ID: 947812437

View in Genome Browser
Species Human (GRCh38)
Location 2:233012922-233012944
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812432_947812437 -8 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812431_947812437 -7 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812428_947812437 4 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252
947812424_947812437 10 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812437 2:233012922-233012944 AGGGCTGCTGTTTCTCTTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type