ID: 947812438

View in Genome Browser
Species Human (GRCh38)
Location 2:233012940-233012962
Sequence GGGGGCTCCTCCTCAGTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812434_947812438 -3 Left 947812434 2:233012920-233012942 CCAGGGCTGCTGTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 36
4: 339
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812424_947812438 28 Left 947812424 2:233012889-233012911 CCGAGACCAGACAGGATCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812428_947812438 22 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812432_947812438 10 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221
947812431_947812438 11 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812438 2:233012940-233012962 GGGGGCTCCTCCTCAGTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812438 Original CRISPR GGGGGCTCCTCCTCAGTGAA TGG Exonic