ID: 947812432

View in Genome Browser
Species Human (GRCh38)
Location 2:233012907-233012929
Sequence GCAGCCCTGGATTCCACCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 362}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812432_947812440 15 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812440 2:233012945-233012967 CTCCTCCTCAGTGAATGGATGGG 0: 1
1: 0
2: 2
3: 14
4: 126
947812432_947812439 14 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812439 2:233012944-233012966 GCTCCTCCTCAGTGAATGGATGG 0: 1
1: 0
2: 2
3: 18
4: 172
947812432_947812435 -10 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812435 2:233012920-233012942 CCAGGGCTGCTGTTTCTCTTGGG 0: 1
1: 0
2: 5
3: 22
4: 350
947812432_947812438 10 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812432_947812437 -8 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812432_947812436 -9 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812432_947812442 18 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812432 Original CRISPR GCAGCCCTGGATTCCACCCG AGG (reversed) Exonic