ID: 947812436

View in Genome Browser
Species Human (GRCh38)
Location 2:233012921-233012943
Sequence CAGGGCTGCTGTTTCTCTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 365}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812424_947812436 9 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812432_947812436 -9 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812431_947812436 -8 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812422_947812436 30 Left 947812422 2:233012868-233012890 CCAGGAGGGGCAGTGCTGAAGCC 0: 1
1: 0
2: 1
3: 28
4: 228
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365
947812428_947812436 3 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812436 2:233012921-233012943 CAGGGCTGCTGTTTCTCTTGGGG 0: 1
1: 0
2: 1
3: 32
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812436 Original CRISPR CAGGGCTGCTGTTTCTCTTG GGG Exonic