ID: 947811875

View in Genome Browser
Species Human (GRCh38)
Location 2:233009874-233009896
Sequence CAGGTGGAGTGGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1544
Summary {0: 1, 1: 0, 2: 10, 3: 143, 4: 1390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947811875_947811883 2 Left 947811875 2:233009874-233009896 CCACCTTCCCTCCACTCCACCTG 0: 1
1: 0
2: 10
3: 143
4: 1390
Right 947811883 2:233009899-233009921 CTGTCTCTCTTTTTTTGAATTGG 0: 1
1: 0
2: 11
3: 147
4: 1320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947811875 Original CRISPR CAGGTGGAGTGGAGGGAAGG TGG (reversed) Intronic
900017420 1:162293-162315 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900047679 1:520889-520911 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900069893 1:762757-762779 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
900127348 1:1074410-1074432 CAGCTGGAGGGCAGGGAGGGAGG + Intergenic
900358420 1:2275877-2275899 CTGGTGGGGTGGAGGCAACGGGG - Intronic
900395192 1:2450592-2450614 CAGGCCGAGTGGGGGGCAGGTGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900496661 1:2978875-2978897 CAGGTGCAGCTGAGGGAAAGGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901130928 1:6962371-6962393 GAGGGGGAGTGGAAGGGAGGAGG - Intronic
901167285 1:7229596-7229618 CAGGAGGAGGGGAGGCTAGGAGG + Intronic
901325896 1:8364901-8364923 CCGGTGGGGTGGGGGGGAGGGGG + Intronic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
901802915 1:11719561-11719583 CTGGGCGAGTGGAGGCAAGGGGG - Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902121455 1:14169491-14169513 CAACTGGAGTGGAGTGAAGAGGG + Intergenic
902171610 1:14616023-14616045 AAGCTGGGGTGGAGAGAAGGTGG + Intronic
902183382 1:14706877-14706899 CTGGTGGGGTGGCGGGGAGGTGG - Intronic
902403584 1:16171452-16171474 TGGGTGGGGTGGAGTGAAGGGGG + Intergenic
902513756 1:16979411-16979433 CAGGGAGAGGGGAGGGAAAGGGG + Intronic
902622485 1:17658541-17658563 CAGGTAGAGTGGAGGACATGGGG + Intronic
902768332 1:18631368-18631390 GAGGTTGGGGGGAGGGAAGGTGG - Exonic
902814391 1:18907948-18907970 AAGGTGGAAGGAAGGGAAGGAGG - Exonic
903113372 1:21157478-21157500 CAGGTGTAGTGGTGAGCAGGAGG - Intronic
903224026 1:21884975-21884997 CAGGTGGTGGGGTGGGAATGAGG - Intronic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
904016882 1:27428527-27428549 CAGGTGGAGGGGGAGGGAGGAGG + Intronic
904236840 1:29122090-29122112 CGGGCGGAGAGGAGGGAGGGGGG + Intronic
904289886 1:29478305-29478327 CGGCTGGAGTACAGGGAAGGGGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904373692 1:30066402-30066424 ACGGTGGAGTGGAAGGGAGGGGG - Intergenic
904678902 1:32215340-32215362 CAGGTTCAGGGGAGGGAAAGGGG + Intronic
904770852 1:32880692-32880714 GAAGTGGAGTGGAGGGCAGGAGG - Intergenic
904812945 1:33175589-33175611 CAGTTGGCGTGTTGGGAAGGAGG + Intronic
904887692 1:33753579-33753601 CTGGTGGAGCTGTGGGAAGGGGG + Intronic
905012303 1:34755624-34755646 CAGGTGGTGTGGAGACAGGGTGG + Intronic
905175664 1:36134034-36134056 AAGGGGGAGTGGGGGGAGGGAGG - Intergenic
905269638 1:36778989-36779011 GAAGGGGAGGGGAGGGAAGGGGG + Intergenic
905280000 1:36842984-36843006 CAGGTGGAGGGGGTGGATGGTGG - Intronic
905309111 1:37037372-37037394 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
905517741 1:38574485-38574507 CAGGTGGAGTTGGGGTAGGGGGG + Intergenic
905537054 1:38730280-38730302 AAGGTGGATTGGAGGGCAGTGGG + Intergenic
905869674 1:41396025-41396047 CAGTTCAGGTGGAGGGAAGGTGG - Intergenic
905885501 1:41489674-41489696 AAGGTGGATGGGAGGAAAGGTGG - Intergenic
905885523 1:41489773-41489795 AAGGTGGGTTGGAGGAAAGGTGG - Intergenic
905885547 1:41489872-41489894 AAGGTGGATGGGAGGAAAGGTGG - Intergenic
906192227 1:43905694-43905716 GAGGAAGAGTGGTGGGAAGGGGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906580238 1:46930012-46930034 CAGGTGGGAAGAAGGGAAGGTGG + Exonic
906603487 1:47148878-47148900 CAGGTGGGAAGAAGGGAAGGTGG - Exonic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907715728 1:56924238-56924260 CAGGAGGTGGTGAGGGAAGGAGG + Intergenic
908213116 1:61921783-61921805 CAGGGGAAGAGGTGGGAAGGAGG + Intronic
908250104 1:62258978-62259000 TGGCTGGAGTGGAGGGAAGGAGG + Intronic
908269211 1:62406786-62406808 CATGTGGCATGAAGGGAAGGAGG - Intergenic
908320395 1:62972804-62972826 AAGGAGGAGGAGAGGGAAGGAGG + Intergenic
908544008 1:65147488-65147510 GGAGTGGAGTGGAGGGGAGGGGG + Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909513590 1:76482870-76482892 CTGGTGGGGTGGGGGGAGGGGGG - Intronic
909861365 1:80609910-80609932 CCGGTGGGGTGGAGGGCAAGGGG - Intergenic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
910361574 1:86417745-86417767 CAGGTGGAGTGGGGGCCAGTTGG - Intergenic
910777709 1:90892548-90892570 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
910811520 1:91242262-91242284 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
910819996 1:91336137-91336159 AAGGAGGAGGGGAGGGTAGGAGG - Intronic
911293849 1:96089299-96089321 GAGGTGGGGAGGATGGAAGGAGG - Intergenic
911810179 1:102266095-102266117 CTTGTGGGGTGGGGGGAAGGGGG + Intergenic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
913169844 1:116222031-116222053 AAGGAGGAGGGGAGGGGAGGAGG + Intergenic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
914815750 1:151060646-151060668 CAGCTGAAGAGGAGAGAAGGGGG + Intronic
914914075 1:151807520-151807542 CTTGTAGAGTGGAGGGAAAGCGG + Exonic
914991189 1:152501008-152501030 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
915247490 1:154567176-154567198 CAGCTGGAGTCAAGAGAAGGGGG + Intergenic
915255434 1:154625249-154625271 CTGGTGCAGTGGGGGAAAGGAGG - Intronic
915362978 1:155296860-155296882 CAGATGCAGTGGAGAGATGGAGG - Intronic
915446786 1:155978618-155978640 TAGGCGGAGCGGAGGGAGGGCGG + Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915931155 1:160061757-160061779 GGGGTGGGGTGGAGGGAGGGTGG + Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916570491 1:166021825-166021847 CTGGTGAAGTAGAGGAAAGGAGG + Intergenic
917107240 1:171504723-171504745 CTGGCGGGGTGGAGGGTAGGGGG + Intronic
917239462 1:172932041-172932063 CAAGTGGATTGGAAGGAAGGAGG + Intergenic
917289798 1:173460682-173460704 AAGGAGGAGGGGAGGGGAGGAGG + Intergenic
917737603 1:177934817-177934839 AAGGAGGAATGGAGGGAGGGAGG + Intronic
918344347 1:183593231-183593253 CAGGAGAAGGGGAGGGAAAGTGG - Intronic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919988158 1:202690108-202690130 CAGGGGGAGTGGAGGCAGAGTGG - Intronic
920304875 1:205012227-205012249 CAGAGGAAGTGGAGGAAAGGGGG + Intronic
920639328 1:207736328-207736350 GTGGTGGGGTGGGGGGAAGGGGG + Intronic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920995079 1:210982414-210982436 GGTGTGGAGTGGGGGGAAGGGGG - Intronic
921036330 1:211382677-211382699 CTGCTGGACTGGAGGGAGGGAGG - Intergenic
921220159 1:212967939-212967961 AAGGTGGAGGGAAGGGATGGAGG + Intronic
922050837 1:221989348-221989370 CAGATGAGGTGGAGGGCAGGTGG - Intergenic
922105260 1:222508207-222508229 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922141536 1:222893392-222893414 CAGGTCGAGTGGGCGGAATGAGG - Intronic
922265575 1:223980741-223980763 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922265581 1:223980757-223980779 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
922646405 1:227291174-227291196 CAGGTGGGGAGGAGGGAGGAAGG - Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922795859 1:228339114-228339136 CAGGTGGGTTGGAGCCAAGGGGG + Intronic
922875023 1:228933840-228933862 CAGGTGGAGTGAGGGAATGGTGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923051932 1:230395588-230395610 CATGAGGAGAGGAGGGGAGGGGG - Intronic
923534463 1:234838235-234838257 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
923602076 1:235412166-235412188 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602093 1:235412193-235412215 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602103 1:235412209-235412231 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923747010 1:236710884-236710906 CGGGTGGGGGGTAGGGAAGGGGG - Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924347436 1:243085744-243085766 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
924453380 1:244198954-244198976 CAGGTGGGGTGAGGTGAAGGCGG - Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063297839 10:4825404-4825426 CAGGGCCAGTGGAGGGAAAGAGG - Intronic
1063371029 10:5523366-5523388 GGGGTGGCGTGGAGGGAACGAGG - Intergenic
1063489268 10:6448045-6448067 CAGGTGGAGTAGGGGGAAGCTGG + Intronic
1063533920 10:6863954-6863976 GAGGTGAAGGGGAAGGAAGGAGG + Intergenic
1063559342 10:7112049-7112071 CAGGTGGACTGGAGGAAATGTGG + Intergenic
1063705352 10:8424969-8424991 CAGGAAGAGAGGAGGGGAGGGGG + Intergenic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064100325 10:12458065-12458087 CAGGTGGTGGAGAGTGAAGGTGG + Intronic
1064114774 10:12568346-12568368 GAGGGGGAGAGGAGGGGAGGGGG - Intronic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064533040 10:16329589-16329611 CGGGTGGGAAGGAGGGAAGGAGG + Intergenic
1064925297 10:20562912-20562934 AACGAGGAGTGGAGGGAATGTGG - Intergenic
1065046639 10:21752160-21752182 GGGGAGGAGTGGAGGGAGGGAGG - Intergenic
1065115173 10:22477301-22477323 CTGGTGGAGGGGAGGGAACTGGG - Intergenic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065259295 10:23908190-23908212 CAAGTAGAGTGAAGGGAAGGTGG + Intronic
1065497259 10:26341983-26342005 GGGGAGGAGTGGAGGGAAGAAGG + Intergenic
1065577038 10:27131628-27131650 CTGGTGTAGTGGAGTGAATGTGG - Intronic
1065736197 10:28754777-28754799 CTGGTGAAGGGCAGGGAAGGAGG + Intergenic
1065989148 10:30991096-30991118 GAGGTGCAGGGGAGGTAAGGTGG - Intronic
1066190913 10:33055293-33055315 CAGGGGGATTGGAGTGTAGGTGG - Intergenic
1066214403 10:33272509-33272531 GAGGAGGAGGGGAGGCAAGGAGG + Intronic
1066728918 10:38419130-38419152 AAGGAGGAACGGAGGGAAGGAGG - Intergenic
1067281934 10:44879804-44879826 CATGAGGAGTGGGGGGAATGAGG - Intergenic
1067382366 10:45786781-45786803 TAGGTGCAGGGGAGGGGAGGCGG - Intronic
1067695966 10:48535920-48535942 CAGGTGGAGGGGCGGGAATTGGG + Intronic
1067789713 10:49278441-49278463 AAATTGGAGTGGAGGGGAGGTGG + Intergenic
1067890066 10:50127329-50127351 TAGGTGCAGGGGAGGGGAGGCGG - Intronic
1068100740 10:52549986-52550008 CATGTGGATTTGGGGGAAGGGGG - Intergenic
1068120579 10:52779310-52779332 AAGGTGGGGAGGAGGGAAGCAGG - Intergenic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068627412 10:59264189-59264211 GGGGTGGAAGGGAGGGAAGGAGG + Intronic
1068932173 10:62602901-62602923 GTGGTGGGGTGGGGGGAAGGAGG - Intronic
1069127908 10:64660493-64660515 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1069821418 10:71230827-71230849 GAGCTTGAGTGGTGGGAAGGTGG - Intronic
1069957228 10:72059678-72059700 CAGGCGGGCTGGAGTGAAGGGGG + Exonic
1070104573 10:73419171-73419193 CATGTGGAGGGGAAGGATGGGGG - Intergenic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1070516778 10:77215205-77215227 GATGTGGAGTGAATGGAAGGAGG - Intronic
1070593475 10:77816847-77816869 CTGGTGGTGTGGGGGGTAGGGGG - Intronic
1070814042 10:79312248-79312270 GAGGTGGGCTGGTGGGAAGGCGG - Intronic
1071115195 10:82210461-82210483 AAGGAGAAGTGGAGGGCAGGGGG + Intronic
1071256585 10:83877258-83877280 CATCTGCAGTGGAGGGATGGGGG - Intergenic
1071567888 10:86680993-86681015 CAGGTGGTGGGGAGGTGAGGAGG - Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072079204 10:92012082-92012104 GAGGGGGAGGGGAGGGAGGGAGG - Intronic
1072139136 10:92574223-92574245 CAGGCGGACTGGAGGGACAGGGG + Intergenic
1072190383 10:93073019-93073041 CAGCTGGACAGCAGGGAAGGGGG - Intergenic
1073248252 10:102106663-102106685 CAGCTGGAGTGGAGGAAATACGG + Intergenic
1073597801 10:104817623-104817645 GAGGTGGAGGGGAGAAAAGGAGG - Intronic
1073684927 10:105741709-105741731 CTTGTGGGGTGGGGGGAAGGGGG + Intergenic
1073838154 10:107467855-107467877 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1073857803 10:107697518-107697540 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1073929718 10:108561086-108561108 CAGGTGGATTGGTGGGTGGGTGG + Intergenic
1074045200 10:109831688-109831710 GTGGTGGAGTGGGGGGAAGGGGG + Intergenic
1074086297 10:110210638-110210660 CAGGAGGAGGGGAGGAGAGGGGG - Intronic
1074103402 10:110371507-110371529 TAGGTGGGGAGGAGGGAAGAGGG + Intergenic
1074198221 10:111207947-111207969 CACCTGGGGTGGAGGGATGGGGG - Intergenic
1074326356 10:112455270-112455292 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1074775563 10:116766076-116766098 GAGGTGGAGAGCAGGAAAGGTGG - Intergenic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075126810 10:119707016-119707038 TAGGGGGAGGGGCGGGAAGGAGG + Intergenic
1075324375 10:121519005-121519027 CTGGTGGAGAGAAGGGCAGGAGG + Intronic
1075338662 10:121627767-121627789 CAGGCAGAGTGAGGGGAAGGAGG - Intergenic
1075517174 10:123118360-123118382 CTGGTGGAGGGGAGTGGAGGAGG + Intergenic
1075556705 10:123437997-123438019 CAGGTCGGGTGGAGGGAGTGGGG + Intergenic
1075698708 10:124454447-124454469 CAGAGGGAGTGGGGGGGAGGGGG + Intergenic
1075838325 10:125475148-125475170 CAGCTGAAGTGGATGAAAGGTGG + Intergenic
1075938391 10:126364814-126364836 AGGGAGGAGTTGAGGGAAGGAGG - Intronic
1076210232 10:128634834-128634856 CAGGGAGAGTGGAGGCAGGGAGG - Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076299219 10:129412037-129412059 GAGGTGTAGTGGGGGGAGGGTGG + Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076325104 10:129615061-129615083 GAGGTGCAGTGGAGAAAAGGGGG + Intronic
1076527155 10:131119057-131119079 CATTTGGAGAGGAGGTAAGGTGG + Intronic
1076631179 10:131853237-131853259 GAGGTGCAGATGAGGGAAGGGGG - Intergenic
1076949486 10:133670074-133670096 AAGGTGGAGAGGGGGGAGGGGGG - Intronic
1076950470 10:133673373-133673395 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076953433 10:133683292-133683314 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076958368 10:133752872-133752894 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076960341 10:133759481-133759503 AAGGTGGAGAGGGGGGAGGGGGG - Intergenic
1076974016 11:157499-157521 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1077015927 11:399254-399276 CAGGTGGGGAGGAAGGCAGGGGG - Intronic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077016034 11:399513-399535 CAGGTGGAGGGGGGGACAGGTGG - Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077279748 11:1737949-1737971 CGGATGGAGCGGAGGGCAGGAGG + Intronic
1077463544 11:2722794-2722816 CTGGTGGGGTAGAGGGAAGGAGG - Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1077923073 11:6655824-6655846 CGGGGGGAGGGGAGGGGAGGGGG - Exonic
1077985578 11:7347992-7348014 CTGGAGGAGTGAGGGGAAGGGGG + Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078101081 11:8330707-8330729 CGGGTGGGGAGGAGGGACGGAGG - Intergenic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078625773 11:12956334-12956356 CAGGAAGTGTGGAGGGGAGGGGG + Intergenic
1078699905 11:13669735-13669757 CAGGAGGGGTGGAGTGTAGGAGG - Intronic
1078859158 11:15231245-15231267 GAAGTGGTGTGGAGGGAAGAGGG + Intronic
1079085733 11:17443446-17443468 GGAGTGGAGTGCAGGGAAGGAGG + Intronic
1079169702 11:18081140-18081162 CAGGAGGAGGGGAGGGAGAGAGG - Intronic
1079364463 11:19797209-19797231 CAGGAGGGGTGGAGGGGAAGTGG - Intronic
1079817188 11:25076541-25076563 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
1079923313 11:26459133-26459155 CAGCTGGATTGGAGGGCATGAGG + Intronic
1079945178 11:26732917-26732939 CAGCTGGAGTGGTGGGATGCAGG - Intergenic
1079995779 11:27293618-27293640 GAGGGGGAGGGGAGGGGAGGCGG + Intergenic
1080616260 11:33947418-33947440 CAGCTGGAATGAAGGGAGGGAGG - Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1080878654 11:36299221-36299243 CAGCTGGAGTGGAGAGAACGTGG - Intronic
1081809109 11:45905384-45905406 CGGGTGGCCTGGAGGGAGGGTGG + Intronic
1082005542 11:47417045-47417067 AAGGTGGAATGGGGGGCAGGTGG - Intergenic
1082008290 11:47433371-47433393 GAGGAGGAGTGGAGGCCAGGAGG - Intergenic
1082266277 11:50121903-50121925 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
1082289812 11:50356669-50356691 GTGGTGGGGTGGAGGGAGGGGGG - Intergenic
1082297440 11:50459478-50459500 GTTGTGGAGTGGGGGGAAGGGGG - Intergenic
1082808378 11:57463927-57463949 AAGGAGGAGGGGAGGGGAGGGGG - Intronic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083627658 11:64079747-64079769 AATGTGGAGTGGAGGTAAGGAGG + Intronic
1083879195 11:65539930-65539952 CAGGTGGGGTGGGGCGGAGGCGG - Intronic
1083929396 11:65832215-65832237 GAGGTTGAGTGGAGAGAAGCTGG - Intronic
1083929414 11:65832467-65832489 GAGGTTGAGTGGAGAGAAGCTGG - Intronic
1083929423 11:65832572-65832594 GAGGTTGAGTGGAGAGAAGCTGG - Intronic
1083929433 11:65832677-65832699 GAGATGGAGTGGAGAGAAGCTGG - Intronic
1084617252 11:70244794-70244816 GAGGAGGAGGAGAGGGAAGGAGG + Intergenic
1084742628 11:71149598-71149620 CAGGTAGAGAGGAGGGTAGTAGG + Intronic
1084742664 11:71149744-71149766 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
1084752081 11:71210681-71210703 CAGGTCAAGTGGGGGGAAGTGGG - Intronic
1084892950 11:72245316-72245338 CAGATGGAGCTGAGGGAACGGGG - Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085282262 11:75339036-75339058 CACGTGGAGTGGTGGAGAGGAGG - Intronic
1085295901 11:75431463-75431485 CAGGTGGAGGGGAGTCAGGGAGG + Intergenic
1085591522 11:77766489-77766511 CAGGTAGAGTGGTGGGTTGGGGG + Intronic
1085640434 11:78189472-78189494 CGGGTGCACTGGAGGGAGGGAGG + Intronic
1085761676 11:79246802-79246824 GAGGTGGAGGTGAGGGAAGAGGG + Intronic
1085826940 11:79857956-79857978 CAGCTAGAGGGGAGGAAAGGAGG + Intergenic
1085857248 11:80188816-80188838 CAGGTGGAAGGAAGGAAAGGAGG - Intergenic
1086530323 11:87777477-87777499 CAGGAGGAAGGGAGGGATGGGGG - Intergenic
1086783878 11:90940826-90940848 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1086960087 11:92972535-92972557 AGGGAGGAGTGGAGGCAAGGTGG + Intronic
1087474820 11:98622110-98622132 GAAGGGGAGGGGAGGGAAGGGGG - Intergenic
1088003436 11:104910551-104910573 CAGGTGTAGTGGGGGTTAGGAGG - Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088195232 11:107266685-107266707 AAGGTGGAGTGGAGGCAGTGTGG - Intergenic
1088840935 11:113627243-113627265 GAGGTGGGGAGGAGGGAGGGAGG + Intergenic
1089027194 11:115283485-115283507 GAGGTGGAGGGAAGGGAAGAGGG + Intronic
1089078560 11:115758688-115758710 CGAGGGGAGTGGAGGCAAGGAGG + Intergenic
1089313290 11:117574056-117574078 GAGCTGGATGGGAGGGAAGGGGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089618295 11:119707527-119707549 CAGTTGGAGTGGGGAGACGGTGG - Intronic
1089667924 11:120032161-120032183 AAGGTGGAGTGGAGGTAGGGAGG + Intergenic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090253810 11:125268963-125268985 GGGGTGGGGTGGAGGGCAGGGGG + Intronic
1090393371 11:126403834-126403856 CAGATGGGGTGCAGGGCAGGCGG - Intronic
1090608710 11:128451370-128451392 TGGGTGGGGTGGATGGAAGGAGG + Intergenic
1090722170 11:129485655-129485677 GAGGTGGGGTGGAGTGACGGGGG - Intergenic
1090809434 11:130223690-130223712 CCGGGGGAGTGGGGGGCAGGAGG + Intergenic
1091074196 11:132599426-132599448 AAGGTGGAGGAGAAGGAAGGAGG + Intronic
1091395056 12:149309-149331 CATGTGCAGTGGGAGGAAGGGGG + Intronic
1091518800 12:1214512-1214534 GGCGGGGAGTGGAGGGAAGGAGG - Intronic
1091917012 12:4276999-4277021 GAGGGGGAGGGGCGGGAAGGAGG - Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092095842 12:5841311-5841333 CAGGTGGGGTGGAGGGGAATGGG - Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1092810306 12:12266592-12266614 TAGGGGGAGGGGAGGGACGGAGG - Intronic
1092817263 12:12322979-12323001 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092817333 12:12323108-12323130 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1093163236 12:15774316-15774338 CAGGGGGGGTGGGGTGAAGGAGG - Intronic
1093427358 12:19043634-19043656 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1093474113 12:19535709-19535731 CAGATAGAGTGAAGGGAAAGAGG + Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1093988957 12:25569008-25569030 CTGGTGGAGCTGTGGGAAGGGGG + Intronic
1094132177 12:27085893-27085915 CAGCTAGAGTGGAGGTAGGGGGG + Intergenic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095676204 12:44921743-44921765 TAGGTGGGGTGGAGGGTGGGAGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095930257 12:47618528-47618550 CTGCTGTAGTGGAGGGATGGTGG - Intergenic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096539141 12:52294478-52294500 AGGGAGGAGGGGAGGGAAGGTGG + Intronic
1096668194 12:53180923-53180945 AAGGGGGAGGGGAGGGGAGGAGG + Intronic
1096773875 12:53952507-53952529 CTGCTGGGGTGGAGGGAATGGGG + Intergenic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1097022310 12:56029012-56029034 CTGGTGGTGTGGGAGGAAGGAGG - Intronic
1097151753 12:56984428-56984450 CAGGAGGGGAGGAGGGAAAGAGG + Intergenic
1097181037 12:57172023-57172045 CAGCTGGAGTAGAGTGCAGGGGG - Intronic
1097767996 12:63547593-63547615 CAGGTAGAGAGAAGGAAAGGAGG + Intergenic
1097779248 12:63684833-63684855 CATGTGGAATGAAGGGAATGTGG + Intergenic
1097784356 12:63742659-63742681 CAGGTAGAGAGAAGGAAAGGAGG + Intergenic
1097980022 12:65729080-65729102 CAGGTGGCGCGGAGCGAAGGGGG - Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098533109 12:71563319-71563341 CTGGTGCAGTGGAGGTCAGGAGG - Intronic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1100399547 12:94217020-94217042 CAGGTGCAGTGGAAGGAGAGAGG - Intronic
1100577091 12:95902366-95902388 GAGGTGGGGAGGAGGGAAGAAGG - Intronic
1100761463 12:97811822-97811844 TAAGTGGAGGGAAGGGAAGGAGG + Intergenic
1100879857 12:99004613-99004635 AAGGTGGGGTGCGGGGAAGGAGG + Intronic
1101040155 12:100747383-100747405 GAGGTGGGGTGTAGGGAAGCAGG - Intronic
1101045537 12:100801749-100801771 GGGGTGGGGTGGAGGGAAGGTGG + Intronic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1101421047 12:104551358-104551380 CAGGTAGTGTGCAGGGAAGTTGG + Intronic
1101826077 12:108221111-108221133 CAAGTGGAGTGGAAAGAGGGAGG + Intronic
1102035839 12:109769943-109769965 AAGATGTATTGGAGGGAAGGGGG - Exonic
1102053542 12:109880121-109880143 TAGGGTGAGTGGAGGGAAAGAGG + Intronic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102334772 12:112069176-112069198 CAGGTGCAGTGGTGAAAAGGGGG - Intronic
1102501160 12:113353574-113353596 AGGGAGGAGTGGAGGGAGGGAGG - Intronic
1102514458 12:113437011-113437033 CACGTCGAGTAGATGGAAGGGGG + Intronic
1102533233 12:113562079-113562101 CAGATGAAGTGGAGGCATGGGGG - Intergenic
1102626570 12:114239976-114239998 CAGGGGGCGTGAAGGGGAGGGGG - Intergenic
1102680287 12:114686305-114686327 CAGGTGGGGAGGAGGGGATGCGG - Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1102992131 12:117322798-117322820 AAGGAGGAAGGGAGGGAAGGAGG - Intronic
1103132639 12:118482460-118482482 CAGGTGAGGTGAAGGGAAGTGGG + Intergenic
1103522984 12:121548800-121548822 GAGGTGGGGAGGTGGGAAGGAGG - Intronic
1103837552 12:123835234-123835256 CATTTGGAGTGGAGGGGAGCTGG + Intronic
1103913787 12:124365719-124365741 CAGGTGGAGGGAGGGGAGGGAGG - Intronic
1104127336 12:125861035-125861057 CAGGTGCAGAGGAGCGGAGGGGG + Intergenic
1104473950 12:129054999-129055021 CAGCTGGAGGGGAGGCAGGGAGG - Intergenic
1104544466 12:129698652-129698674 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1105007336 12:132729522-132729544 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105007347 12:132729544-132729566 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105285273 13:18998347-18998369 GAGGAGAAGCGGAGGGAAGGAGG - Intergenic
1105974156 13:25458637-25458659 AAGGTGGAGTGGAAGGCAGGAGG + Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106660114 13:31790747-31790769 GAGGTGGGGTGGATGGAAGTTGG + Intronic
1106829611 13:33565218-33565240 CAGGAAGTGTAGAGGGAAGGGGG + Intergenic
1106859756 13:33893066-33893088 CAGGCCGAGAGAAGGGAAGGAGG + Intronic
1107353469 13:39541177-39541199 CAGCTGGAGTGGAGAGATGGAGG - Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108713650 13:53058003-53058025 CAGGTGGAGATGAGGGACTGTGG - Intergenic
1109981737 13:69916586-69916608 GTTGTGGAGTGGGGGGAAGGGGG + Intronic
1110594350 13:77302392-77302414 GTGGTAGAGTGGAGGGATGGGGG + Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112108998 13:96273964-96273986 GAGGAGGAGGGGAGGGAGGGAGG - Intronic
1112304304 13:98259806-98259828 CAGGTCGGATGAAGGGAAGGTGG + Intronic
1112431432 13:99354109-99354131 CAGGTGCAGAGCAGTGAAGGGGG - Intronic
1112987288 13:105466640-105466662 CAGATGGAGTGAGGGGGAGGTGG - Intronic
1113799254 13:113078036-113078058 CAGGTGGTGGTGCGGGAAGGGGG - Intronic
1113909918 13:113836838-113836860 GAGGGGGAGTGGGGGGGAGGAGG + Intronic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1113975641 13:114225552-114225574 AAGGGGGAGGGGAGGGAGGGGGG + Intergenic
1114062329 14:19029472-19029494 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1114099930 14:19370521-19370543 CAGGGGGTGTTGTGGGAAGGTGG + Intergenic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114484914 14:23056758-23056780 CAGGAGGGGTGGAGGCAGGGAGG + Intronic
1114574713 14:23701350-23701372 CTGGTGGAGTGGTGGGAGTGAGG + Intergenic
1114920150 14:27316255-27316277 CAGGTATAGTGGGGGGGAGGGGG - Intergenic
1114982293 14:28179793-28179815 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
1115117070 14:29894149-29894171 CAAGTGAAGTGGATGGGAGGTGG + Intronic
1115243562 14:31272680-31272702 CAGGTGGCAAAGAGGGAAGGAGG - Intergenic
1115320765 14:32077170-32077192 CTGGTGGCGGGGAGGGAGGGAGG + Intronic
1115528565 14:34305229-34305251 CGGGTGGAGTGGAGGTAGGCAGG + Intronic
1115948505 14:38693609-38693631 AAGGTGGAGTGGGAGCAAGGTGG + Intergenic
1116062152 14:39937034-39937056 GTGGTGGAGTGGGGGGAGGGGGG + Intergenic
1116284457 14:42954226-42954248 GTGGTGGAGTGGGGGGAGGGGGG - Intergenic
1116490812 14:45500766-45500788 CAGGTAGGCTGGAGGCAAGGAGG - Intergenic
1116954549 14:50910771-50910793 CAGGAAAAGTGGAAGGAAGGAGG - Intronic
1117297533 14:54393447-54393469 CGGGTGGTGTGGAGGGAGAGCGG + Intergenic
1117630569 14:57686491-57686513 CAGGAGGAGTGCAGGAGAGGAGG - Intronic
1118389809 14:65286767-65286789 CAGGTGATGGGGAGGGAGGGCGG + Intergenic
1118743154 14:68755903-68755925 CAGCTGGAGTGGGGGGGGGGGGG - Intergenic
1119182774 14:72615592-72615614 TGGGTGGAAGGGAGGGAAGGAGG - Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119319162 14:73719223-73719245 GGGGTGGGGTGGAGGGGAGGGGG - Exonic
1119406879 14:74404595-74404617 CAGTTGGGGAGTAGGGAAGGAGG + Intergenic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119862811 14:77948798-77948820 CAGGTAGTGGGGAGGGAAGGAGG - Intergenic
1120274416 14:82353403-82353425 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1120483509 14:85082322-85082344 CAGGTGGTGGGGAGGGTGGGTGG - Intergenic
1120876372 14:89379733-89379755 CTGGTGGTGGGGAGGGAGGGCGG - Intronic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121255131 14:92525431-92525453 GAGATTGAGGGGAGGGAAGGAGG + Intronic
1121413522 14:93763559-93763581 AGAGTGGAGTGGAAGGAAGGAGG - Intronic
1121442045 14:93955575-93955597 CAGCTGAAGTGGAAGGGAGGAGG + Intronic
1121656856 14:95603437-95603459 CAGGTTGAGTTGAGGGGAGAAGG + Intergenic
1121766782 14:96494708-96494730 CAGGTAGAGGGGAGGGAGGAGGG - Intergenic
1122036989 14:98956204-98956226 GTGGTGGAGTGGTGAGAAGGAGG + Intergenic
1122323557 14:100869307-100869329 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122323744 14:100870349-100870371 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122328089 14:100894696-100894718 CAGGTGGCGTGAAGGGGAGATGG + Intergenic
1122411067 14:101526480-101526502 CAGATGGAGTGGTGGGGATGAGG - Intergenic
1122611259 14:102984982-102985004 GGGGTGGAGTGGAGGTGAGGAGG + Intronic
1122631361 14:103109145-103109167 CAGGTGGTGGAGAGGGAGGGAGG - Intronic
1122758070 14:103998061-103998083 AAGGTGTGGTGGAGGGGAGGAGG + Intronic
1122781228 14:104144407-104144429 CAGGTAGAGGACAGGGAAGGAGG + Intronic
1123456787 15:20433547-20433569 CAGGAGGAGAGGAGTGAACGTGG - Intergenic
1123467958 15:20530102-20530124 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1123650155 15:22470940-22470962 CAGGTGGAGAGAACAGAAGGTGG - Intergenic
1123661275 15:22566809-22566831 CAGGAGGAGAGGAGTGAACGTGG + Intergenic
1123728272 15:23125311-23125333 CAGGTGGAGAGAATAGAAGGTGG + Intergenic
1123740561 15:23279782-23279804 CAGGTGGAGAGAACAGAAGGTGG - Intergenic
1123746437 15:23322776-23322798 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1123908672 15:24945304-24945326 AAGGGGGAGAGGAGGAAAGGAGG - Intronic
1123982781 15:25619259-25619281 AAGCTGGAGTGGAGAGAAGCAGG - Intergenic
1124262937 15:28208701-28208723 CAGGAGGAGAGGAGTGAAAGTGG - Intronic
1124278704 15:28346093-28346115 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1124315075 15:28661045-28661067 CAGGAGGAGAGGAGTGAACGTGG + Intergenic
1124359423 15:29024863-29024885 CAGGAGGAGCGGATGGAAGCAGG + Intronic
1124439161 15:29674703-29674725 CCGGGGGGGCGGAGGGAAGGAGG + Intergenic
1124532876 15:30521990-30522012 CAGGTGGAGAGAATAGAAGGTGG - Intergenic
1124720256 15:32105467-32105489 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124720261 15:32105486-32105508 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124765780 15:32485654-32485676 CAGGTGGAGAGAACAGAAGGTGG + Intergenic
1125213366 15:37240666-37240688 AAGGAGGAATGGAGGGAGGGTGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1126876495 15:53047432-53047454 CTGGTGGAGGGGAGGAAAAGGGG - Intergenic
1126903889 15:53343829-53343851 GAGGTGCAGTGGAAGGAAAGTGG + Intergenic
1126965755 15:54051906-54051928 GTGGTGGGGTGGAGGGAGGGGGG - Intronic
1127279265 15:57475131-57475153 CAGGTGGTGTGGTCAGAAGGGGG - Intronic
1127330777 15:57937604-57937626 CAGGAGGAAGGGAGTGAAGGAGG + Intergenic
1127507589 15:59610955-59610977 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507606 15:59610982-59611004 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507711 15:59611178-59611200 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127686905 15:61354745-61354767 ATGGTGGAGGGCAGGGAAGGTGG + Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128835732 15:70807718-70807740 GAGGTGGTGTGGAGGCAAAGAGG + Intergenic
1128881722 15:71249886-71249908 CAGCAGGAGTGGAAGGAAAGGGG - Intronic
1129186363 15:73909530-73909552 CCTGGGAAGTGGAGGGAAGGTGG + Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129324722 15:74794080-74794102 GGGGTGGCGGGGAGGGAAGGAGG - Intronic
1129392763 15:75228816-75228838 CAGGCTGAGTGGATGGGAGGGGG + Intergenic
1129658757 15:77541641-77541663 CATGTGGAGTGGGAGGAAGGCGG - Intergenic
1129787695 15:78320429-78320451 CAGATGGAGTGGAAGGAATGGGG - Intergenic
1129844366 15:78761485-78761507 CAGGTGGTGCTCAGGGAAGGTGG - Intronic
1129901523 15:79154813-79154835 CAGGAGCATTGGGGGGAAGGAGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130257434 15:82332294-82332316 CAGGTGGTGCTCAGGGAAGGCGG + Intergenic
1130390104 15:83447584-83447606 GAGGCGCAGAGGAGGGAAGGAGG + Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130597511 15:85257671-85257693 CAGGTGGTGCTCAGGGAAGGCGG - Intergenic
1130897447 15:88182358-88182380 GAAGTGGAGGGTAGGGAAGGTGG - Intronic
1130956271 15:88629463-88629485 CAGGTGGCATGGAGGCCAGGCGG - Intronic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131294896 15:91139183-91139205 ATGGTGGTGTGAAGGGAAGGAGG + Intronic
1131382536 15:91975706-91975728 CAGGTGGAGGCGTAGGAAGGAGG - Intronic
1131403803 15:92147179-92147201 CAGGTGGAAAGGAGGAGAGGCGG - Intronic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131978113 15:97966077-97966099 AAGGAGGAAGGGAGGGAAGGAGG - Intronic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132172961 15:99681797-99681819 CAGGTGCAGTAGTGAGAAGGGGG + Intronic
1132377602 15:101340542-101340564 GAGGTAGAATGGAGTGAAGGAGG - Intronic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132525979 16:414946-414968 CTGGTGGAGGGAAGGGAAGGAGG - Intergenic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132657568 16:1047812-1047834 CAGGAGCAGGGGCGGGAAGGAGG - Intergenic
1132734177 16:1377494-1377516 CAGGGGGAGTGGAGGCAGAGGGG - Intronic
1132828313 16:1915804-1915826 ACGGTGGAGAGGAGGGAAGGAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133416663 16:5612321-5612343 CAGATGGAGTGGTGGATAGGTGG - Intergenic
1133421437 16:5650343-5650365 GTGGTGGTGTGGAGGGAGGGAGG + Intergenic
1133520214 16:6549344-6549366 GAGGAGGGGAGGAGGGAAGGAGG + Intronic
1134044130 16:11088989-11089011 CAGGTGGCCTGGGGGGAAAGGGG - Intronic
1134263686 16:12674538-12674560 CAGGTGGAGTGAAAGGAGGCGGG + Intronic
1134527897 16:14958354-14958376 CAGGAGGAAGGGAGAGAAGGGGG - Intergenic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135413192 16:22250423-22250445 CAGCTGGGGTGGAGGAATGGGGG + Intronic
1135435520 16:22424569-22424591 GCGGTGGGGAGGAGGGAAGGGGG - Intronic
1135861416 16:26059259-26059281 CAAGTGGAGGGAAAGGAAGGAGG - Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136142224 16:28294782-28294804 CAGCTGGAGACGAGGGTAGGGGG + Intronic
1136383613 16:29909183-29909205 CATGTGTGGTGGAGGGGAGGGGG - Intronic
1136450971 16:30354112-30354134 CTGGTGGTGTGGAGCGAGGGAGG - Intronic
1137036794 16:35575076-35575098 CCGGTGCTGTGGAGGGCAGGGGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137675644 16:50302549-50302571 AGGGTGGGGTGGGGGGAAGGTGG - Intronic
1137677521 16:50311103-50311125 CTAGTGGTGGGGAGGGAAGGAGG + Intronic
1137819914 16:51434450-51434472 GAGTTGGATTGGAGGAAAGGGGG + Intergenic
1138088103 16:54152425-54152447 CAGGTGGCTTGGAGGAAAGTGGG - Intergenic
1138133702 16:54503256-54503278 CATCTGGAGTAGAGGGGAGGGGG + Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138585347 16:57966237-57966259 TAGGTGGAGAGGAGGGAACGTGG - Intronic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1138891608 16:61150138-61150160 CAAGAGGAGTGGAGGGGATGAGG + Intergenic
1138969591 16:62128764-62128786 GAGGTGGAGAGGAGAGAAGAAGG - Intergenic
1139445828 16:66998044-66998066 CACGTGGAGGGGCGGTAAGGTGG + Intronic
1139490988 16:67285920-67285942 AAGGTCGTGTGGAGGAAAGGGGG + Intronic
1139640457 16:68287868-68287890 CAGGGTAAGTGGTGGGAAGGGGG + Exonic
1140054940 16:71517206-71517228 CAGGTGGAATGGGAGTAAGGTGG + Intronic
1140845080 16:78879063-78879085 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
1140864972 16:79052184-79052206 GTGGTGGGGTGGGGGGAAGGGGG - Intronic
1141286992 16:82681831-82681853 CACCTGGAGTGCAGGGAAGTTGG - Intronic
1141382369 16:83588021-83588043 CAGGTGTACGGGATGGAAGGAGG - Intronic
1141684125 16:85560723-85560745 CTGGTGGAGTTCAGGAAAGGGGG - Intergenic
1141688658 16:85584390-85584412 GAGGCAGCGTGGAGGGAAGGCGG - Intergenic
1141694636 16:85613700-85613722 CAGGTAAAGTGGGGGGATGGGGG + Intronic
1141713937 16:85716355-85716377 GAGGAGGAAGGGAGGGAAGGAGG + Intronic
1141812255 16:86383394-86383416 CAGATGGAGTCGCAGGAAGGTGG - Intergenic
1141819290 16:86434022-86434044 CAGGTGGAGAGGATGGAGGATGG - Intergenic
1141900379 16:86986937-86986959 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141900389 16:86986953-86986975 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141921583 16:87139136-87139158 CAGCTGGAGTGCAGGGCATGGGG - Intronic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1142030666 16:87836850-87836872 GAGGCGGGGAGGAGGGAAGGAGG + Intronic
1142030673 16:87836870-87836892 AGGGAGGAGAGGAGGGAAGGAGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142280193 16:89143957-89143979 CATGTGGAGTGCAGGGTATGTGG + Intronic
1142280702 16:89146209-89146231 CAGGTAGAGACGAGGGCAGGGGG + Intronic
1142329802 16:89444462-89444484 GGGGTGGAGTGGAGGGAGGGGGG + Intronic
1142446242 16:90140164-90140186 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1142461263 17:95299-95321 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1142674074 17:1502712-1502734 AAGGTGGAGTGGAGAGAACTTGG - Intronic
1142698095 17:1644495-1644517 CATGGGCAGTGGATGGAAGGGGG - Intronic
1142700934 17:1660325-1660347 CAGGTGGAATCGAGGGGAGAGGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1142935460 17:3326698-3326720 GTGGTGGAGTGGGGGGAGGGGGG - Intergenic
1143114790 17:4576385-4576407 CAGGGTTAGTGGAGGTAAGGAGG + Intergenic
1143576138 17:7794380-7794402 CAGGACGAGGGGAGGGTAGGAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144234407 17:13243643-13243665 TAGGTGGAACTGAGGGAAGGTGG - Intergenic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144440655 17:15278343-15278365 AAGGTGGGGTGGGGGGCAGGCGG - Intergenic
1144504843 17:15821266-15821288 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1144636143 17:16910493-16910515 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1144645928 17:16973334-16973356 GAGGTGGAGAGGAAGGAGGGAGG + Intergenic
1144832762 17:18140663-18140685 GAGGTGGGGTGGGGGGCAGGTGG + Exonic
1145065999 17:19761874-19761896 CAGGTGCTGTGGTGGGCAGGAGG + Intergenic
1145169016 17:20639149-20639171 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1145203579 17:20968588-20968610 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1145398106 17:22511918-22511940 GAGGTGAAGTGGGGGGAAGGGGG - Intergenic
1146110951 17:30089085-30089107 GTCGTGGGGTGGAGGGAAGGGGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146420251 17:32678403-32678425 GTGGTGGAGTGGGGGGAGGGGGG - Intronic
1146496337 17:33325753-33325775 GTGGTGGAGTGGATTGAAGGAGG + Intronic
1146538376 17:33673148-33673170 CAGGTGCAGGGGAGTGCAGGAGG + Intronic
1146594479 17:34157102-34157124 GAGGAGGAGAGGAGGGACGGAGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1146906538 17:36621747-36621769 CAGGTGGCATGGAGGGCAAGGGG + Intergenic
1147035952 17:37680998-37681020 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1147056114 17:37836427-37836449 CAGGCGTAGTGGAGGCACGGTGG - Intergenic
1147627269 17:41908233-41908255 CAGGTGGTGTTGAGGGAGAGTGG - Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147783575 17:42961685-42961707 AGGATGGAGTGGAGGGAGGGAGG - Intronic
1148161976 17:45455387-45455409 CAGGTAGAGTGGTGAGAAAGTGG - Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148603443 17:48910565-48910587 CAGGGGGAGGGGAGGGAGAGAGG - Intronic
1148783720 17:50135195-50135217 GAGGTGGGGTGGAGGGGTGGGGG + Exonic
1148789589 17:50165973-50165995 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1149302737 17:55319560-55319582 GGGGTGGAGGGCAGGGAAGGAGG + Intronic
1149596755 17:57868714-57868736 GAGGTGAGGGGGAGGGAAGGGGG + Intronic
1149787108 17:59444966-59444988 ATGGTGGAGTGGAGAGAAAGAGG + Intergenic
1149952590 17:61005942-61005964 GTGGTGGAGTGGGGGGAAGGGGG - Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150345093 17:64398439-64398461 GAGGTGGAGTGGGGGGAGGAAGG + Intronic
1150393208 17:64802036-64802058 CAGGTAGAGTGGTGAGAAAGTGG - Intergenic
1150416784 17:64994781-64994803 AGGGTGGAGTGGAGGGAGAGAGG + Intergenic
1150613102 17:66749282-66749304 CCGGAGGGGTGGAGGGCAGGGGG - Intronic
1150677773 17:67259563-67259585 AAGGAGGGGTAGAGGGAAGGAGG + Intergenic
1150794868 17:68229100-68229122 AGGGTGGAGTGGAGGGAGAGAGG - Intergenic
1151070614 17:71206299-71206321 GTTGTGGGGTGGAGGGAAGGGGG + Intergenic
1151109232 17:71655276-71655298 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1151245922 17:72794575-72794597 CAGTTTGAGTGTAGAGAAGGAGG - Intronic
1151264719 17:72945907-72945929 CTGGTGGGGTCGGGGGAAGGTGG - Intronic
1151511211 17:74561402-74561424 CAGGTAGAGGGCTGGGAAGGTGG - Intergenic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1151884671 17:76916467-76916489 CAGGTGGAGTGGGGAGAACTTGG + Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152069626 17:78128333-78128355 CACGGGGAGGGGAGGGGAGGGGG - Intronic
1152362393 17:79838881-79838903 GAGGTGGGGTGGAGGGAGGAGGG - Intronic
1152420306 17:80189220-80189242 CAGGTGCACTGGAGAGAGGGGGG + Intronic
1152504730 17:80741320-80741342 CAGGTGGAGGGCAGTGCAGGAGG + Intronic
1152710860 17:81870064-81870086 GGGGTGGAGAGGAGCGAAGGTGG - Intronic
1152793813 17:82296909-82296931 GGGGTGGAGAGGAGGGAGGGAGG - Intergenic
1153090893 18:1341195-1341217 GATGTGGGGTGGAGGGATGGGGG + Intergenic
1153695213 18:7633527-7633549 CAAGAGGAGTGAAGGGAAGGTGG - Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1153836620 18:8969751-8969773 AAGGTGGAAGGGAGGGAAGGGGG - Intergenic
1155063136 18:22246277-22246299 GAGGTGGAGGGCAGGGATGGAGG + Intergenic
1155079159 18:22390381-22390403 GGGGTGGGGTGGAGGGAGGGAGG + Intergenic
1155707675 18:28837156-28837178 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1156292035 18:35755771-35755793 CAGGTGGAGAGGAGGCAAAAGGG - Intergenic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1156668250 18:39434882-39434904 CAAGTGAAGTTGGGGGAAGGAGG + Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157583595 18:48787372-48787394 CAGGAGGAAGGGAGAGAAGGAGG + Intronic
1157597244 18:48871266-48871288 CAGGTGCAATTGATGGAAGGAGG - Intergenic
1157614481 18:48978511-48978533 CAGGTGCAATTGAAGGAAGGAGG + Intergenic
1157968392 18:52236706-52236728 CTGGTGGAGGGGTGGGCAGGGGG + Intergenic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158669260 18:59460231-59460253 CAGGAGGAGAGAAGGGAGGGTGG - Intronic
1158904743 18:62001150-62001172 CTAGTGGAGTGGTGGGAAGGAGG - Intergenic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159685812 18:71418501-71418523 CAGGTGGAGAGGAGGCAGAGTGG + Intergenic
1160042866 18:75361154-75361176 CAGGTGGTGCAGAGGGAACGTGG + Intergenic
1160208642 18:76858627-76858649 CAGGTGGAGGCGAGTGCAGGTGG + Intronic
1160318199 18:77867313-77867335 CAGGTGGAGAGGAAGGTGGGTGG - Intergenic
1160461976 18:79046384-79046406 CCGGTGCTGTGGGGGGAAGGAGG + Intergenic
1160650964 19:227666-227688 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1160770467 19:828658-828680 GAGGTGCAGTGAAGGAAAGGGGG + Intronic
1160770500 19:828760-828782 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160770553 19:828958-828980 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160770612 19:829123-829145 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160770635 19:829189-829211 GAGGTGCAGAGAAGGGAAGGGGG + Intronic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1160945978 19:1644286-1644308 CTGGGGGAGTGGAGGCAATGAGG + Intronic
1161021773 19:2014460-2014482 CAGGTGGGGTCCAGGGATGGAGG + Intronic
1161321403 19:3643349-3643371 AAGGTGGCGTGCAGGGCAGGAGG + Exonic
1161403188 19:4077988-4078010 CAGGTGGGCTGCAGGGAGGGAGG - Intergenic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161576718 19:5058456-5058478 CAGGAGCAGGGGCGGGAAGGGGG + Intronic
1161591594 19:5131543-5131565 CAGGTGGGGTGGAGCGGGGGAGG + Exonic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161778009 19:6274377-6274399 CAGGTGGTGTGGGGGAAGGGGGG - Intronic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1161984479 19:7646202-7646224 CAGGGGGATTGAGGGGAAGGAGG - Intronic
1162172776 19:8804554-8804576 GAGGTGGTCTGGAGGAAAGGTGG - Intergenic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162497399 19:11030913-11030935 CAGGTCGAGGAGAAGGAAGGGGG + Intronic
1162536446 19:11265291-11265313 CAGCTGGAGTGGAGTGAATGAGG - Intergenic
1162800113 19:13105468-13105490 CAGGGTGAGTGGTGGTAAGGTGG - Exonic
1162859103 19:13492145-13492167 CCAGTGTAGTGGAGGGAGGGAGG - Intronic
1162899749 19:13787720-13787742 CAGGTCGAGGCGGGGGAAGGTGG - Intergenic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163113926 19:15178129-15178151 GGTGGGGAGTGGAGGGAAGGAGG + Intronic
1163138923 19:15332930-15332952 GGGGTGAAGTGGAGGAAAGGAGG + Intergenic
1163465819 19:17468039-17468061 AAGGAGGAGAGGAGGGGAGGAGG + Intergenic
1163513528 19:17749454-17749476 CAGGAGGAGGGAGGGGAAGGGGG + Intronic
1163607348 19:18282233-18282255 CACGCGGGGTGGAGGGAGGGAGG - Intergenic
1163779673 19:19239785-19239807 GAGGAGGAGTGGAAGGGAGGAGG - Intronic
1164150660 19:22547738-22547760 CTAGTGGAGTGGGGGGCAGGTGG - Intergenic
1164323926 19:24176127-24176149 GTGGTGGAGAGGGGGGAAGGGGG - Intergenic
1164441960 19:28285322-28285344 GAGGTGGAGGGGAAGGAGGGTGG + Intergenic
1164521296 19:28982197-28982219 CAGGTGAGGAGGAGGGAAGGAGG + Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164744224 19:30599351-30599373 GAGGAGGAAGGGAGGGAAGGAGG - Intronic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1164868725 19:31625939-31625961 GAAGTGGAGTGGAGGCAGGGAGG - Intergenic
1164925623 19:32127777-32127799 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1165343305 19:35227539-35227561 CAGGTGGACTGGGGGAGAGGAGG + Intronic
1165942906 19:39424175-39424197 AAGCTGGAGTGGTGGGAACGTGG - Exonic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166156708 19:40918146-40918168 CATGTGGGGTGGGGGGAGGGGGG + Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166412907 19:42568525-42568547 GTCGTGGGGTGGAGGGAAGGGGG + Intergenic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166646118 19:44533038-44533060 GAGGTGGTGGGGAGGGAAGCTGG - Intergenic
1166888111 19:45973575-45973597 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1166921448 19:46231528-46231550 CAGGTGGGGTGGGGAGGAGGTGG + Intergenic
1167212137 19:48139884-48139906 CAGGTGGATCGGAGAGATGGTGG - Intronic
1167571351 19:50290867-50290889 CAGCTGGAGAGGAGGTCAGGAGG - Exonic
1168370387 19:55828262-55828284 GTGGTGGGGTGGGGGGAAGGGGG + Intronic
1168421440 19:56206671-56206693 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168424021 19:56224272-56224294 CTGATGGAATGTAGGGAAGGAGG - Intronic
1168426695 19:56244800-56244822 CTGATGGAATGTAGGGAAGGAGG + Intronic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925180297 2:1813174-1813196 CAGGTGGGGGGGAGAGAGGGAGG + Intronic
925336011 2:3099806-3099828 CTGGTGGAGTGGGGAGCAGGTGG - Intergenic
925356693 2:3246834-3246856 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
925356699 2:3246850-3246872 AAGGAGGAAGGGAGGGAAGGAGG + Intronic
925398237 2:3552543-3552565 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925398248 2:3552568-3552590 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925398259 2:3552593-3552615 GAGGTGGTGTGGAGGGGAGGGGG - Intronic
925418420 2:3690343-3690365 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
925418458 2:3690403-3690425 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925941781 2:8827645-8827667 CAGGTAAAGTGGAGGCAGGGAGG - Intronic
926163105 2:10501873-10501895 CAGGCCCAGTGGAGGGAAGGAGG - Intergenic
926209006 2:10854996-10855018 CAGGTGGATTCTAGGGAAGGAGG + Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926244645 2:11113721-11113743 AAGGTGGGGAGGAAGGAAGGAGG - Intergenic
926434136 2:12821482-12821504 GAGGTGGAGGAGAAGGAAGGCGG - Intergenic
926597095 2:14802885-14802907 GTGGTGGAGTGGGGGGAGGGGGG + Intergenic
926884182 2:17582217-17582239 CAGGAGGGGTGAGGGGAAGGAGG + Intronic
927315847 2:21681040-21681062 GAGGTGGGAGGGAGGGAAGGAGG + Intergenic
927471958 2:23384135-23384157 CCGGGGGAGCGGAGGGAGGGTGG + Intergenic
927517320 2:23679983-23680005 GAGGAGGAGCGGAGGGAACGGGG + Intronic
927846553 2:26475288-26475310 CAGGTGGAGTGCAGGGAACAAGG + Intronic
927873871 2:26641414-26641436 CAGGTGGAATGGGCAGAAGGTGG - Intergenic
927897187 2:26790671-26790693 CTGGTGGTGGGGAGGGAGGGAGG + Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928012549 2:27623743-27623765 TAGAGAGAGTGGAGGGAAGGGGG - Intergenic
928189399 2:29148212-29148234 AAGGTGGAGGGGAGGGGAGTTGG + Intronic
929423441 2:41818938-41818960 GAGGAGGAGAGGAGGGGAGGAGG + Intergenic
929570200 2:43018138-43018160 GAGGTGGAGTGGAGAAGAGGAGG + Intergenic
929778188 2:44941531-44941553 GAGGGGGAGAGCAGGGAAGGAGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930312243 2:49755928-49755950 AGGGTGGAAAGGAGGGAAGGGGG + Intergenic
930365435 2:50433731-50433753 AAGGTGGAAGGGAGGGAAGGAGG + Intronic
930599290 2:53424872-53424894 GAGGTGTAGTGGAGGCAAGTCGG + Intergenic
930709300 2:54534990-54535012 CTGGTGGAGTGGAGAGAATGAGG - Intronic
930768442 2:55108568-55108590 CAGCTCTAGTGGAGGGATGGGGG + Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
930931736 2:56892990-56893012 GCTGTGGGGTGGAGGGAAGGGGG - Intergenic
931098878 2:58973195-58973217 AAGGTGGGGAGGAAGGAAGGGGG + Intergenic
931581276 2:63778056-63778078 CAGGTGGAGTTGAAGGAAATAGG - Intronic
931681235 2:64751253-64751275 AGTGTGGGGTGGAGGGAAGGAGG + Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932347320 2:71004204-71004226 CAGGTGGAGAGGTGGGCAAGTGG - Intergenic
932460183 2:71876954-71876976 AAGTTGGAGGGGAGGGAGGGAGG + Intergenic
932572305 2:72944486-72944508 CATGGGGAGGGGAGAGAAGGTGG - Exonic
932749010 2:74359181-74359203 GAGGTAGAGTGGAGGGAAGGAGG + Intronic
932793939 2:74679366-74679388 TGGGTGGAGTGGATGGAAAGGGG + Intronic
933247607 2:79993639-79993661 CAGGTAGTGTGGAGTGAAGAGGG + Intronic
933377801 2:81502236-81502258 AAGGAGGAGTGGGTGGAAGGAGG + Intergenic
933672040 2:85017553-85017575 GGGGTGGGGTGGAGGGAGGGAGG - Intronic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
933709624 2:85315783-85315805 CAGCTGGAGGGGAAGGTAGGGGG + Intergenic
933713440 2:85343991-85344013 CAGCTGGAGGGGAAGGTAGGGGG - Exonic
933927307 2:87106050-87106072 CAGGGAGTGTGGAGGGAGGGAGG - Intergenic
934653988 2:96107910-96107932 CAGGTGGGGTTGGGGGATGGAGG + Intergenic
935125929 2:100222932-100222954 CAAGTGTAGTGCAGGGAAAGAGG - Intergenic
935706509 2:105861946-105861968 CAGGTGGAAGAAAGGGAAGGGGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936399725 2:112156085-112156107 CAGGAAGCGTGAAGGGAAGGTGG - Intronic
936451363 2:112636152-112636174 CAGGTGCAGGGGAAGGAAGGTGG + Intergenic
936501250 2:113068093-113068115 CAGGAGGAGTGAAGGGATAGAGG - Intronic
937035817 2:118781041-118781063 CAGCTGGAGTGATGGGATGGAGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937137133 2:119563501-119563523 TAGGTGGGGTGGAGGGATAGGGG - Intronic
937231373 2:120400003-120400025 CACGTCCAGTGGAGGGGAGGAGG + Intergenic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937312228 2:120909384-120909406 CAGGTGCAGTGGGAGGAAGCTGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937599026 2:123706348-123706370 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
937696107 2:124810426-124810448 CAGATACAGTGGAGGGCAGGGGG + Intronic
937890491 2:126934896-126934918 CAGGTGGGGTGGAGTGAAGCAGG + Intergenic
938569228 2:132546886-132546908 CAAATGAAGGGGAGGGAAGGAGG + Intronic
938639882 2:133266943-133266965 CCGGCGGAGGGGAGGGGAGGGGG - Intronic
939058554 2:137393305-137393327 GTGGTGGGGTGGTGGGAAGGGGG - Intronic
939144015 2:138390731-138390753 CAGATGGCGTGGAGGGAGGGCGG - Intergenic
939244517 2:139606454-139606476 CATGGGGGGTGGAGGGAGGGGGG + Intergenic
939411739 2:141835494-141835516 TGGGGGGAGGGGAGGGAAGGTGG + Intronic
939447977 2:142334497-142334519 CTAGTGGAGCTGAGGGAAGGAGG - Intergenic
939733915 2:145819528-145819550 AGGGAGGAGTGAAGGGAAGGAGG - Intergenic
939825941 2:147015603-147015625 CAACTGGAGTGGAAGGAGGGGGG + Intergenic
939983204 2:148805618-148805640 GAGGGAGAGTGGAGGGGAGGAGG - Intergenic
940329679 2:152460979-152461001 CAGGTAGTGGGGAGGCAAGGGGG - Intronic
940576560 2:155513485-155513507 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
942104460 2:172619148-172619170 CCAGTGCAGTGGAGGGCAGGGGG - Intergenic
942165226 2:173234755-173234777 CACCTGAAGTGGAAGGAAGGTGG + Intronic
942682506 2:178492468-178492490 CATGTGGGGTGGGGGGAGGGGGG + Intronic
942791563 2:179766937-179766959 CAGGTGGAGTGGACTGCGGGGGG - Intronic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
943446594 2:187994656-187994678 CATGTGGAATGGAGGGTAGCAGG - Intergenic
943550900 2:189338441-189338463 TAGGTGGAGTGGAGTGGAGCTGG - Intergenic
943732510 2:191317623-191317645 AATGTGGGGTGGAGGGAAGGGGG - Intronic
944212642 2:197222267-197222289 GAGGAGGAGGGTAGGGAAGGAGG + Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
945136824 2:206638614-206638636 CAGGTAGTGTGGTGGGTAGGGGG - Intergenic
945581563 2:211601806-211601828 GAGGTGGGATGGAGGGAGGGAGG + Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
945929347 2:215839815-215839837 AGGGTGGAGGAGAGGGAAGGGGG - Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946227019 2:218269624-218269646 CATGTGGCGAGAAGGGAAGGTGG + Intronic
946413115 2:219525634-219525656 CAGGTGCAGAGGAAGGAAGATGG - Intronic
946449265 2:219765760-219765782 CAGAAGGAGTGGAAGGGAGGTGG - Intergenic
947096526 2:226573053-226573075 CAGGTGGAGGGAAGTGGAGGAGG - Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
1168749317 20:271016-271038 AAGGAGGAGGGAAGGGAAGGGGG + Exonic
1168840198 20:905153-905175 CAGGTGGAGTAGAGTGGGGGTGG - Intronic
1168943438 20:1732258-1732280 CAGGTGGGGGGGAAAGAAGGAGG + Intergenic
1168960063 20:1862895-1862917 TTGGTGGAGAGGAGGGAAGGAGG - Intergenic
1168962070 20:1876785-1876807 GAGGGGGAGGGGAGGCAAGGAGG - Intergenic
1168973840 20:1949468-1949490 CAAGTGGAATGGAGGCAATGTGG - Intergenic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1169765468 20:9143549-9143571 ACGGTGGAGGGGAGGGATGGTGG + Intronic
1170231248 20:14049395-14049417 GAACTGGAGTGGAGGGGAGGTGG + Intronic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170438069 20:16350542-16350564 AAGGTGGGGAGGAGGGAAGATGG + Intronic
1170561652 20:17563629-17563651 CTGGTGGGGTGGTGGGGAGGAGG - Intronic
1170592766 20:17783505-17783527 CAGGAGGAGTGGAGGTTGGGTGG - Intergenic
1171012298 20:21515230-21515252 GAGGTGGAGCAGCGGGAAGGCGG + Intergenic
1171202668 20:23254639-23254661 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1171354592 20:24534302-24534324 CAGATGGAGGGGAGGGGTGGAGG - Intronic
1172113943 20:32562937-32562959 AGGGTGGAGGGGAGGGAGGGTGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1173572509 20:44086596-44086618 GAGGTGGTGTGGAGGGAGGTGGG - Intergenic
1173573740 20:44096446-44096468 GAGGTGGAGTGGGAGGGAGGGGG + Intergenic
1173688648 20:44941879-44941901 TTGATGCAGTGGAGGGAAGGGGG - Intronic
1173918083 20:46724733-46724755 CAGATGGAGTAGATGGATGGAGG + Intronic
1174189875 20:48732860-48732882 GTGGTGGGGTGGAGGGAGGGCGG - Intronic
1174198010 20:48786895-48786917 GAGGTGGAGGGGAGGGAAAGAGG + Intronic
1174200759 20:48804885-48804907 CAAGAGGAGTGGCGGGGAGGAGG + Intronic
1174275512 20:49400994-49401016 CAGGTGGATAGGTGGGTAGGTGG - Intronic
1174339322 20:49886244-49886266 CATGTGGAGGGGAGAGACGGAGG - Intronic
1174445559 20:50588466-50588488 CAGGTGAGGTTGAGGGAAAGCGG + Intronic
1174543619 20:51308496-51308518 CAGGTCCAGGGGAGGGAAGAAGG + Intergenic
1174627521 20:51927812-51927834 GAGGGGGAGTGGGGGGGAGGGGG + Intergenic
1174726395 20:52867178-52867200 AAGGTGGAGTGGGAGGAAGTGGG - Intergenic
1174852309 20:54007048-54007070 AAGTTGGCGTGGAGGCAAGGAGG + Intronic
1174960522 20:55151769-55151791 GAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1175110523 20:56644843-56644865 CAGGGGAAGTGGAGAGTAGGGGG + Intergenic
1175294702 20:57900293-57900315 AAGGTTGAGGGGAGGGAGGGAGG + Intergenic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1175605096 20:60306259-60306281 CAGATAAGGTGGAGGGAAGGAGG + Intergenic
1175605467 20:60308767-60308789 CAGGTGGAGGGGAAGGGAGAAGG + Intergenic
1175644746 20:60661513-60661535 CCAGTGGCTTGGAGGGAAGGGGG + Intergenic
1175923935 20:62462885-62462907 CAGGTCCAGTGGGGGGCAGGTGG + Intergenic
1175935273 20:62511115-62511137 CAGGAGGGGTGGAGGTCAGGAGG - Intergenic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176113891 20:63422733-63422755 TGGGTGGAGTGGAGGGTGGGAGG + Intronic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1177577724 21:22980495-22980517 AAGGTGGAGGACAGGGAAGGGGG + Intergenic
1177686732 21:24447193-24447215 CAGGTGTTGTGGAAGGGAGGTGG - Intergenic
1177758317 21:25373721-25373743 GAGGAGGAGGGGAGGGGAGGGGG - Intergenic
1178099107 21:29247092-29247114 AAGGTGGAAGGGTGGGAAGGGGG - Intronic
1178170534 21:30035080-30035102 GAGGAGAAGAGGAGGGAAGGAGG - Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1179135829 21:38678930-38678952 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1179164526 21:38925196-38925218 CAGCTGCAGGGGAAGGAAGGAGG + Intergenic
1179519287 21:41931839-41931861 GAGGTGGAGTGGTGGGATGTTGG - Intronic
1179519364 21:41932059-41932081 GAGGTGGAGTGGTGGGATGCTGG - Intronic
1179535475 21:42048730-42048752 CAGATGGAGTGGACGGTAGTAGG + Intergenic
1179714110 21:43279038-43279060 AAGGTGGAGGGGACGGTAGGGGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714333 21:43279953-43279975 GAGGTAGAGGGGAGGGGAGGTGG + Intergenic
1179714397 21:43280112-43280134 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714412 21:43280145-43280167 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714420 21:43280161-43280183 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714428 21:43280177-43280199 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714436 21:43280193-43280215 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714490 21:43280315-43280337 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714521 21:43280388-43280410 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714598 21:43280566-43280588 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714650 21:43280684-43280706 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714686 21:43280766-43280788 GAGGTGGCGGGGAGGGGAGGTGG + Intergenic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1179714701 21:43280798-43280820 AAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714754 21:43280923-43280945 TAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179955730 21:44737178-44737200 GGGGTGGGGTGGAGGGCAGGGGG + Intergenic
1180050176 21:45327482-45327504 GAGGTGGAGTTGCGGGAAGGAGG + Intergenic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180156154 21:45978125-45978147 GAGGGGGAGAGGAGGGAAGGGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180480822 22:15752099-15752121 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1180712151 22:17846686-17846708 CATGTGGAGTAGAGGGCGGGAGG - Intronic
1181107232 22:20582546-20582568 CAGGTGGTGTGGAGGCAGGCGGG + Intronic
1181468961 22:23126487-23126509 CAGATGGAATGCAGGGAAGGAGG - Intronic
1181528422 22:23502702-23502724 GGGATGGAGTGGAGGGATGGGGG - Intergenic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1181767201 22:25100388-25100410 CAAATGGAGTGGAAGGGAGGAGG + Intronic
1181873453 22:25921567-25921589 CATGTGGAGTGTAGGTGAGGAGG + Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181977230 22:26738528-26738550 GAGGGGGAGGGGAGGGGAGGTGG - Intergenic
1182458536 22:30468472-30468494 CAGGTGGGGTGGATGGCTGGGGG - Intronic
1182458873 22:30470366-30470388 CAGGTCCAGAGGAGGGAAGGGGG - Intronic
1182679843 22:32070240-32070262 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1182815604 22:33160836-33160858 CAGGCTGAGTGAAGGGAAGTTGG + Intergenic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1182972854 22:34593866-34593888 AAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1183208405 22:36434778-36434800 CCGGCTGTGTGGAGGGAAGGGGG + Intergenic
1183314072 22:37127679-37127701 GACGGGGAGGGGAGGGAAGGAGG + Exonic
1183390346 22:37542111-37542133 CAGGTGGGGTGGATGGGAGAAGG + Intergenic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183782400 22:40007275-40007297 GAGGAGGAGAGGAGGAAAGGAGG - Intronic
1183966280 22:41444877-41444899 CAGATTGGGTGGGGGGAAGGGGG - Intronic
1183988929 22:41585067-41585089 CAGTTGGAGTGGGTGGGAGGTGG + Intronic
1184534625 22:45078000-45078022 CAGGTGGTGCCGAGGGAAGCTGG + Intergenic
1184617602 22:45648618-45648640 CAGGGGGTGTGGTGGGACGGAGG - Intergenic
1184729724 22:46365850-46365872 AAGGTTGGGTGGGGGGAAGGTGG + Intronic
1184748400 22:46469977-46469999 GAGGAGGAGGGGAGGGAGGGAGG + Intronic
1184762119 22:46550616-46550638 GAGGTGGACTGCAGGGAATGTGG + Intergenic
1184779584 22:46640352-46640374 CATGTGGGGTGGAGGGATGGAGG + Intronic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1185136481 22:49076252-49076274 CAGGAGGTGGTGAGGGAAGGTGG + Intergenic
1185277935 22:49957777-49957799 CAGGTGGGGTGGGGGGTGGGAGG + Intergenic
949386644 3:3509921-3509943 CAGGGGGTGGGGAGAGAAGGGGG + Intergenic
950007632 3:9701705-9701727 CAGGTGGTATGGAGGGAGGGAGG + Intronic
950556883 3:13701357-13701379 AGGGCAGAGTGGAGGGAAGGAGG - Intergenic
950584707 3:13883908-13883930 CAGATGGTGGGGAGAGAAGGGGG + Intergenic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
950795352 3:15505984-15506006 CAGGTGGGGAGGAGGGAGGCTGG + Intronic
951140144 3:19148565-19148587 CAGGGGAAGTGGAAGGATGGAGG - Exonic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
952949917 3:38514755-38514777 CAGGGGGAGGGGGGGGAGGGTGG - Intronic
953105073 3:39869913-39869935 AAGGTGGAGGGGTGGGAAGCAGG + Intronic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953414142 3:42705873-42705895 AAGGAGGAGTAAAGGGAAGGTGG - Intronic
953748487 3:45593099-45593121 CAGCTAGAGTGCAGGGAGGGAGG + Intronic
953980985 3:47412912-47412934 CAGGTAGTGGGGAGGAAAGGGGG - Exonic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954331050 3:49890454-49890476 CATGTGGACTGTAGGGCAGGTGG + Intronic
954366853 3:50151031-50151053 GAGGGGGAGTGTTGGGAAGGGGG - Intergenic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954601733 3:51875592-51875614 CAGGAAGAGTGGAGGAAGGGCGG + Intergenic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955349293 3:58182173-58182195 GAGGGGGAGGGGAGGGGAGGAGG + Intergenic
955425373 3:58783995-58784017 GTGGTGGAAGGGAGGGAAGGAGG - Intronic
956015915 3:64882390-64882412 CAGAAGGAGTGGGAGGAAGGAGG - Intergenic
956080215 3:65549351-65549373 CAGGAAGAGGGGAGGGGAGGGGG - Intronic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956979010 3:74614725-74614747 CGGGCGGACTGGAGGGAGGGAGG + Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958513868 3:95086878-95086900 GAGGTGAAGTGGGAGGAAGGTGG - Intergenic
959254511 3:103992012-103992034 CACGAGGAGAGGAGGTAAGGAGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959495702 3:107048863-107048885 CAGGTGCAGGGTAGGGAAAGAGG + Intergenic
960280104 3:115771750-115771772 CAGGTGGAGTTAGGGGAAAGAGG + Intergenic
960429919 3:117556776-117556798 CAGGAGGAAGGGAGAGAAGGGGG - Intergenic
960586169 3:119323039-119323061 GAGCTGGAGCGGAGGGAACGTGG - Intronic
960822691 3:121750872-121750894 AAGGTGGAGTTGGGGGAGGGAGG + Intergenic
960913884 3:122678444-122678466 GAGGTGGAGTGGTGGGCATGAGG + Intergenic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
961351391 3:126306896-126306918 TGGGTGGAGTGGAGGGAGAGTGG - Intergenic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961639038 3:128353446-128353468 GAGGAGGAGAGGAGGGAAAGAGG - Intronic
961734936 3:128995407-128995429 CAGGTGGGGTGTGGGCAAGGTGG - Intronic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
961812064 3:129527700-129527722 AAGATGGAGTGGAGGGAGGGAGG - Intergenic
961816869 3:129555668-129555690 AGGGTGGAGGGGAGGGATGGGGG - Exonic
961930332 3:130526342-130526364 TGGCTGGAGTGGAGGGAATGAGG + Intergenic
961940861 3:130636754-130636776 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961940876 3:130636782-130636804 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962425977 3:135269809-135269831 AAGGTGGACTGGAGGGGTGGTGG + Intergenic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962559535 3:136591264-136591286 GAGGAGGGGAGGAGGGAAGGCGG + Intronic
962740192 3:138357677-138357699 AAAGTGGAGTGGAGGCCAGGCGG - Intronic
963115601 3:141726462-141726484 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
963301699 3:143604601-143604623 GAAGTGGGGTGGAGTGAAGGTGG + Intronic
963411838 3:144938024-144938046 GGGGTGGAGTTGGGGGAAGGTGG + Intergenic
963437113 3:145286040-145286062 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
964002832 3:151796186-151796208 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
964167439 3:153725592-153725614 GAGGTGCAGTGGAGTGAATGAGG - Intergenic
964445428 3:156752720-156752742 GAGGAGGAGTGGAGCGGAGGTGG + Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965106569 3:164363058-164363080 CGAGTGGAGTGGAGGGCAGACGG + Intergenic
965120163 3:164543919-164543941 TTTGTGGAGTGGAGGGGAGGGGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965401546 3:168218584-168218606 TAGGTGGAGTGGAGGTAGAGGGG - Intergenic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
965681727 3:171258713-171258735 CAGGTGGAGTGGGCAGAAGGAGG - Intronic
965768746 3:172158855-172158877 GAGGAAGAGGGGAGGGAAGGAGG - Intronic
966159721 3:176955287-176955309 GTGGTGGAGTGGGGGGAGGGGGG - Intergenic
966254737 3:177904881-177904903 GAGGTGGGGTGGAGGGACTGGGG + Intergenic
966886494 3:184380283-184380305 CAGCTGGGGAGGAGGGAGGGAGG - Exonic
967207583 3:187138229-187138251 GAGGTGGCGGGGAGGGGAGGCGG + Intronic
967237726 3:187403424-187403446 GATGTGAAGTGGAGGGCAGGAGG - Intergenic
967269889 3:187724861-187724883 GAGGTGGAGCGCAGGGAAGGAGG - Intronic
967269894 3:187724880-187724902 GATGTGGAGGGCAGGGAAGGAGG - Intronic
967591062 3:191274128-191274150 AAGATGAAGTGGAGGGTAGGAGG - Intronic
967726732 3:192869291-192869313 GAGGAGGGGAGGAGGGAAGGAGG + Intronic
967838117 3:193981397-193981419 AAAGTGGAGAGGAAGGAAGGAGG - Intergenic
967870992 3:194228966-194228988 AGGGTGGAGGGGAGGGAAAGAGG - Intergenic
968278460 3:197458325-197458347 CAGGGTGAGTGGAGGGCATGTGG - Intergenic
968366866 3:198192321-198192343 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
968628333 4:1637905-1637927 CAGGTGGATGGGAGGAATGGGGG - Intronic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
968957540 4:3726897-3726919 CAGCTGGCGTGGAGGGGTGGGGG + Intergenic
969108865 4:4828911-4828933 GAGGGGGAGAGGAGGAAAGGAGG - Intergenic
969370429 4:6727866-6727888 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
969424350 4:7115569-7115591 CAGGTGATGTGGAGGTGAGGAGG + Intergenic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
970486205 4:16527271-16527293 CAGCTGGAGTGAAGAGAATGAGG + Intronic
971153168 4:24055429-24055451 TAGGAGGGGTGGAAGGAAGGAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971862534 4:32126608-32126630 CAGGTGGGGTGGGGGGAGGGGGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972151680 4:36099042-36099064 CATGGGGAGGGGAGGGTAGGGGG - Intronic
972619573 4:40733822-40733844 AAGGTGGGAAGGAGGGAAGGAGG + Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
972957983 4:44415905-44415927 CAGGTGGAGCTGTGAGAAGGGGG + Intronic
973093765 4:46171501-46171523 CAGTTGGTGGGGAGGGAGGGAGG - Intergenic
973639022 4:52885388-52885410 CCGGTGGGGTGAAGGGAGGGAGG - Intronic
973682465 4:53334597-53334619 GTGGTGGGGTGGGGGGAAGGGGG + Intronic
975101841 4:70522538-70522560 GGGATGGTGTGGAGGGAAGGGGG - Intronic
975180186 4:71335061-71335083 TACGTGAAGTGGAGGGAGGGAGG + Intronic
975693179 4:76985678-76985700 TAAGTGTAATGGAGGGAAGGTGG + Intronic
975829723 4:78356643-78356665 CAGATGCAATGGAGGGGAGGAGG + Intronic
976005395 4:80423894-80423916 CAGGTGCAGTAGACTGAAGGTGG - Intronic
976221820 4:82762204-82762226 GAGGGGGAGAGGAGGGGAGGGGG + Intronic
976245513 4:83002438-83002460 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
977023392 4:91786170-91786192 GTGGTGGGGTGGAGGGAGGGCGG - Intergenic
977344238 4:95797344-95797366 CTTGTGGGGTGGGGGGAAGGGGG + Intergenic
978156819 4:105499212-105499234 GTGGTGGGGTGGGGGGAAGGGGG - Intergenic
978563175 4:110054838-110054860 GGAGTGGAGTGGAGGGTAGGAGG + Intronic
978812468 4:112865586-112865608 CATGTGGTGTGGAGGTATGGAGG + Intronic
979255280 4:118601930-118601952 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
980867528 4:138570753-138570775 GTTGTGGAGTGGGGGGAAGGGGG + Intergenic
981285943 4:143019524-143019546 CAGGTGCAGTGGCGGCATGGTGG + Intergenic
981300700 4:143183530-143183552 GAGGTGGAGTGGAGGAAATTTGG - Intergenic
981374833 4:144002615-144002637 CAAGTGCAGTGGAGTGGAGGTGG + Intronic
982045913 4:151445455-151445477 AAGGTGGAGTGGGGGGGTGGAGG + Intronic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
982209082 4:153020493-153020515 CAGGAGGAGAGTGGGGAAGGAGG - Intergenic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
983155051 4:164336990-164337012 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
983790569 4:171792771-171792793 CAGGAAGAGGTGAGGGAAGGAGG + Intergenic
984120724 4:175738841-175738863 CAGATGGTGTGTAGGGAGGGTGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
985145189 4:186889173-186889195 CGGGAGGAGTGGCAGGAAGGCGG - Intergenic
985145195 4:186889193-186889215 CGGGAGGAGTGGCAGGAAGGCGG - Intergenic
985145201 4:186889213-186889235 CGGGAGGAGTGGCAGGAAGGCGG - Intergenic
985152181 4:186959030-186959052 CAGGTTGAGTTTAAGGAAGGGGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985496188 5:207769-207791 CAGGAGGTGTGGAGGGGTGGAGG + Intronic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985663627 5:1169863-1169885 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
985837432 5:2281226-2281248 CAGGTGGATGGGTGGGTAGGTGG + Intergenic
985912604 5:2895760-2895782 GATGTGGAGTGGAGGGAGTGAGG + Intergenic
986009625 5:3700589-3700611 GAGGAGGAGTGGAGGAAGGGGGG - Intergenic
986105812 5:4658373-4658395 CAGGTGAAGATCAGGGAAGGAGG + Intergenic
986222753 5:5784303-5784325 CAGATGAAGTGAAAGGAAGGAGG + Intergenic
986360319 5:6971508-6971530 GTGGTGGAGTGGGGGGAGGGGGG + Intergenic
986759793 5:10869476-10869498 AAGGTAGAGAGGAAGGAAGGAGG - Intergenic
987723840 5:21671753-21671775 AAGGAGGAATGGAGGGAGGGAGG - Intergenic
987880190 5:23734432-23734454 GTGGTGGGGTGGGGGGAAGGGGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
988714959 5:33816468-33816490 CGGGTGAAGGGAAGGGAAGGGGG - Intronic
988878238 5:35471994-35472016 GATGTGGAATGGAGGGATGGAGG - Intergenic
989049015 5:37300403-37300425 CAGGAGGTTTGTAGGGAAGGTGG - Intronic
989619335 5:43368998-43369020 GAGGTGGGGTGGGGGGCAGGGGG + Intergenic
989748820 5:44866190-44866212 CAGATGGTGAGGAGGGAAAGAGG - Intergenic
990047889 5:51457168-51457190 GAGGGGCAGTGGAGGGAGGGAGG - Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990719609 5:58679131-58679153 AGTGTGGAGTGGAGGAAAGGAGG + Intronic
990731271 5:58811789-58811811 GTGGTGCAGTGGAGGGAGGGTGG - Intronic
990782959 5:59386684-59386706 CAGGAGGAAGGGAGGGAGGGAGG + Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
991133729 5:63156474-63156496 AAGGTGGAGGGCAGAGAAGGAGG - Intergenic
991544238 5:67763532-67763554 GATGTGGAGTGGGGGGAGGGGGG + Intergenic
991555977 5:67895461-67895483 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992219636 5:74558945-74558967 TTGGTGGAGTGGAGGGAAGGGGG + Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992448154 5:76852173-76852195 CAAGTGGAGTGGAGGCCAGTGGG - Intronic
992776948 5:80097221-80097243 AAGGTGAAGAGGAGGGAAGCTGG - Intergenic
992937594 5:81725786-81725808 GAGGTGGAGTTGTGGGGAGGAGG + Intronic
993491470 5:88556629-88556651 AAGGTGGGGCGGAGGGAAGAAGG - Intergenic
993503068 5:88683626-88683648 CAGGTGTAATGGATGGCAGGGGG + Intergenic
993669751 5:90746231-90746253 GAGGTGGGGTGGGGGGAGGGTGG + Intronic
993888849 5:93448045-93448067 GTCGTGGGGTGGAGGGAAGGGGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994221551 5:97201435-97201457 CAGGAGGAAGGGAGAGAAGGGGG + Intergenic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
995385900 5:111588462-111588484 GAGGTGGAGTATGGGGAAGGTGG - Intergenic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995883145 5:116864879-116864901 CAGTTGCAGTGGTGGGGAGGGGG - Intergenic
996387593 5:122925251-122925273 AAGGGGGAGGGGAAGGAAGGAGG - Intronic
996512208 5:124329266-124329288 CATGTGGAGTGGAGAAATGGAGG - Intergenic
996871861 5:128201212-128201234 GGGGTGAAGGGGAGGGAAGGAGG - Intergenic
996877211 5:128252681-128252703 CAGGTAGAGTGGAAGGAAGGGGG + Intergenic
996954823 5:129170235-129170257 TGGGTGGAGTGGAGGGGATGGGG - Intergenic
997131255 5:131278725-131278747 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
997251945 5:132395912-132395934 CAGGAGGAGAACAGGGAAGGAGG + Intergenic
997355893 5:133262845-133262867 CAGGTGGTGTGGGGGGAGGTGGG + Intronic
997376736 5:133402924-133402946 ATGGTGGCGGGGAGGGAAGGAGG + Intronic
997584676 5:135037318-135037340 CACGAAGAGAGGAGGGAAGGGGG + Intronic
997839906 5:137229718-137229740 GAGGTGGGGTTGGGGGAAGGGGG + Intronic
997852629 5:137346316-137346338 GAGGAGGGGTGCAGGGAAGGAGG - Intronic
997952386 5:138252786-138252808 GAGATGGGGTGGAGGGAATGAGG + Exonic
998003245 5:138640723-138640745 GAGGTGGAGGTGAGGGGAGGAGG + Intronic
998060700 5:139116552-139116574 AAGGGGAAGTGGAGGTAAGGAGG - Intronic
998080532 5:139271592-139271614 CAAGAGGAGTGCAGGGATGGAGG + Intronic
998104066 5:139457208-139457230 CAGGTGGGGTGGAGAGTAGTGGG - Intronic
998405474 5:141872123-141872145 CAGGTGGAGGGGGGGGGTGGGGG - Intronic
999026374 5:148236423-148236445 GTTGTGGAGTGGGGGGAAGGGGG + Intergenic
999758529 5:154682887-154682909 CGGGTGGAATGGAGGGAGGAGGG - Intergenic
999796431 5:154993733-154993755 GAAGCGGAGGGGAGGGAAGGGGG - Intergenic
999829713 5:155306960-155306982 CAGGTAGATGGGAGGGGAGGTGG + Intergenic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000465102 5:161566240-161566262 TAGGTGGAGAGTAGTGAAGGAGG - Intronic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001220426 5:169895615-169895637 TAGGTAACGTGGAGGGAAGGTGG - Intronic
1001400591 5:171444132-171444154 GAAGTGGAGCTGAGGGAAGGTGG + Intronic
1001540262 5:172532995-172533017 CTGGTGTAGTGGAGAGAACGCGG - Intergenic
1001647013 5:173289716-173289738 AAGGAGGAAGGGAGGGAAGGGGG - Intergenic
1001698609 5:173690623-173690645 CAAGTGGAGTGGGGTGACGGTGG - Intergenic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002402946 5:179002239-179002261 CAAGAGGAGTAGAGAGAAGGGGG + Intergenic
1002461328 5:179375437-179375459 GAGGGGGAGTGTGGGGAAGGGGG - Intergenic
1002542473 5:179915401-179915423 GAGGTGCAGTGGGGGTAAGGTGG - Intronic
1002606379 5:180385292-180385314 GAGACGGAGTGGAGAGAAGGCGG + Intergenic
1002678659 5:180941079-180941101 GAGGTGGAAGGGAGGGAGGGAGG + Intronic
1002726089 5:181297519-181297541 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1002764720 6:229190-229212 CAGGCATAGTGGAAGGAAGGCGG - Intergenic
1002775900 6:327322-327344 CAGCTGGAGGAGAGTGAAGGTGG + Intronic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1002917665 6:1542038-1542060 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1002917714 6:1542182-1542204 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1002940100 6:1708356-1708378 GATGAGGAGTGGAGGGAAGGCGG + Intronic
1003383572 6:5647231-5647253 CAGGAAGAGAGGCGGGAAGGTGG - Intronic
1003812378 6:9799080-9799102 TAGGATGGGTGGAGGGAAGGAGG + Intronic
1003961546 6:11213608-11213630 CAGGGGGACTGGAAGGATGGTGG - Exonic
1004110306 6:12711429-12711451 CAGTTGGAGTGGATGGGAAGGGG + Intergenic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004342174 6:14817467-14817489 CAGATGGAGTGGGAGGAAAGGGG + Intergenic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1005167180 6:22938170-22938192 CAGGTGGAGTGGGAGGGAGAGGG + Intergenic
1005319831 6:24642132-24642154 GAGGGGAAGGGGAGGGAAGGAGG + Intronic
1005939305 6:30548752-30548774 TAGGAGGAAGGGAGGGAAGGAGG + Intronic
1006043646 6:31274481-31274503 GTGGTTGAGTGAAGGGAAGGGGG - Intronic
1006082077 6:31573446-31573468 CAGGTAGAGTGGGGAGGAGGTGG - Exonic
1006093248 6:31640588-31640610 AATGTGGAGTGGAGGGCTGGGGG - Intronic
1006172860 6:32105108-32105130 GAGCTGGAATGGAGGGAGGGAGG - Intronic
1006294296 6:33163144-33163166 CAGGTGAGGTGGGAGGAAGGTGG + Exonic
1006316131 6:33293038-33293060 CAGATGGAGTTGGGGGAAGATGG - Exonic
1006375876 6:33671397-33671419 CAGGTTGGGTGGGGGGAATGCGG - Intronic
1006638661 6:35477406-35477428 CAGGTGGAAGGTAGGGAAGAGGG - Intronic
1006909467 6:37554821-37554843 CAGGTGGGGTGGCGGGGAGATGG + Intergenic
1007155113 6:39735296-39735318 CAGTTTGATTGGAGGGAAAGGGG - Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007386596 6:41524281-41524303 GAGGAGGAGAGGAGGGGAGGGGG + Intergenic
1007389995 6:41545583-41545605 CAGGGGGACTGGAGGGATTGTGG - Intergenic
1007396016 6:41578250-41578272 CAGGTGGAGACGAGAGAAAGTGG - Intronic
1007478833 6:42136808-42136830 CGACTGGAGTGGAGGGGAGGAGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008760834 6:54849432-54849454 GAGGTGGAGTGGGGGGCAAGTGG + Intronic
1008800535 6:55363582-55363604 GAGGTGGGGTGGGGGGAGGGGGG - Intronic
1009398108 6:63226119-63226141 CATGTGGTGTGGGGGGAGGGGGG - Intergenic
1009469180 6:64010404-64010426 GTGGTGGTGTGGAGAGAAGGGGG + Intronic
1009483976 6:64196740-64196762 GTGGTGGGGTGGAGGGAGGGGGG + Intronic
1010295079 6:74185933-74185955 CAGGTAGGGAGCAGGGAAGGGGG + Intergenic
1010582187 6:77613652-77613674 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011628623 6:89303124-89303146 CAGCTGGAGTGAGGGGCAGGTGG + Intronic
1011711818 6:90062738-90062760 CAGTTGGAGAGAAGGGAAAGAGG - Intronic
1011742611 6:90377637-90377659 GAGGAGGAGGGGAGGGAGGGAGG - Intergenic
1011746672 6:90413455-90413477 CAGGAGGAGTGGGGGGCGGGGGG - Intergenic
1012848919 6:104424157-104424179 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848935 6:104424209-104424231 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848960 6:104424293-104424315 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848976 6:104424341-104424363 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1012848993 6:104424393-104424415 CAGGAGGAAGGAAGGGAAGGAGG + Intergenic
1013490837 6:110644797-110644819 CAGGGGGAGGGGAGGCAGGGGGG + Intronic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1016163970 6:140916959-140916981 AAAGTGGACTGGAGGGAAAGAGG + Intergenic
1016350842 6:143165540-143165562 CAGGTGGAGCGGAGGGCTGGTGG - Intronic
1016438158 6:144058958-144058980 CTAGTGGAGTTGTGGGAAGGGGG - Intronic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1016758308 6:147710973-147710995 AAGGTGGGGAGGAGGGAGGGAGG + Intronic
1016878956 6:148891236-148891258 CAGGTGAAGTGAAGCCAAGGAGG - Intronic
1017074714 6:150607025-150607047 AAGTTGGAGGGAAGGGAAGGGGG - Intronic
1017540177 6:155393603-155393625 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017597071 6:156039998-156040020 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1017931918 6:158963417-158963439 AAGGGGGAGGGAAGGGAAGGGGG - Intergenic
1018219836 6:161566774-161566796 CTGGTGGAGGGGAGGGGAGGAGG - Intronic
1018365441 6:163115733-163115755 AAGGTGGAGTGGACAGAAGGGGG - Intronic
1018458632 6:163976136-163976158 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018715487 6:166529417-166529439 GTGGTGGGGTGGAGGGATGGGGG + Intronic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1018812603 6:167308550-167308572 CAGGTGGGGTGGGGTGCAGGAGG + Intronic
1018825239 6:167403942-167403964 CAGGCAGAGTGGAGGGAGGGAGG + Intergenic
1018862008 6:167717799-167717821 AGGGTGGAGTGGAGAGAAAGAGG + Intergenic
1018905576 6:168073547-168073569 CAGGCGGAGATTAGGGAAGGAGG + Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019161805 6:170073952-170073974 CAGGTGGAGCGCAGGGTAGGCGG - Intergenic
1019266764 7:121525-121547 GAGGTGGAGAGGAAGGGAGGAGG + Intergenic
1019273939 7:166180-166202 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019335006 7:478772-478794 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019335042 7:478875-478897 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019335064 7:478938-478960 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019335100 7:479041-479063 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019335136 7:479144-479166 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019335158 7:479207-479229 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019335173 7:479249-479271 AAGGAGGAGGGAAGGGAAGGAGG + Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1019932105 7:4230453-4230475 GAAGGGGAGTGGAGGGCAGGGGG + Intronic
1019936701 7:4262746-4262768 GAGGTAGAGGGGAGGGGAGGGGG - Intronic
1019936787 7:4262958-4262980 GAGGTGGCGGGGAGGGAAGGGGG - Intronic
1020104141 7:5413369-5413391 GATGGGGAGAGGAGGGAAGGAGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021983515 7:26077560-26077582 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1022211770 7:28217859-28217881 GGGGTGGAGTGGAGGGATAGAGG - Intergenic
1022520926 7:31006518-31006540 AGGGTGGGGTGGAGAGAAGGGGG - Intergenic
1022619028 7:31963964-31963986 AAAGTGGGGTGGAGGCAAGGTGG + Intronic
1022938174 7:35202520-35202542 CATGTGGAATGAAGGGAATGTGG + Exonic
1022992511 7:35722312-35722334 GAGGAGAAGTGGAGGAAAGGAGG + Intergenic
1023514485 7:40987295-40987317 CTGGTGGGGTGGAGGAGAGGAGG + Intergenic
1023562712 7:41492474-41492496 CACAGGGAGTGGTGGGAAGGAGG + Intergenic
1023638688 7:42237547-42237569 GAGGAGGAGAGAAGGGAAGGAGG - Intronic
1023935889 7:44739461-44739483 CAGGAGGGGTGAAGTGAAGGTGG - Intergenic
1023956627 7:44891820-44891842 CCAGTGGAGAGGAGGGAAGTTGG + Intergenic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1024237742 7:47410547-47410569 AAGGTGGAGAGGATTGAAGGTGG - Intronic
1024615667 7:51109444-51109466 CAGGAGCAGTGCAGTGAAGGTGG - Intronic
1025135297 7:56406689-56406711 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1025154389 7:56590658-56590680 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1025945366 7:66100324-66100346 AAGGAGGAGGGGAGGGGAGGGGG + Intronic
1026401794 7:70021413-70021435 AAGCTGGATGGGAGGGAAGGAGG + Intronic
1026492067 7:70871821-70871843 GAGGTGGGGGGGAGGGAGGGAGG + Intergenic
1026846719 7:73702809-73702831 GGGCTGGAGTGGAGGGCAGGGGG + Intronic
1027141692 7:75662073-75662095 AAGGTGGAGGGGAGGGAGGAGGG + Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1027899513 7:84092739-84092761 AAGGAGGCATGGAGGGAAGGAGG - Intronic
1028020392 7:85764521-85764543 CATGTGGGGTGGGGGGAGGGGGG - Intergenic
1028316104 7:89404961-89404983 AAGGGGGAGGGGAGGGACGGAGG + Intergenic
1028472440 7:91219933-91219955 CAGGTGGAGAGGACAGAGGGAGG - Intergenic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1028876394 7:95827912-95827934 GGGGTGGAGGGGATGGAAGGGGG + Intronic
1029055132 7:97733149-97733171 CAGGGGGATTGGAGGGCCGGAGG + Intronic
1029139537 7:98400549-98400571 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
1029189331 7:98760714-98760736 CAGTTGGAGAGGACAGAAGGAGG + Intergenic
1029302810 7:99598379-99598401 CAGGTGGAGGGAAGGGTAGAGGG + Intronic
1029438578 7:100575432-100575454 CAGGGGGAGTGCAGTGCAGGAGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029595536 7:101535700-101535722 AAGATGGAGTGGAGGAAGGGTGG - Intronic
1029813800 7:103074572-103074594 GGGGAGGAGTGGAGGGAAGGCGG - Intronic
1030018155 7:105244972-105244994 CAGGGAGAGGGCAGGGAAGGGGG - Intronic
1030133290 7:106221371-106221393 AAGGTGGAGAGGAAGAAAGGGGG - Intergenic
1030379991 7:108800796-108800818 GAGGTGGAGGGAAGGAAAGGAGG - Intergenic
1030553722 7:110997058-110997080 GAGGTGGGGGAGAGGGAAGGAGG - Intronic
1030750605 7:113227351-113227373 CTGGTGGAGCTGTGGGAAGGAGG + Intergenic
1032058244 7:128701324-128701346 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032071472 7:128810114-128810136 GAGGCGGAGTAGAAGGAAGGAGG - Intronic
1033060008 7:138097106-138097128 GAGGTGGGGTGGTGGGAATGAGG - Intronic
1033136151 7:138786128-138786150 GAGGTGGAGAAGAGGGAAGCTGG - Intronic
1033270641 7:139930053-139930075 CGGCTGGAGGGGAGGGATGGAGG - Intronic
1033888653 7:145980054-145980076 GTTGTGGAGTGGGGGGAAGGGGG + Intergenic
1033932091 7:146536513-146536535 CAGGTGGAAGGGAAGTAAGGAGG + Intronic
1034398843 7:150848165-150848187 CAGGTGGTGTGTCTGGAAGGAGG - Intronic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034744948 7:153515715-153515737 CACTTGGAGTGGGGAGAAGGGGG + Intergenic
1034800035 7:154050930-154050952 CAGGTGGAAGGGACTGAAGGAGG + Intronic
1034959825 7:155358305-155358327 CACGAGGAAAGGAGGGAAGGTGG + Exonic
1035038031 7:155908124-155908146 TAGGGGGAGAGGAAGGAAGGTGG + Intergenic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251422 7:157599943-157599965 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251426 7:157599959-157599981 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251455 7:157600055-157600077 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251459 7:157600071-157600093 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251478 7:157600133-157600155 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251482 7:157600149-157600171 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251506 7:157600229-157600251 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251510 7:157600245-157600267 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251514 7:157600261-157600283 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035316637 7:158000990-158001012 CAGGTGGGGTGCAGGGTGGGGGG + Intronic
1035385611 7:158470642-158470664 CAAGTGCAGTAGAGAGAAGGCGG - Intronic
1035389640 7:158496488-158496510 AAGGTGGGGCGCAGGGAAGGGGG - Intronic
1035570570 8:669980-670002 CAGGTGGAGAGGAGAGAGGACGG - Intronic
1035645273 8:1214135-1214157 AATGAGGTGTGGAGGGAAGGGGG - Intergenic
1035992758 8:4510752-4510774 AAGGAAGAGAGGAGGGAAGGAGG - Intronic
1036493905 8:9252057-9252079 AAGGGGGAGAGGGGGGAAGGGGG + Intergenic
1036779319 8:11634735-11634757 CAGGTGGGGTGAAGGGAGGTGGG - Intergenic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1036982927 8:13491299-13491321 GGGGTGGAGTGGAGAGAAGATGG - Intronic
1037018345 8:13936856-13936878 TGGGTGGGGTGGAGGGAGGGGGG - Intergenic
1037057042 8:14455974-14455996 CAGTTGGAGGGGAGGGGATGCGG + Intronic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037187476 8:16081513-16081535 GAGTTGGAGTGAAGGGAAGGGGG - Intergenic
1037525537 8:19720669-19720691 GAGGTAGAGGGGAGGGAGGGTGG - Intronic
1037658276 8:20905989-20906011 CACGTGGAGGGAAGGGAAGGAGG + Intergenic
1037806430 8:22060150-22060172 CAGGAAGAGGGGAGGGAGGGAGG - Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1038011954 8:23482639-23482661 CAGGTGGGCTGGAAGGAATGTGG + Intergenic
1038040323 8:23718657-23718679 TAGATGGAGTGGAGTGAATGAGG + Intergenic
1038200880 8:25411486-25411508 CATGTGGACTGGAAGGGAGGTGG - Exonic
1038406284 8:27325261-27325283 CAGGTGGAGTGGACAGAGGATGG + Intronic
1038534804 8:28346419-28346441 CGGGTGGAAGGGAGGCAAGGAGG + Exonic
1038542619 8:28402233-28402255 GAGGTGGGGAGGAGGGAGGGAGG + Intronic
1039658791 8:39439538-39439560 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
1039774358 8:40720873-40720895 AAGGTGGGAGGGAGGGAAGGGGG + Intronic
1039777621 8:40752317-40752339 CAAGAGGAGTAGGGGGAAGGAGG - Intronic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1039936713 8:42051998-42052020 CGGGGGGAGGGGAGGCAAGGCGG + Intergenic
1039966999 8:42290825-42290847 GAGGTGGTGTGGTGAGAAGGTGG - Intronic
1040098525 8:43474671-43474693 GAGCTGGAGTGGAGGGGATGGGG + Intergenic
1040520959 8:48175741-48175763 CTGGTTGAGTGGAGGAAAAGGGG + Intergenic
1041677601 8:60551102-60551124 ACGCTGGGGTGGAGGGAAGGAGG - Intronic
1041788621 8:61664747-61664769 GGGCTGGAGAGGAGGGAAGGTGG + Intronic
1041991796 8:64001565-64001587 CATGTGGGGTGGGGGGAGGGGGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042615812 8:70647760-70647782 AGGGTGAAGTGGAAGGAAGGTGG + Intronic
1042699648 8:71598243-71598265 CAGGTGGGGTTGAGGGTAGAGGG + Intergenic
1043001923 8:74770024-74770046 CTGGTAGATGGGAGGGAAGGAGG + Intronic
1043171077 8:76967464-76967486 CAGCTGGAGTGGGAGAAAGGTGG - Intergenic
1043358252 8:79439323-79439345 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1043961787 8:86424834-86424856 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1043970962 8:86527727-86527749 GGGGTAGAGTGGAGGGAAAGGGG + Intronic
1044058734 8:87605721-87605743 AAGGTGGGGGGGAGGGCAGGGGG + Intronic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1044896936 8:96902572-96902594 CAGATGGATGGGATGGAAGGAGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045388098 8:101690186-101690208 CTTGTGGAGAGGAGGGGAGGGGG + Intronic
1045508364 8:102794552-102794574 CAGCTGGAGAGGAGGAATGGTGG - Intergenic
1045526949 8:102949090-102949112 CAGCTGGAAAGGAGGGAATGTGG - Intronic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1046462045 8:114552132-114552154 CAACTGGAGTGGAGTGAAGAAGG - Intergenic
1046682231 8:117183103-117183125 CAGGTGGAGAGGTGGGAGGCTGG + Intergenic
1046724060 8:117655506-117655528 AAGGCTGAGTGGAGGGCAGGGGG - Intergenic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061820 8:121235684-121235706 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061826 8:121235700-121235722 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047061832 8:121235716-121235738 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1047248872 8:123166754-123166776 TGGGTGGGGTGGAGGGAATGGGG - Intergenic
1047292063 8:123540258-123540280 GAGGTGCAAAGGAGGGAAGGGGG - Intronic
1047416264 8:124667076-124667098 CAGGTGGAGGGGAGAGGAGATGG + Intronic
1047520610 8:125592846-125592868 GAGATGAAGTGCAGGGAAGGTGG - Intergenic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1047927648 8:129697024-129697046 AAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1048029323 8:130616024-130616046 CACATGGAGTGGTGGGAGGGGGG + Intergenic
1048250861 8:132865782-132865804 CGGGTAGAGTGAAGGGCAGGAGG - Intergenic
1048260785 8:132943522-132943544 CAGGTGGAGAGCAGGGAGGAGGG - Intronic
1048261651 8:132950254-132950276 AAGGTGGAGTGGAAGCATGGAGG - Intronic
1048366439 8:133742706-133742728 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
1048574216 8:135678282-135678304 CAGGAGGAGAGGAGGGAGAGAGG - Intergenic
1048703706 8:137125349-137125371 GGGGTGGTGTGGAGGGAGGGAGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049245591 8:141560552-141560574 CAGATGGAGGGCAGGGGAGGAGG + Intergenic
1049273243 8:141707279-141707301 CAGGTGGAGGGGAGGAAGTGGGG - Intergenic
1049280714 8:141742761-141742783 CAAGTGGGGTGGAGGGGAGAGGG - Intergenic
1049293357 8:141815973-141815995 TGGGTGGAGTGGAGTGGAGGAGG + Intergenic
1049396791 8:142404655-142404677 CAGCTAGAGTGCAGGGAAGCCGG + Intergenic
1049469273 8:142768222-142768244 GAGGTGGGGTGGGGGGGAGGGGG + Intronic
1049530452 8:143151924-143151946 CAGGCAGGGTGGACGGAAGGTGG - Intergenic
1049603126 8:143517289-143517311 CAGGTGCAGGGGAAGGGAGGGGG + Intronic
1049729087 8:144166746-144166768 GAGGTGGGGTCGAGGGAGGGGGG + Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050091214 9:2017237-2017259 GGGGTGGGGTGGAGGGAAGTTGG + Intronic
1050151513 9:2622626-2622648 CAGGCGCAGTGTTGGGAAGGAGG + Intronic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050309620 9:4339799-4339821 AAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050309639 9:4339828-4339850 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050753351 9:8967898-8967920 CTCGTGGGGTGGAGGGAGGGAGG - Intronic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1051642749 9:19238590-19238612 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055545792 9:77371809-77371831 CAGGTGGGGTGGGGGGAGGGGGG - Intronic
1055978912 9:81981522-81981544 TAGATGGAGTGGAGGGAGGTAGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056513447 9:87328048-87328070 CAAGTGGAGTAGAAGGAATGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1057082594 9:92184217-92184239 TAGGTGGAGAGGAGGATAGGTGG - Intergenic
1057141559 9:92729590-92729612 CATCTGGAGTGGGGAGAAGGTGG - Intronic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057198834 9:93129808-93129830 CATGTGGAGGGGAGGGCAGCAGG + Intronic
1057489355 9:95509243-95509265 GAGGAGGAGGGGAGGGGAGGGGG + Intronic
1057556946 9:96095534-96095556 GAGGAGGAGGGGAAGGAAGGAGG - Intergenic
1057607987 9:96515477-96515499 ATGGTGGTGGGGAGGGAAGGTGG - Intronic
1057767434 9:97934434-97934456 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058507414 9:105680270-105680292 CAGGTGTCGTGCAGGCAAGGTGG - Intergenic
1059349611 9:113655185-113655207 CAGGTGAAGAGGAAGGGAGGTGG - Intergenic
1059460346 9:114425562-114425584 CAGGTGAAAGGAAGGGAAGGGGG + Intronic
1059505964 9:114800119-114800141 CAGGTGGAGTGGGGAGGGGGAGG + Intronic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060215415 9:121735965-121735987 AAGGTCGGGTGCAGGGAAGGAGG - Intronic
1060527110 9:124326889-124326911 CAGGTAGAGTGAAGGAACGGAGG - Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060894892 9:127211267-127211289 CAGGTGGAGGAGAGGAGAGGGGG + Intronic
1060941587 9:127545868-127545890 CAGGCGGGGTGGGGGGCAGGAGG - Intronic
1060943632 9:127557467-127557489 CAGGAAGAGGGGAGGGAGGGCGG + Intronic
1060981366 9:127794314-127794336 CAGGTGGGTGGGAGGGGAGGGGG - Intergenic
1061228163 9:129293224-129293246 CAGGTCGGGTGGGGGGCAGGGGG - Intergenic
1061258382 9:129465974-129465996 CATGTGGAGGGCAGAGAAGGAGG - Intergenic
1061366324 9:130173830-130173852 CCGATGGAGTGGGGGGAAGCGGG - Intronic
1061398282 9:130355125-130355147 CTCCTGGAGTGGAGGGAGGGTGG + Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1061999281 9:134207753-134207775 CAGGTGGAGAGGATGGGGGGAGG - Intergenic
1062201378 9:135304567-135304589 GAGGGTGAGTGGAGGGATGGAGG + Intergenic
1062245393 9:135563395-135563417 CAGGTGGACAGGTGGGTAGGTGG + Intronic
1062284879 9:135768440-135768462 AAGGCGGAGAGGATGGAAGGCGG - Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062449180 9:136608364-136608386 GAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1062652370 9:137584558-137584580 CAGGTGGAGTGGTGAGCAGCGGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1062751223 9:138255165-138255187 AAGGAGGAAGGGAGGGAAGGAGG - Intergenic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1185661922 X:1735183-1735205 GAGGAGGAGGGAAGGGAAGGAGG - Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186232322 X:7468817-7468839 CAGGTGGAGGGGAAGAAATGTGG - Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186476236 X:9859814-9859836 CAGGTGAGGGGGAGGGAGGGAGG - Intronic
1186490804 X:9970554-9970576 AAGGAGGAGAGGAGGGAGGGAGG - Intergenic
1186576804 X:10775332-10775354 AAGGTGGATTGGAAAGAAGGAGG + Intronic
1186599030 X:11016146-11016168 CAGGAAGAGTGGGGGGATGGTGG + Intergenic
1187220289 X:17319283-17319305 GCGGTGGGGTGGGGGGAAGGGGG - Intergenic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188253413 X:27928212-27928234 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1189178692 X:38982855-38982877 TAGGGGGTGTGGATGGAAGGAGG + Intergenic
1189222249 X:39382491-39382513 AAGATGGCCTGGAGGGAAGGGGG - Intergenic
1189364812 X:40380313-40380335 CAGCTGGAGGGGAGGCAAGGTGG + Intergenic
1190248825 X:48707398-48707420 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1190259360 X:48788146-48788168 AAGGTGGAGTTGAGGGGATGAGG + Intronic
1190479850 X:50865317-50865339 CACGTTAAGTGGAGGCAAGGAGG + Intergenic
1190681462 X:52830339-52830361 CAGGGGGAGGGGGGAGAAGGAGG - Intergenic
1190783525 X:53621692-53621714 CAGGTTGAGTGAGGGGAAGCAGG - Intronic
1192562030 X:72133535-72133557 AAGGTGAAGGAGAGGGAAGGAGG - Intergenic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1192906294 X:75555303-75555325 GTGGTGGGGTGGGGGGAAGGGGG - Intergenic
1193237941 X:79131587-79131609 CTAGTGGAGTTGTGGGAAGGGGG + Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1193969410 X:88033341-88033363 GTGGTGGGGTGGAGGGAGGGGGG - Intergenic
1194323558 X:92481414-92481436 TAGGTGCAGTTGAGGGAGGGAGG + Intronic
1194699476 X:97096037-97096059 CAGGTGGGGTTGGGGGACGGCGG + Intronic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1195306131 X:103585715-103585737 CGGGTCGAGTCGAGGGAAGCTGG + Intronic
1195860695 X:109380060-109380082 GAGATGGCGTGGAGGGAAGAAGG + Intronic
1196586578 X:117436109-117436131 CAGGGGTAGAGGAGAGAAGGGGG - Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197415491 X:126167057-126167079 CGGGTGGAGTGAAGGGGAAGAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197734726 X:129842575-129842597 AAGGTGAAGTGGAGGAAGGGAGG - Intronic
1197753063 X:129978996-129979018 GAGGTGGAGTGGGGAGGAGGAGG + Intergenic
1197772019 X:130095151-130095173 AGGGTGGTGTGCAGGGAAGGTGG + Intronic
1197867933 X:131038196-131038218 AAGGTGGGGTGGGGGGAGGGGGG + Intergenic
1198156995 X:133970722-133970744 GGGGTGGGGTGGTGGGAAGGTGG + Intronic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1198693818 X:139314042-139314064 CAGGTGGAAAGGAGAGAAAGAGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199565853 X:149215198-149215220 GTGGTGGGGTGGAGGGAGGGGGG - Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199963757 X:152801076-152801098 CAGATGGTGGGGAGGGAGGGAGG - Intergenic
1200036301 X:153334052-153334074 AAGGGGGCGTGGCGGGAAGGGGG - Intergenic
1200121840 X:153794802-153794824 CAGGTGGTGTTGGGGGCAGGAGG + Intronic
1200138224 X:153885249-153885271 CAGGTAGGGGTGAGGGAAGGTGG - Intronic
1201132345 Y:10962756-10962778 GAGGTGGAGTGGAGTGGAGTGGG - Intergenic
1201146007 Y:11066182-11066204 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1201438460 Y:13985042-13985064 GAGGTGGTGTGTAGGGAGGGAGG - Intergenic
1201438613 Y:13985528-13985550 GAGGTGGTGTGTAGGGAGGGAGG - Intergenic
1201445960 Y:14057180-14057202 GAGGTGGTGTGTAGGGAGGGAGG + Intergenic
1201446113 Y:14057666-14057688 GAGGTGGTGTGTAGGGAGGGAGG + Intergenic
1201549995 Y:15209429-15209451 GAAGAGGAGGGGAGGGAAGGAGG + Intergenic
1201623002 Y:15980975-15980997 GATGTGGAGTGGGGGGAAGCAGG + Intergenic