ID: 947812442

View in Genome Browser
Species Human (GRCh38)
Location 2:233012948-233012970
Sequence CTCCTCAGTGAATGGATGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947812434_947812442 5 Left 947812434 2:233012920-233012942 CCAGGGCTGCTGTTTCTCTTGGG 0: 1
1: 0
2: 3
3: 36
4: 339
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
947812432_947812442 18 Left 947812432 2:233012907-233012929 CCTCGGGTGGAATCCAGGGCTGC 0: 1
1: 0
2: 0
3: 27
4: 362
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
947812431_947812442 19 Left 947812431 2:233012906-233012928 CCCTCGGGTGGAATCCAGGGCTG 0: 1
1: 0
2: 1
3: 15
4: 116
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
947812428_947812442 30 Left 947812428 2:233012895-233012917 CCAGACAGGATCCCTCGGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 58
Right 947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812442 Original CRISPR CTCCTCAGTGAATGGATGGG TGG Exonic