ID: 947812431

View in Genome Browser
Species Human (GRCh38)
Location 2:233012906-233012928
Sequence CAGCCCTGGATTCCACCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812431_947812442 19 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
947812431_947812438 11 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812431_947812437 -7 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812431_947812433 -10 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303
947812431_947812440 16 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812440 2:233012945-233012967 CTCCTCCTCAGTGAATGGATGGG 0: 1
1: 0
2: 2
3: 14
4: 126
947812431_947812436 -8 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812431_947812435 -9 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812435 2:233012920-233012942 CCAGGGCTGCTGTTTCTCTTGGG 0: 1
1: 0
2: 5
3: 22
4: 350
947812431_947812439 15 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812439 2:233012944-233012966 GCTCCTCCTCAGTGAATGGATGG 0: 1
1: 0
2: 2
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812431 Original CRISPR CAGCCCTGGATTCCACCCGA GGG (reversed) Exonic