270712v1_random:35555-35577 CTGAGTCAGAGAGATGGGGATGG - Intergenic
925247229 2:2394744-2394766 CTGCTTCACAGAGAAGGGGAAGG - Intergenic
925766993 2:7245779-7245801 CTGGGACACTGACAAGGGCAAGG + Intergenic
926056644 2:9777667-9777689 CAGGGACAGAGCCAAGGGCAGGG - Intergenic
926146486 2:10399701-10399723 CAGGGGCAGAGAGAAGCGGAAGG - Intronic
926379167 2:12267177-12267199 CTGGGTGGGGGACTAGGGGAGGG - Intergenic
926412405 2:12617959-12617981 CTGGGTCAGATTCAATGGAAAGG - Intergenic
927048266 2:19301960-19301982 CTGGCTCACAGAGAAGGGGAGGG + Intergenic
927207051 2:20617360-20617382 CTGGCTCAGAGCCCTGGGGAGGG + Intronic
928208075 2:29301575-29301597 ATGGGTCAGGGACCAGGGAAGGG + Intronic
928250680 2:29675503-29675525 ATGGGACAGAGACCAGGGGGAGG + Intronic
928633314 2:33216329-33216351 CTGGGAAAGAAAAAAGGGGAGGG + Intronic
929333022 2:40707639-40707661 CAGGGTGGGAGCCAAGGGGAGGG - Intergenic
929599641 2:43197135-43197157 CTGAGTCTAAGACAAGGGGCTGG - Intergenic
930606189 2:53495927-53495949 CTGGGTCAGATTTTAGGGGAAGG - Intergenic
930610099 2:53532808-53532830 TTGGGTCGGGGGCAAGGGGAGGG - Intronic
931255993 2:60573446-60573468 GTGGGTCAGAGTCCAGGGGAGGG + Intergenic
931640552 2:64377346-64377368 CTGGGAAAGAGAAAAGGAGAGGG + Intergenic
932643631 2:73478829-73478851 TGGGGTCAGGGGCAAGGGGAGGG - Intronic
932704079 2:74009968-74009990 CTGGCTCAGGGACAAGTGGCAGG - Intronic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933038375 2:77429699-77429721 CTGGGACAGAAAGAAGGGGTGGG + Intronic
933466437 2:82658034-82658056 CAGGCACAGACACAAGGGGATGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933976697 2:87517773-87517795 CTCTGTCAGAGACAAGGGCAGGG + Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934176308 2:89582611-89582633 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
934247380 2:90319291-90319313 CTGAGTCAGAGAGATGGGGATGG + Intergenic
934261945 2:91483312-91483334 CTGAGTCAGAGAGATGGGGATGG - Intergenic
934286618 2:91656972-91656994 CTGGGTCAGAGGCCAGGGGCTGG - Intergenic
934304985 2:91814300-91814322 CTGAGTCAGAGAGATGGGGATGG - Intergenic
934328272 2:92038448-92038470 CTGAGTCAGAGAGATGGGGATGG + Intergenic
934466652 2:94268989-94269011 CTGAGTCAGAGAGATGGGGATGG + Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
934865076 2:97801219-97801241 CTTGGGCAGAAACAAGGGCATGG + Intronic
935578781 2:104737430-104737452 GTGGGACAGGGACAAAGGGAAGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936317120 2:111433031-111433053 CTCTGTCAGAGACAAGGGCAGGG - Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936517419 2:113191190-113191212 CTGGGTCAGGGTTAATGGGAGGG - Intronic
937345531 2:121123264-121123286 CTTCCTCAGAGACAAGGGGGTGG + Intergenic
937682728 2:124661992-124662014 GGGGGTGGGAGACAAGGGGAGGG - Intronic
937822641 2:126328144-126328166 CTGGGTCTGTCACAAAGGGAAGG - Intergenic
938091359 2:128436942-128436964 CCTGGTCAGAGCCAACGGGATGG - Intergenic
938314925 2:130318751-130318773 CAGGGTCAGAGCCAAGGACAAGG + Intergenic
938747767 2:134296199-134296221 CTGTGTCAGAGAATTGGGGATGG + Intronic
938903381 2:135817358-135817380 CTGGGTCAGAGATGCCGGGAGGG + Exonic
940029951 2:149251448-149251470 GAGGGTGGGAGACAAGGGGAGGG - Intergenic
940184078 2:150963057-150963079 GCGGGTGGGAGACAAGGGGAGGG + Intergenic
940836782 2:158530714-158530736 CTGCTTCAGAGATAAGGGGTAGG + Intronic
941384465 2:164836855-164836877 CTTGGTCTGGGACCAGGGGATGG - Intronic
941887585 2:170544768-170544790 CTTGGAGAGAGACAAGAGGATGG + Intronic
942606179 2:177693482-177693504 CTGGGACAGTGAAATGGGGAAGG - Intronic
943147142 2:184060268-184060290 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944614612 2:201447790-201447812 CCTGGGCAGAGAAAAGGGGAAGG - Intronic
945934376 2:215887816-215887838 CTAAGGCAGTGACAAGGGGATGG + Intergenic
947143029 2:227037226-227037248 GTGGGTGAGAGGCTAGGGGAGGG - Intronic
947341621 2:229146327-229146349 GGGGGTCAGGGGCAAGGGGAGGG + Intronic
947662601 2:231880886-231880908 CGGGGGCAGAGACAGGGAGAGGG - Intergenic
947810198 2:232999360-232999382 CTGGGTCAGAGACAAGGGGAGGG - Intronic
948857077 2:240735219-240735241 CTGGGTCTGAGAAAGGAGGAAGG - Intronic
1169141068 20:3227887-3227909 CTGGGTCAGAGAGAAGGCAGTGG + Intronic
1169389112 20:5175160-5175182 CTAGGTCAGAGAGCAGGGGAAGG - Intronic
1170265233 20:14459866-14459888 GGGGGTGAGAGACTAGGGGAGGG - Intronic
1170633224 20:18082994-18083016 CTGGGGCAGGAACATGGGGAAGG - Intergenic
1170724704 20:18916039-18916061 CTGAGTCAGAGAAAAGGAGTGGG + Intergenic
1171149110 20:22811175-22811197 CTGGGCTACAGACAAAGGGAAGG - Intergenic
1172306220 20:33882584-33882606 CTAGGGCAGAGACAAGGAGGTGG - Intergenic
1172588728 20:36102874-36102896 GTGGGTCAGTGCCAAGGGGAGGG + Intronic
1173250047 20:41359608-41359630 CTGGCTCCCAGACAAGGGGCGGG - Exonic
1174020304 20:47524644-47524666 CTGGTACAGAGACAGAGGGAGGG + Intronic
1175370339 20:58483942-58483964 CTGAGGCAGAGGCCAGGGGAGGG + Intronic
1175403054 20:58711439-58711461 CTGTGTCAGGGACACGGGGCAGG - Intronic
1175571892 20:60029626-60029648 CGGGGTGGGAGGCAAGGGGAAGG - Intronic
1175628623 20:60511940-60511962 CTAGGTCAAAGACAATGGTATGG - Intergenic
1175874547 20:62223158-62223180 CTGGGCCAGAGCCATGTGGACGG + Intergenic
1176258214 20:64164798-64164820 CTTGGACAGAGACAGGGAGAGGG + Intronic
1176587291 21:8599654-8599676 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1178729784 21:35090735-35090757 TTGGGTCAGGAAAAAGGGGAAGG - Intronic
1178929423 21:36804640-36804662 GAGGGTCAGAGAGATGGGGATGG - Intronic
1179129754 21:38624293-38624315 GTGGGTGGGGGACAAGGGGAGGG + Intronic
1179236338 21:39550396-39550418 GTGGGTAGGGGACAAGGGGAGGG - Intergenic
1179477888 21:41659612-41659634 AAGGGTCTGAGACACGGGGAGGG - Intergenic
1179488245 21:41724529-41724551 TTGGGTCAGGGACAAGGGCACGG - Intergenic
1180270122 22:10576651-10576673 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1180280560 22:10689626-10689648 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1180587781 22:16908163-16908185 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1180709219 22:17828446-17828468 CTGGGTCTGAGGCAAGGACACGG + Intronic
1180844435 22:18973531-18973553 CTGGGGCAGGGACGAGGAGAGGG - Intergenic
1181057038 22:20265180-20265202 CTGGGGCAGGGACGAGGAGAGGG + Intronic
1181065243 22:20302723-20302745 CTGGGGCAGATGTAAGGGGAAGG + Intergenic
1181685049 22:24522518-24522540 CTTGGCCAGAGACATGGGAAAGG - Intronic
1183001381 22:34862435-34862457 GAGGGGCAGAGACAAGGGCAAGG - Intergenic
1183589467 22:38771377-38771399 CAGGGGCAGAGACCAGAGGAAGG - Intronic
1183607889 22:38877281-38877303 CACGGTCAGAGACAAGGCCAAGG + Intergenic
1184520516 22:44991328-44991350 CTGGGTCCGTGCAAAGGGGAAGG + Intronic
1184685988 22:46096611-46096633 CTGGGTCAGGGACGGGGGTAGGG - Intronic
1185095794 22:48805242-48805264 GGGGCTCAGAGACAAGGGGAGGG + Intronic
1185372683 22:50468296-50468318 CTCAGTCAGGGACAAGGGCAGGG + Intronic
949469846 3:4382920-4382942 GGGGGTCAGAGACTAGGGGAGGG + Intronic
950012002 3:9730908-9730930 ATGGGTCTGAGAGAAGGGGCTGG - Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950946374 3:16952179-16952201 TGGGGTGGGAGACAAGGGGAGGG + Intronic
951208818 3:19951966-19951988 GTGGGACAGAGATGAGGGGAAGG + Intronic
951369629 3:21829456-21829478 CAGGGTCAGAGAGAAGGGATGGG + Intronic
952215442 3:31273436-31273458 CTGGGGCAGAGACAATGGGTTGG + Intergenic
954297340 3:49681610-49681632 CTGGGTCAGAGACCTGGCCAAGG - Intronic
954428921 3:50458907-50458929 CTGGGCCAGAAACCCGGGGAAGG - Intronic
954723117 3:52582799-52582821 CTGGGTCAAAGACACCGGGCCGG + Intronic
955411294 3:58657257-58657279 CAGGGTCAGAGAGATGGGGTTGG + Intronic
955919364 3:63939344-63939366 CAGGGTGAAAGACATGGGGATGG - Intronic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
957545558 3:81631949-81631971 GGGGGTGGGAGACAAGGGGAGGG - Intronic
958136383 3:89499253-89499275 CAGAGGCAGAGACAAGGGGGTGG + Intergenic
958550894 3:95610265-95610287 GTGGGTAAGAGACTAGGGTATGG - Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959003802 3:100996092-100996114 CTGGGTCAAAGACAAAGGAAAGG - Intergenic
959147618 3:102567907-102567929 CAGGGTGGAAGACAAGGGGATGG + Intergenic
959187093 3:103058075-103058097 ATGGGTGAGGGCCAAGGGGAGGG - Intergenic
959457766 3:106584640-106584662 CTGGGCCTGACACAAGGGAAAGG - Intergenic
960592921 3:119382412-119382434 CTGGGCTGGTGACAAGGGGAGGG - Intronic
960640666 3:119819840-119819862 CTGGGTCAGTGAGGAGAGGATGG + Intergenic
962846145 3:139275407-139275429 CTGGGTCAGAGCCTATGTGAGGG + Intronic
964366983 3:155961041-155961063 CAGGGTCAGGGGCTAGGGGAGGG - Intergenic
964708739 3:159648647-159648669 CTAGGGCACAGACAAGGGCAGGG - Intronic
964774045 3:160255874-160255896 CTGGGTCAAAGACAAGGGTGTGG + Intronic
965820117 3:172676612-172676634 CCGGTACAGAGACAAAGGGAGGG - Intronic
966965356 3:184986446-184986468 ATGACTCAGACACAAGGGGAGGG + Intronic
967120156 3:186375526-186375548 CTGGGTCAGAGAAAAAGGATAGG - Intergenic
968754017 4:2405592-2405614 CTAGGTCAGAGGGAAGGGGCCGG + Intronic
968982932 4:3860468-3860490 CCGGCTCAGATTCAAGGGGAAGG - Intergenic
970995489 4:22262658-22262680 GGGGGTGAGGGACAAGGGGAGGG + Intergenic
971417949 4:26450806-26450828 GAGGGTCAGAGGCAAGGGGAGGG + Intergenic
971438821 4:26657226-26657248 GGGGGTCAGAGGCAAGGGGAGGG - Intronic
971903741 4:32698229-32698251 CAGGATCAGAGACAATTGGAAGG - Intergenic
972061424 4:34878273-34878295 TGGGGTGAGAGGCAAGGGGAGGG + Intergenic
973623562 4:52750518-52750540 GTGAGTCAGAGATAAGAGGAGGG - Intronic
973811276 4:54572520-54572542 CTGGGAAAGAGACATGGGAAGGG - Intergenic
973896079 4:55414595-55414617 AGGGGTCAGGGGCAAGGGGAGGG - Intronic
974932826 4:68378797-68378819 CTGGGGCAGAGGCATGGGGCAGG + Intergenic
975241235 4:72061783-72061805 CGGGGTGGGAGGCAAGGGGAGGG + Intronic
976855317 4:89597671-89597693 CTGGTCCATACACAAGGGGAGGG + Intergenic
978757482 4:112319095-112319117 CTGGGAAAGAGACAAGTGGCAGG + Intronic
979328500 4:119404570-119404592 CTGGGGCAGAGGCAGGGGCAAGG - Intergenic
979502924 4:121460834-121460856 CTGAGAGAGAGACAGGGGGAAGG + Intergenic
979921204 4:126498718-126498740 GTGGGTCAGGGGGAAGGGGAGGG + Intergenic
981294412 4:143114719-143114741 CGGGGTGGGGGACAAGGGGAGGG + Intergenic
981589288 4:146339968-146339990 CGGGGTGGGGGACAAGGGGAGGG - Intronic
981752675 4:148107846-148107868 GGAGGTCAGGGACAAGGGGAGGG + Intronic
982381756 4:154756262-154756284 TAGGGTCACAAACAAGGGGAAGG + Intergenic
983803801 4:171968349-171968371 CTAGGACAGAGACATTGGGATGG - Intronic
984123250 4:175772078-175772100 CCAGGTCAGTCACAAGGGGAAGG + Intronic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
984880428 4:184405689-184405711 CAGTGTCAGAAACAAGGGGATGG + Intronic
985107639 4:186514634-186514656 CTGGGAAAGAGACAAATGGATGG + Intronic
985779851 5:1864829-1864851 CAGGGTCAGAGCCAGGAGGAGGG - Intergenic
985789387 5:1917026-1917048 CGGGGAGAGAGACAAGGGGGAGG - Intergenic
987227524 5:15859086-15859108 CTGGGGCACAGACAATTGGATGG - Intronic
987553677 5:19416842-19416864 GTGGGTGAGAGGCTAGGGGAGGG + Intergenic
987577974 5:19754914-19754936 CTGGGTCAAAAACAAAAGGATGG + Intronic
988296166 5:29365562-29365584 CTGGGTGGGAGAAAATGGGAAGG - Intergenic
988308062 5:29519582-29519604 CTAGCTCAGAGAGAAGGGTAAGG - Intergenic
989128529 5:38080359-38080381 CAGACTCAGAGACAAGGGCAGGG - Intergenic
989139975 5:38192481-38192503 CTGGGTGAAGGACAAAGGGAAGG - Intergenic
989406176 5:41063728-41063750 CTGGGACTGAGAGAAGGGCAGGG + Intronic
990630545 5:57664120-57664142 GGGGGTGAGAGGCAAGGGGAGGG - Intergenic
990756724 5:59079924-59079946 CAGGGGCAGAGGCAAGGGAAGGG + Intronic
991184220 5:63788481-63788503 GTGGGGCAGAGAGAAAGGGAAGG + Intergenic
991990407 5:72333122-72333144 CTAGGTCAGAGTCAAGGGTCTGG - Intronic
992900486 5:81290158-81290180 CAGGGTCAGGGGCTAGGGGAGGG - Intergenic
993386702 5:87269534-87269556 TTGGGTCAGAGAGAAAGGAAAGG + Intronic
994570735 5:101510402-101510424 GTGGGTTAGAGACTAGGGGAGGG - Intergenic
994595709 5:101831850-101831872 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
996932075 5:128901640-128901662 CTGGCCCAGATTCAAGGGGAAGG + Intronic
996960991 5:129249432-129249454 CAGGGTAGGAGGCAAGGGGACGG + Intergenic
997555813 5:134797618-134797640 CTGGCCCAGATTCAAGGGGATGG + Intronic
997800623 5:136857320-136857342 CGGGGTGGGAGGCAAGGGGAGGG + Intergenic
998153795 5:139772492-139772514 CTGGGACAGGGAGAAGGAGAGGG - Intergenic
999350073 5:150861451-150861473 CAGGGTCAGATTCAAGAGGAGGG + Intronic
999380532 5:151118050-151118072 CTGGGACAGAGCTGAGGGGATGG - Intronic
999998668 5:157116798-157116820 GTGGGTCAGAGACAATGCGGGGG - Intronic
1000304467 5:159983114-159983136 CTGGGTCAGGTTGAAGGGGAAGG - Intergenic
1000442991 5:161285155-161285177 CTTGGAGAGAGACAAGGGGTGGG - Intergenic
1000661008 5:163938184-163938206 GGGGGTCAGGGCCAAGGGGAGGG + Intergenic
1000935049 5:167297352-167297374 CTGACTCAGAAACAAGGAGATGG - Intronic
1001576255 5:172765891-172765913 TTAGGACAGAGACAAGGGGATGG + Intergenic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1001838436 5:174852589-174852611 CTGGGTCATGGAAAAGGGTATGG - Intergenic
1001870640 5:175151297-175151319 CTGAGTCTCAGAGAAGGGGAGGG + Intergenic
1001897871 5:175396989-175397011 CTGGGGCAGAGCCAGCGGGACGG + Intergenic
1001980620 5:176035199-176035221 CTGAGTCTGAGAAAAGGAGAAGG + Intergenic
1002296552 5:178234533-178234555 CAGGGCCAGAGACAAGGAGTGGG - Intergenic
1002309420 5:178305809-178305831 ATGGGTCCGAGACATGGAGAAGG + Intronic
1002783767 6:385879-385901 CTTGGTTGGAGTCAAGGGGAAGG - Intergenic
1002928065 6:1616446-1616468 CCGGGTCAGAAACAAGGGTCAGG + Intergenic
1003019461 6:2497109-2497131 ATGGGACAGAGAGAAGGAGACGG + Intergenic
1003363049 6:5446882-5446904 CTGGTGCAGAGACACAGGGAGGG + Intronic
1004816533 6:19317157-19317179 TTGGGTCATGGACAAGGTGAGGG - Intergenic
1005560586 6:27036286-27036308 GGGGGTCAGGGGCAAGGGGAGGG - Intergenic
1005773925 6:29108334-29108356 CTTGGCCAGTGACATGGGGATGG + Intergenic
1005882544 6:30072082-30072104 CTGGGTCAGCAAAATGGGGAAGG + Intronic
1006136062 6:31897205-31897227 CTGGGGCCGAGAGAAGAGGAGGG + Intronic
1006173392 6:32108159-32108181 CAGGGTCAGGGAAAAGAGGAGGG + Intronic
1006839447 6:37019119-37019141 CTGGGTCAGGGAGAGGGGAAAGG - Intronic
1006898610 6:37486007-37486029 CTGAGTCAGACACAGGGAGATGG - Intronic
1006906550 6:37537039-37537061 CTGGGTCTGAGAGGAGGGGCAGG + Intergenic
1007131886 6:39482895-39482917 CTGGGCCCTAGAGAAGGGGAGGG + Intronic
1007176452 6:39901115-39901137 CAGGATCAGAGACAAGGCTAAGG - Intronic
1007294838 6:40813930-40813952 CTGCCTCTGAGAAAAGGGGATGG + Intergenic
1007366545 6:41398119-41398141 CTGGGTTAGAACCAAGGAGAAGG + Intergenic
1007483847 6:42167133-42167155 CTGGGCTGGAGACAAGGGGTGGG + Intronic
1007511531 6:42378027-42378049 CTGGGTAAGAGGCAAGGGATTGG + Intronic
1007790249 6:44304571-44304593 CTGAGTGGGAGCCAAGGGGAGGG - Intronic
1010016065 6:71105844-71105866 CTGGGGAAGAGACATGGGGAGGG - Intergenic
1010175987 6:73028478-73028500 CTGGGTCAGAGTGAACGGGGTGG - Intronic
1010208441 6:73343968-73343990 CTGGGTTAGAGAGAAGGGCCAGG - Intergenic
1011712533 6:90069202-90069224 CTGGGTCTGAGACAAGGACTTGG + Intronic
1012127762 6:95452917-95452939 GAGGGTGAGAGGCAAGGGGAGGG - Intergenic
1012230310 6:96753087-96753109 ATGGGTGGGAGGCAAGGGGAGGG + Intergenic
1012533030 6:100261411-100261433 CTGAGCAAGAGACAAGGGAAAGG + Intergenic
1013862980 6:114659114-114659136 GGGGGTTGGAGACAAGGGGAGGG + Intergenic
1014699064 6:124660970-124660992 CTGGGTAACACAAAAGGGGAGGG - Intronic
1017047415 6:150360229-150360251 GTGGGTGGGGGACAAGGGGAGGG - Intergenic
1017103298 6:150866405-150866427 CTGGGGCGGAAACCAGGGGAGGG + Intronic
1017148906 6:151260565-151260587 CAGGGTCTGAAACAAGGGGCTGG - Intronic
1017206640 6:151809332-151809354 CTGGGCAAGAGAAAATGGGAGGG - Intronic
1017905044 6:158752086-158752108 CTGGGGCAGAGTCCAGTGGATGG + Intronic
1018064770 6:160117224-160117246 CTGGGTCATTGACAAGGTGCAGG + Intergenic
1018749231 6:166788685-166788707 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1019181546 6:170190327-170190349 AGAGGTCAGAGAGAAGGGGATGG - Intergenic
1019422540 7:957796-957818 GCGGGTCAGTGACAAGGGGCAGG - Intronic
1022854108 7:34298693-34298715 GTGGGTAAGAGATAAGGGGAAGG + Intergenic
1023099656 7:36703535-36703557 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1023836622 7:44072453-44072475 CTGCCTCAGTGAGAAGGGGAGGG + Exonic
1023866253 7:44239673-44239695 CCGGGTTAGAGACGAGGGGAAGG + Intronic
1024914122 7:54479859-54479881 CTGGAACAGAGGCAAGGGGAAGG + Intergenic
1024920024 7:54545817-54545839 GAGGGACAGAGAGAAGGGGAGGG + Intronic
1027712056 7:81616584-81616606 CTGGCTCAGAGAAAAGTGTAAGG + Intergenic
1028356283 7:89914105-89914127 CTGAGTTAGGGACAAGGAGAAGG + Intergenic
1028883380 7:95905329-95905351 CTGGGTCAGTGACATCGGAATGG + Intronic
1029115118 7:98232702-98232724 CTGGGCGGGAGACCAGGGGATGG + Intronic
1029259704 7:99293510-99293532 CTGGGGCAGAGACAAGCTTAGGG - Intergenic
1029506735 7:100967566-100967588 CAGGGCCAGAGACCAGGTGAAGG - Exonic
1029658271 7:101941932-101941954 CAGGGACAGAGAGAGGGGGAGGG - Intronic
1031626085 7:123994753-123994775 GTGGGAATGAGACAAGGGGATGG + Intergenic
1031737832 7:125389051-125389073 CTGAGTCAGAGGCAAGGAGAAGG - Intergenic
1031876522 7:127147968-127147990 CTGGTTCAATGGCAAGGGGATGG - Intronic
1032508853 7:132455984-132456006 CAGGGCCAGAGACAAGGGAGGGG - Intronic
1032548968 7:132766714-132766736 CTGGGTCAGTGAGTAGGGCATGG + Intergenic
1033993558 7:147317621-147317643 CAGGGGCTGAGACAAAGGGAAGG - Intronic
1034111607 7:148542722-148542744 CTGGGCCAGAGAGAAAGGCAAGG - Intergenic
1034406808 7:150909392-150909414 CTGAGGCAGAGGCAAGGGGCTGG + Intergenic
1035070398 7:156140485-156140507 CTGAGGCAGAGAGAAGGGGAAGG + Intergenic
1035085440 7:156253797-156253819 CTGAGAGAGAGAAAAGGGGAAGG - Intergenic
1035381842 7:158445572-158445594 CTGGGGCAGAGGCGAGGGGTGGG - Intronic
1035754969 8:2023980-2024002 CTGGGTCAGAGCCGAGGAGAGGG + Intergenic
1036025262 8:4900471-4900493 CTGGGCCAGGGTGAAGGGGAAGG - Intronic
1036287518 8:7456945-7456967 CTGGGTTGTGGACAAGGGGAGGG - Intronic
1036333962 8:7854580-7854602 CTGGGTTGTGGACAAGGGGAGGG + Intronic
1036753321 8:11456721-11456743 CTGGGTAAGAGACATGGGCGGGG + Intronic
1037753453 8:21697079-21697101 ATGGGACAGAGGAAAGGGGAAGG + Intronic
1037781281 8:21870846-21870868 CAGGATCAGATACAGGGGGAGGG + Intergenic
1037876380 8:22550965-22550987 TTGGGGCAGAGACAGGGAGAGGG + Intronic
1038074237 8:24051912-24051934 ACGGGTGGGAGACAAGGGGAGGG + Intergenic
1038847869 8:31246476-31246498 TTGGCTCAGAGACAAGTGCAGGG + Intergenic
1040013680 8:42682973-42682995 CAGGGGAAGAGAGAAGGGGAAGG + Intergenic
1040421049 8:47240877-47240899 GAGGGTCAGAGACAATGTGATGG + Intergenic
1041277562 8:56178664-56178686 CTGTGACAGATACCAGGGGATGG - Intronic
1041320227 8:56604866-56604888 CTGGCTAAGACACCAGGGGATGG + Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1041526473 8:58812318-58812340 CAAGGTCAGAGTCAAGGGCAGGG - Intronic
1043957129 8:86373753-86373775 CTGGGCCTGCTACAAGGGGAAGG - Intronic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1047312937 8:123707695-123707717 GGGGGTCAGGGGCAAGGGGAGGG + Intronic
1048164798 8:132053080-132053102 GAGGGTAACAGACAAGGGGAAGG - Intronic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048767242 8:137858452-137858474 CAGGGACAGAAACAAGGAGATGG + Intergenic
1048929239 8:139297925-139297947 CTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1048941403 8:139403672-139403694 CTGGGCCAGACAATAGGGGAAGG - Intergenic
1049154231 8:141057093-141057115 GTGGGGCAGAGAGAAGGGGGTGG - Intergenic
1049925771 9:405966-405988 CTGGGGCAGTCAGAAGGGGAAGG - Intronic
1051472007 9:17454046-17454068 CTGGGTCCCATACAAGGGGAGGG + Intronic
1051695152 9:19760508-19760530 GGGGGTCAGGGACAAGGGGAGGG - Intronic
1052274188 9:26659252-26659274 CTGGGACAGAGACGAGGGACAGG - Intergenic
1052330687 9:27264863-27264885 CGGGGTGGGAGGCAAGGGGAGGG - Intergenic
1053423517 9:37996258-37996280 CTGGGTGTGAGGGAAGGGGAGGG - Intronic
1053696707 9:40645784-40645806 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1053943122 9:43275972-43275994 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054307957 9:63445015-63445037 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054406686 9:64769013-64769035 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054440313 9:65254473-65254495 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1054490094 9:65767465-65767487 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1054718716 9:68582621-68582643 CTTGGGCAGAGACAGTGGGATGG - Intergenic
1054990535 9:71320452-71320474 GTTGGTCAGAGACAAGAGAAGGG + Intronic
1057244427 9:93442477-93442499 CTGGCTCACACTCAAGGGGAGGG - Intergenic
1058291270 9:103243093-103243115 CTTGATCATAGAAAAGGGGACGG + Intergenic
1058609633 9:106761757-106761779 CTGGGCCAGGGAGAAGGGTATGG - Intergenic
1059715964 9:116913506-116913528 CTGGGTTTGAGGGAAGGGGAAGG + Intronic
1061272833 9:129553343-129553365 AGGGGGCAGAGAAAAGGGGAGGG - Intergenic
1061298185 9:129688468-129688490 CTGGGGCAGAGACTGTGGGAGGG - Intronic
1061423198 9:130483422-130483444 CAGGGTCAGGGACAGGGGGCTGG + Intronic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062441276 9:136570836-136570858 CGGGGCCAGGGACAAAGGGAAGG + Intergenic
1062447668 9:136602386-136602408 CTGGGGCGGGGACAGGGGGAAGG + Intergenic
1202779158 9_KI270717v1_random:19429-19451 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1203586217 Un_KI270747v1:5831-5853 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1203617250 Un_KI270749v1:77366-77388 CTGAGTCAGAGAGATGGGGATGG - Intergenic
1185433228 X:21449-21471 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185442430 X:233517-233539 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1188230464 X:27656795-27656817 ATGGGTCAAAGCCAAGGGGAAGG + Intronic
1188637832 X:32457521-32457543 CTTGTGCAGAGACAAGGGAAAGG + Intronic
1188972918 X:36639110-36639132 CTGGGCAAGAGACATGTGGATGG + Intergenic
1189370146 X:40421399-40421421 CTGGTCCAGATTCAAGGGGAAGG + Intergenic
1189548887 X:42072588-42072610 GTGGGGAAGAGACAAGGGGAAGG + Intergenic
1189916457 X:45860527-45860549 CTGGGTTAGAGAAACAGGGATGG - Intergenic
1190161914 X:48038207-48038229 AGGGGTGAGAGGCAAGGGGAGGG + Intronic
1190233828 X:48601311-48601333 ATTGGTCAGAGAGCAGGGGAAGG + Intronic
1190310406 X:49113487-49113509 CTGGGACAAGGACAAGGGAAAGG - Exonic
1190740809 X:53287701-53287723 AGGGGACAGAGGCAAGGGGAGGG + Intronic
1191985767 X:66978883-66978905 CTGGGTGGGGGACTAGGGGAGGG + Intergenic
1192075752 X:67994362-67994384 GGGGGTGAGGGACAAGGGGAGGG + Intergenic
1192240346 X:69323397-69323419 CTGAGGCAGAGGCAAGGTGAGGG + Intergenic
1192933147 X:75829903-75829925 GGGGGTCAGGGGCAAGGGGAGGG - Intergenic
1193689266 X:84620741-84620763 AGGGGTTACAGACAAGGGGAGGG - Intergenic
1194708682 X:97206154-97206176 TGGGGTCGGAGTCAAGGGGAGGG + Intronic
1195269980 X:103219907-103219929 CTGGTTCACAGAAAAGGTGAAGG - Intergenic
1197051756 X:122067375-122067397 CAGGGTCGGGGTCAAGGGGAGGG + Intergenic
1197203428 X:123769280-123769302 CTGGGTCCAACACAAGAGGAGGG + Intergenic
1197430713 X:126359433-126359455 GGGGGTGAGGGACAAGGGGAGGG + Intergenic
1197767874 X:130070836-130070858 CCAGGTCAGATACAAGAGGAGGG + Intronic
1198239194 X:134766471-134766493 CAGGGTCAGAGCCAAGGAGATGG + Intergenic
1198847787 X:140931318-140931340 CTGGTACAGAGACAGAGGGAAGG - Intergenic
1201194432 Y:11477735-11477757 CTGAGTCAGAGAGATGGGGATGG + Intergenic
1201757518 Y:17502432-17502454 CTGGGGAAGAGAAAAGGAGAGGG - Intergenic
1201844036 Y:18403550-18403572 CTGGGGAAGAGAAAAGGAGAGGG + Intergenic