ID: 947812428

View in Genome Browser
Species Human (GRCh38)
Location 2:233012895-233012917
Sequence TCCACCCGAGGGATCCTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812428_947812435 2 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812435 2:233012920-233012942 CCAGGGCTGCTGTTTCTCTTGGG 0: 1
1: 0
2: 5
3: 22
4: 350
947812428_947812437 4 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812428_947812439 26 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812439 2:233012944-233012966 GCTCCTCCTCAGTGAATGGATGG 0: 1
1: 0
2: 2
3: 18
4: 172
947812428_947812442 30 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
947812428_947812438 22 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812428_947812436 3 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812428_947812440 27 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812440 2:233012945-233012967 CTCCTCCTCAGTGAATGGATGGG 0: 1
1: 0
2: 2
3: 14
4: 126
947812428_947812433 1 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812428 Original CRISPR TCCACCCGAGGGATCCTGTC TGG (reversed) Exonic