ID: 947812424

View in Genome Browser
Species Human (GRCh38)
Location 2:233012889-233012911
Sequence CGAGGGATCCTGTCTGGTCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812424_947812438 28 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812424_947812437 10 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812424_947812435 8 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812435 2:233012920-233012942 CCAGGGCTGCTGTTTCTCTTGGG 0: 1
1: 0
2: 5
3: 22
4: 350
947812424_947812436 9 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812424_947812429 -10 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812429 2:233012902-233012924 GGATCCCTCGGGTGGAATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 123
947812424_947812433 7 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303
947812424_947812430 -9 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812430 2:233012903-233012925 GATCCCTCGGGTGGAATCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812424 Original CRISPR CGAGGGATCCTGTCTGGTCT CGG (reversed) Exonic