ID: 947812433

View in Genome Browser
Species Human (GRCh38)
Location 2:233012919-233012941
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812431_947812433 -10 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303
947812424_947812433 7 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303
947812422_947812433 28 Left 947812422 2:233012868-233012890 CCAGGAGGGGCAGTGCTGAAGCC 0: 1
1: 0
2: 1
3: 28
4: 228
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303
947812428_947812433 1 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812433 2:233012919-233012941 TCCAGGGCTGCTGTTTCTCTTGG 0: 1
1: 1
2: 4
3: 51
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type