ID: 947811441

View in Genome Browser
Species Human (GRCh38)
Location 2:233006699-233006721
Sequence GATGGTGCACAGAAAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947811441_947811442 -6 Left 947811441 2:233006699-233006721 CCAAGAGCTTTCTGTGCACCATC 0: 1
1: 1
2: 2
3: 23
4: 188
Right 947811442 2:233006716-233006738 ACCATCTCATTGAACACTCATGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947811441 Original CRISPR GATGGTGCACAGAAAGCTCT TGG (reversed) Intronic
901026209 1:6279976-6279998 GAGCGTGCACTGAAATCTCTGGG - Intronic
903333506 1:22609592-22609614 CACAGTGCACAGAAAGCACTTGG - Intergenic
904800041 1:33086159-33086181 GATCGTGTACAGAAAACACTTGG - Intronic
908256770 1:62309614-62309636 GATAGTGCACTTAAAGCCCTTGG - Intronic
909038491 1:70622594-70622616 CATGGAGAACAGAAAGATCTGGG - Intergenic
909610976 1:77551567-77551589 AATGGTCCACTGAGAGCTCTGGG + Intronic
910819988 1:91336095-91336117 GATGGGACAGAGAAAGCCCTTGG - Intronic
912146763 1:106803737-106803759 GATGGTGCTCAGAAATTTGTGGG - Intergenic
913237577 1:116798080-116798102 GGTGGTGCAGAGAAAGCCCTAGG + Intergenic
915096549 1:153466614-153466636 GATGGGGCTCAGAGAGCTGTCGG + Intergenic
915662993 1:157419054-157419076 TAGGGTGCACAGAAAGCTGAGGG + Intergenic
917822795 1:178782422-178782444 GGTGGAGAACAGAATGCTCTGGG - Intronic
920032090 1:203043707-203043729 GCTGGTTCACAGAAAGCTCAGGG + Intronic
920373699 1:205495066-205495088 GCAGGTGCACAGAATGCCCTTGG - Intergenic
920542718 1:206791643-206791665 CATGGGGCACAGGAAGCTTTGGG - Intergenic
920811674 1:209291725-209291747 GATGGTGAAAATAAAGCTCCAGG + Intergenic
922452741 1:225750120-225750142 GATAGTGCACAGAAAGCTCTTGG + Intergenic
923893498 1:238241720-238241742 GATGGTCCAAAGAGAGGTCTGGG + Intergenic
924912252 1:248526631-248526653 TATGGTGAACAGAGAGCTCTGGG - Intergenic
1064229977 10:13521404-13521426 GCTGGCACACAGCAAGCTCTGGG + Intronic
1064585846 10:16838526-16838548 GATGATGCACAAAAATCTTTGGG + Intronic
1067323607 10:45245431-45245453 GATGATGCACAAAAATCTCTGGG + Intergenic
1068011775 10:51460654-51460676 GATAATGCACAGAAAGCTTATGG + Intronic
1068571855 10:58638599-58638621 GATGAGGCACACACAGCTCTTGG - Intronic
1069117127 10:64521320-64521342 CATGGTCCCCTGAAAGCTCTGGG + Intergenic
1070085642 10:73234697-73234719 TAATGTGCACAGAAAGCTTTAGG - Intronic
1070285455 10:75080253-75080275 GATAATGCATATAAAGCTCTTGG + Intergenic
1071343354 10:84668157-84668179 GATGGGGCTCAGAGAGGTCTTGG - Intergenic
1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG + Intronic
1071878613 10:89869921-89869943 GATAGTGCACATAAAGCACCTGG + Intergenic
1074630827 10:115252950-115252972 GGTGGAGCACAGATAGCTCTTGG - Intronic
1077075397 11:698936-698958 GCTGCTGCACAGAGAGCACTCGG + Intronic
1077815254 11:5680524-5680546 GATGGGTCACACAAAGATCTTGG - Intronic
1078399526 11:11011677-11011699 GAGGGTGTATAGAAAGGTCTTGG + Intergenic
1078473897 11:11613949-11613971 GATGTTACACAGAAAGTTCCTGG - Intronic
1081589318 11:44409946-44409968 CGTGGTGCAGAGAAAGCACTTGG - Intergenic
1084207578 11:67604920-67604942 GATGCTGCAGAGAAGGCTCCTGG + Exonic
1084402599 11:68953688-68953710 AATAGCTCACAGAAAGCTCTAGG + Intergenic
1084939631 11:72605633-72605655 GATGGGGCTCAGAATGTTCTAGG + Intronic
1087365164 11:97209265-97209287 GATGGTGTAAAGAGAGCTCCTGG - Intergenic
1092161344 12:6317063-6317085 GAGGGAGCTCAGAGAGCTCTGGG + Intronic
1095691486 12:45094425-45094447 GAGGGAGCAGAGAAAGCTCGTGG - Intergenic
1096063691 12:48723207-48723229 TAAGGAGCACAGAATGCTCTGGG - Intergenic
1096252614 12:50042663-50042685 GATGGCACAGAGAATGCTCTGGG + Intergenic
1097738269 12:63208021-63208043 GAAGGTTCACAGAAAGCATTTGG + Intergenic
1098214431 12:68200503-68200525 GAGCCTGCCCAGAAAGCTCTGGG + Intergenic
1098882545 12:75931041-75931063 GATGGTTGAAAGTAAGCTCTAGG + Intergenic
1101549414 12:105748189-105748211 CCTGGTGCACAGTAAGCACTCGG + Intergenic
1104308649 12:127634069-127634091 AATGCTGCACAGAAAGATGTGGG + Intergenic
1104529551 12:129556248-129556270 GTTGGTGCACAGACAGCTGCTGG - Intronic
1104926055 12:132314394-132314416 GATGGTGCATATGAAGCGCTTGG - Intronic
1105305335 13:19164839-19164861 CATGGTGCCCAGATGGCTCTTGG - Intergenic
1106006119 13:25771692-25771714 GAGGGTGCACAGAAACATGTGGG - Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107879468 13:44820545-44820567 GATGCTGCCCAGTAAGATCTGGG + Intergenic
1116457637 14:45137200-45137222 GATGAAGCTCATAAAGCTCTCGG + Exonic
1116653162 14:47620010-47620032 AAAGGTTCACAGGAAGCTCTTGG + Intronic
1117231045 14:53719022-53719044 CATGGTTCACAAAAAACTCTAGG + Intergenic
1126992851 15:54402963-54402985 GATAATGCACAGAAAGCACCTGG + Intronic
1131450456 15:92535153-92535175 GCTGGTGCAGAGAAAACTATGGG + Intergenic
1135314820 16:21435616-21435638 GCTAGTGCAAAGGAAGCTCTTGG + Intronic
1135367745 16:21867890-21867912 GCTAGTGCAAAGGAAGCTCTTGG + Intronic
1135444071 16:22503266-22503288 GCTAGTGCAAAGGAAGCTCTTGG - Intronic
1135791854 16:25404213-25404235 GATGGCCCACAGAAAACTCCTGG - Intergenic
1136141251 16:28290242-28290264 GATGGTACACAGGAAGTCCTTGG + Intergenic
1136311487 16:29414297-29414319 GCTAGTGCAAAGGAAGCTCTTGG + Intergenic
1136324933 16:29516084-29516106 GCTAGTGCAAAGGAAGCTCTTGG + Intergenic
1136439618 16:30256068-30256090 GCTAGTGCAAAGGAAGCTCTTGG + Intergenic
1137645109 16:50066617-50066639 GATGGCACACAGAAGGCGCTGGG - Intronic
1139886122 16:70208373-70208395 GCTAGTGCAAAGGAAGCTCTTGG + Intergenic
1142155134 16:88529574-88529596 GATGGGGCTCAGAGAGCCCTGGG + Intronic
1142604198 17:1072665-1072687 GATGCTGGACAGGAAGTTCTGGG + Exonic
1142743957 17:1945893-1945915 GATGCTGCTCAGGAAGCCCTAGG + Intronic
1142808084 17:2382089-2382111 GTTGGTGCAGAGAGAGCTCTGGG + Intergenic
1146629404 17:34459104-34459126 GGTGGTGCTCACAGAGCTCTGGG + Intergenic
1148634627 17:49138957-49138979 GATAATGCACACAAAGCTCTTGG + Intronic
1148955410 17:51349839-51349861 TATGGTGGACAGAAAGCTTGGGG + Intergenic
1150922661 17:69499966-69499988 GATTGTGTTCAGGAAGCTCTGGG + Intronic
1156507738 18:37609164-37609186 GCCGGTTCACAGACAGCTCTTGG + Intergenic
1158395162 18:57073594-57073616 GATGATGCATATAAAGCCCTCGG - Intergenic
1159760665 18:72421213-72421235 GATGGTGCTAAGAAATTTCTGGG + Intergenic
1161326465 19:3666394-3666416 CAACGTGCAGAGAAAGCTCTCGG + Intronic
1161812533 19:6478939-6478961 GAGGATGCAGAGACAGCTCTGGG + Exonic
1163644520 19:18480962-18480984 GAAGGTGCATAGAAAGCTTATGG + Intronic
1163910231 19:20183101-20183123 GAGAATGCAGAGAAAGCTCTGGG - Intronic
1163932628 19:20411801-20411823 GAGAATGCAGAGAAAGCTCTGGG + Intergenic
1164744924 19:30604809-30604831 GAGGTTGCACAGCAAGCTCGGGG + Intronic
1164835696 19:31353838-31353860 GGTGGGGCACAGGTAGCTCTGGG - Intergenic
1167931753 19:52871700-52871722 AATTGTGCACACATAGCTCTAGG + Intronic
926644608 2:15275661-15275683 GATGGTGTACAGAGAGCTTGGGG + Exonic
927483733 2:23474321-23474343 GCTGGTGAACAGAGAGGTCTAGG - Intronic
930033587 2:47072407-47072429 GATGGCGCTCAGGAAGCCCTAGG - Intronic
932436102 2:71703348-71703370 GATGGTGGAGAGAATGCTCTTGG + Intergenic
935205872 2:100896089-100896111 CCTGGGGCACAGAAAGCTCTAGG - Intronic
935269564 2:101422186-101422208 GATGGTGCTCAGCAAGTTCAGGG - Intronic
935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG + Intergenic
938757586 2:134395010-134395032 GGTGGAAAACAGAAAGCTCTTGG + Intronic
939221088 2:139302228-139302250 GATGGTGGATAGATAGCACTTGG - Intergenic
940174946 2:150868541-150868563 GGTGGAGGCCAGAAAGCTCTTGG + Intergenic
943633498 2:190280308-190280330 GGTTGAGCCCAGAAAGCTCTAGG - Intronic
947811441 2:233006699-233006721 GATGGTGCACAGAAAGCTCTTGG - Intronic
1168940570 20:1707726-1707748 GATGGTGCACAGAGAGGGCTGGG + Intergenic
1169405425 20:5317421-5317443 ACTGGTGCCCAGGAAGCTCTGGG + Intergenic
1169587150 20:7097457-7097479 GATGGTCCTCAACAAGCTCTGGG - Intergenic
1170130731 20:13016862-13016884 GATGATGAACATAAAGCACTGGG - Intronic
1170435242 20:16319858-16319880 GAAGGAGAACAGAGAGCTCTGGG - Intronic
1172458584 20:35097067-35097089 GATAGTGCAAAGAAAGTGCTTGG - Intergenic
1172743023 20:37184093-37184115 GATGATGCACACCAAGATCTGGG - Intronic
1173505897 20:43586898-43586920 CATGGTGGACAGGAAGCTCTAGG - Intronic
1173565544 20:44035810-44035832 GATTGTGCACAGCAAGTTTTAGG + Intronic
1173787730 20:45806875-45806897 GATGATACAAACAAAGCTCTTGG - Intronic
1175392081 20:58633850-58633872 GCTGGTTGACAGAGAGCTCTGGG - Intergenic
1178794026 21:35726979-35727001 GATGGTGCAGGGAGAGCTATAGG - Intronic
1179716628 21:43291843-43291865 AATGGTGCACAGAACCCTTTTGG + Intergenic
1182503723 22:30767036-30767058 GATGCTACAAAAAAAGCTCTGGG + Intronic
1184968582 22:47998904-47998926 GATGCTGGACAGAAAGCCCTGGG - Intergenic
1185095925 22:48806125-48806147 CAGGGCCCACAGAAAGCTCTTGG + Intronic
949897881 3:8783669-8783691 GATGGTGAGAAGAAAGCTCCTGG - Intronic
950544395 3:13630014-13630036 GAAGGGTCACAGAAGGCTCTGGG - Intronic
954325544 3:49861438-49861460 GATCGTGCACAGGAATCTCAAGG - Exonic
955810992 3:62789202-62789224 GATAGTACATATAAAGCTCTTGG - Intronic
956068009 3:65417588-65417610 GATGGTGAAAAGAAAGTCCTAGG + Intronic
956670044 3:71680253-71680275 GATGGTGCTCAGATCGCTCTTGG - Exonic
964212759 3:154246398-154246420 GATGGCCCACAGACAGCACTGGG - Intronic
966209720 3:177440543-177440565 GATTGTGCACAGAAAATACTTGG + Intergenic
966630359 3:182067205-182067227 GATGGCGCTCAGAATGGTCTGGG + Intergenic
967242461 3:187454282-187454304 GATGGTGCATAGAAAGTGCCTGG + Intergenic
967429051 3:189360770-189360792 TATCGTGCACAGAAAGCTGAGGG + Intergenic
968073250 3:195801412-195801434 GAGGGTGCGGAGAAGGCTCTGGG - Intronic
969975559 4:11097616-11097638 AATTGTGTACAGAAAGCTCAGGG - Intergenic
971308688 4:25505733-25505755 GATGGTGCGCAGCAGGGTCTCGG - Intergenic
973646502 4:52956034-52956056 GTTGGTGAAGAGAAAGCTATGGG + Intronic
978358627 4:107904706-107904728 GATGGTGCAGAGACAGATCCAGG - Intronic
983851617 4:172587723-172587745 GATGGTTCACAAAAAGCTTCTGG - Intronic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
985047997 4:185960117-185960139 TATGGAACACAAAAAGCTCTTGG + Intergenic
986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG + Intergenic
988393737 5:30669705-30669727 GATGGTGCCCAGAAAGATTGCGG - Intergenic
992406648 5:76464248-76464270 CATAGTGCACAGAAAACTCATGG + Intronic
993893179 5:93499841-93499863 GCTGATGCAGAGAAAGCTTTAGG + Intergenic
996790887 5:127291523-127291545 GATTGTGCAGATAACGCTCTAGG + Intronic
1000117913 5:158170754-158170776 GATGATGCATATAAAGCTGTTGG + Intergenic
1001323036 5:170698536-170698558 GATAGTGCACATGAAGCCCTAGG + Intronic
1001965646 5:175908188-175908210 CCTCGTGCACAGAAATCTCTCGG + Intergenic
1002251302 5:177931007-177931029 CCTCGTGCACAGAAATCTCTCGG - Intergenic
1002261268 5:177995429-177995451 CATGGTGGACAGTGAGCTCTAGG - Intronic
1002923374 6:1589748-1589770 GATGGTGCACAGAATACACAGGG - Intergenic
1003309139 6:4953560-4953582 GCTGATGCCCAGAAAGCTCTGGG - Intronic
1003367847 6:5493717-5493739 CATGATGCACAGAAAGCACCCGG + Intronic
1005704452 6:28437679-28437701 GATGGTGCTTAGAAATCACTGGG - Intronic
1006390959 6:33758209-33758231 GAAGATGCATAGAAAGCTCAGGG + Intergenic
1006715479 6:36116639-36116661 GCGGGTGCACTGAAATCTCTGGG - Intergenic
1006876603 6:37302977-37302999 GCTGGAGCACAAACAGCTCTTGG - Intronic
1007064362 6:38974898-38974920 GATGGTGCACATAAAATTCTTGG - Intronic
1007110737 6:39312290-39312312 TCTGGTGCTCAGAAAGATCTGGG + Intronic
1007654997 6:43446501-43446523 GATGGTGCAGGGAGAGATCTGGG - Intronic
1010543493 6:77122150-77122172 GATGTTGGAAAGAAAGATCTGGG - Intergenic
1012453807 6:99382154-99382176 CATGGTGCTCAGGAAGCACTTGG + Intronic
1012902508 6:105022633-105022655 GTTTTTGCACAGAAAGGTCTGGG + Intronic
1013872763 6:114786906-114786928 GATGGAGCAGAGAAAGATCTGGG + Intergenic
1014122389 6:117740226-117740248 CATGGTGGAAAGAAAGCTCTGGG - Intergenic
1014392179 6:120876292-120876314 GATGGTGAAAAGAAAGCTATGGG + Intergenic
1015985374 6:138879298-138879320 CATGGTGAACAGAAAGCTCAAGG - Intronic
1017502452 6:155038240-155038262 GATGGTGGTCAGAAGGCACTAGG - Intronic
1017515505 6:155152537-155152559 CATGGTACAAAGAAAACTCTGGG - Intronic
1017529864 6:155278847-155278869 GATGATACACAGAAAGCAGTTGG + Intronic
1018610526 6:165643699-165643721 GATGGGGAAAAGAAAGATCTTGG + Intronic
1018702194 6:166436084-166436106 CCTGGTACACAGAAAGCACTTGG + Intronic
1019602998 7:1894664-1894686 GATGGGGCGCAGGAAGGTCTGGG + Intronic
1019824109 7:3269252-3269274 GGGGGAGCAGAGAAAGCTCTGGG - Intergenic
1021630926 7:22646770-22646792 GATGGGCCCCAGAAAACTCTGGG + Intergenic
1021918033 7:25455210-25455232 GATGGTACACGCAGAGCTCTTGG - Intergenic
1022638027 7:32155589-32155611 GAAGGTGCACTGTGAGCTCTGGG - Intronic
1023282216 7:38582446-38582468 GTTGATGCATGGAAAGCTCTTGG - Intronic
1024951273 7:54863106-54863128 GAAGGAGCACAGAATGCTCTGGG + Intergenic
1029178573 7:98683191-98683213 TATTCTGGACAGAAAGCTCTTGG + Intergenic
1031922637 7:127613003-127613025 GATGGTGCAGAGAAATCACCTGG + Exonic
1032267443 7:130379467-130379489 GATGGTGCTGGGAAAGCCCTGGG + Intergenic
1033599321 7:142877380-142877402 GATGGAGAACAGGGAGCTCTCGG + Intronic
1035141766 7:156769518-156769540 GATGGTGCAGAGAAAGAACAAGG - Intronic
1036698398 8:10994230-10994252 GAAGGTGCACGAAAAGCTCAGGG - Intronic
1037248813 8:16868524-16868546 CATGTTGCAGAGAAAGCTTTGGG + Intergenic
1037494261 8:19423879-19423901 CAGGCTGCACAGAAAGCCCTGGG + Intronic
1037590902 8:20311253-20311275 GATGCTGCACACAAAGGGCTGGG + Intergenic
1039630071 8:39101297-39101319 GTTGGTGCTCAGAAAGTTTTGGG - Intronic
1040071687 8:43193788-43193810 GATGGTGCCCAGGATGCCCTCGG - Exonic
1043273912 8:78369442-78369464 TATAGTGCACAGATAGCTTTTGG - Intergenic
1044163090 8:88945420-88945442 GATACTGCCCAGAAACCTCTTGG + Intergenic
1045151004 8:99408037-99408059 GCTGGTGCAGAGAGAGCACTGGG + Intronic
1045595976 8:103657031-103657053 GGTGGGGAACAGAAAGTTCTGGG - Intronic
1047850372 8:128850999-128851021 GATGTTGCATATAAAGCGCTTGG + Intergenic
1049296138 8:141840483-141840505 GATGGTGCCCAGAAGGATCTGGG - Intergenic
1050009251 9:1169506-1169528 GATGATGCTAAGAAAGCTTTTGG + Intergenic
1050853110 9:10313944-10313966 GAAGTTGAACAGAAAGCACTAGG - Intronic
1052158193 9:25221573-25221595 GATGCTGCACAGAATACTTTAGG + Intergenic
1055658917 9:78481605-78481627 TAGGGGGAACAGAAAGCTCTGGG + Intergenic
1056765829 9:89443836-89443858 GATGGGGCACAGAGAGCATTTGG + Intronic
1056873287 9:90304761-90304783 GATGGTACACAGAAACCTCTGGG + Intergenic
1058839882 9:108895814-108895836 CATGGAGCACAGAAGGCTCATGG - Intronic
1058883343 9:109304389-109304411 GATTGTGCGCTTAAAGCTCTTGG - Intronic
1059303776 9:113338060-113338082 GCTGGTGCATATAAAGCTTTTGG + Intronic
1060193601 9:121608622-121608644 GATAGTGAACATAAAGCTGTAGG + Intronic
1060562528 9:124558144-124558166 GATGCTGCACAGAATGCCATAGG - Intronic
1060613914 9:124993686-124993708 TATGGTGCATTGGAAGCTCTTGG + Intronic
1061729854 9:132605334-132605356 GCTGGTGCTCAGAAAGCTTTGGG - Intronic
1186012902 X:5156782-5156804 TATTGTGCAGAGGAAGCTCTCGG - Intergenic
1186561947 X:10622053-10622075 GAGGGTGCAAGGAAACCTCTGGG + Intronic
1186870342 X:13765264-13765286 GGTGGTATACAGAAATCTCTTGG - Intronic
1187716358 X:22106403-22106425 GATGCTTCACAGAAATCTGTGGG - Intronic
1190359803 X:49638150-49638172 GATGGAGCACAGACAGCCCCTGG - Intergenic
1193730300 X:85095051-85095073 GATGGTGGATAGGAAGCACTAGG + Intronic
1195200080 X:102540800-102540822 GATGCTTCAGAGAAAGTTCTTGG - Intergenic
1197203003 X:123765098-123765120 GATGGGGCCCGGAAAACTCTAGG - Intergenic
1197540280 X:127751063-127751085 GATGACCCACATAAAGCTCTAGG + Intergenic
1197568936 X:128125184-128125206 GATGATGCACAGAAAGCTTTTGG + Intergenic