ID: 947812983

View in Genome Browser
Species Human (GRCh38)
Location 2:233015823-233015845
Sequence GAGAGTGAGCAGAAGGATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038
Summary {0: 1, 1: 0, 2: 8, 3: 103, 4: 926}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947812983 Original CRISPR GAGAGTGAGCAGAAGGATGA GGG (reversed) Exonic
900419788 1:2550934-2550956 GAGAGAGAGGTCAAGGATGATGG - Intergenic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
901742313 1:11350331-11350353 GAGTGAGAGAAGCAGGATGAGGG - Intergenic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905070544 1:35221274-35221296 GAGGGAGAGGAGAAGGATGTAGG - Intergenic
905235512 1:36543462-36543484 GAGAATGAGAAGAAGGAAGTGGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905410846 1:37766848-37766870 GAGCGTGAGGAGAATGAAGATGG - Intergenic
905854448 1:41298965-41298987 GAGAGTTAGCTGAAGCCTGAAGG - Intergenic
905855865 1:41313368-41313390 GAGAGTGGGAGGAAGAATGAGGG + Intergenic
905871340 1:41406306-41406328 GAGAGTGCCCAGAAAAATGATGG + Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906392170 1:45427725-45427747 GAGACAGAGTAGAATGATGATGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
907301227 1:53487495-53487517 GCCAGTGACCAGAAGCATGATGG - Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
909419230 1:75444933-75444955 GAGATTGAGGAGAAAGAAGAAGG + Intronic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909976932 1:82056743-82056765 GAAAGTGAGGAGAAGGACAATGG - Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910635784 1:89405728-89405750 GAGAGCGAGCAGAAGCAGGGTGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
911125954 1:94341008-94341030 GAGAGTGAGCAAAACTATTAGGG + Intergenic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911676223 1:100661246-100661268 GAGATGGAGCACAAGGATGTAGG + Intergenic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912703403 1:111895045-111895067 GAGAGGGAGAGGAAGCATGAGGG + Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
914048331 1:144108518-144108540 GAGAGCGAGAGGAAGGAGGAGGG + Intergenic
914130853 1:144856930-144856952 GAGAGCGAGAGGAAGGAGGAGGG - Intergenic
914346998 1:146808482-146808504 AGGAGAGGGCAGAAGGATGAGGG + Intergenic
914351311 1:146842801-146842823 GTGGGTGAGCAGGTGGATGATGG + Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915581633 1:156816424-156816446 AGGAGGGAGCAGGAGGATGAAGG - Intronic
916140462 1:161693008-161693030 GAGAGCGAGCAGAAGCAAGATGG + Intergenic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916573423 1:166046765-166046787 GAGAGAGAGGGGAAGGATCATGG + Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917032743 1:170712514-170712536 AAGAGTGAGCAGAAGAGTAAAGG + Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918230837 1:182529914-182529936 GAGAGACAGCAGAAGGGTAAAGG - Intronic
918265263 1:182836491-182836513 GGGAGTGATCAGAAATATGAGGG + Intergenic
918404702 1:184200277-184200299 GCGAGTGAGAAGAGGGCTGAAGG - Intergenic
918606915 1:186438493-186438515 GAGACTGAGGAGAATAATGAAGG + Intergenic
919772296 1:201170401-201170423 GAGAGTGAGCAGCATTATAATGG + Intronic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920358952 1:205398778-205398800 GACAGTGAGGGGAAGGAAGAGGG + Intronic
920970622 1:210740814-210740836 GAGAGTGAGAAGGAAGAGGAGGG + Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921200600 1:212801868-212801890 GAGAGAGAGAACAAAGATGAAGG - Intronic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921487319 1:215730446-215730468 GAGAGAGAGCTGAAAGAGGAGGG - Intronic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923134536 1:231106630-231106652 GAGAGGGAGAGGAAGGAGGAGGG - Intergenic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923679011 1:236104102-236104124 GAGAGGGAGCAGATGGGAGACGG - Intergenic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1064438104 10:15328837-15328859 GATAGTGAGAGGCAGGATGAAGG - Intronic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064598261 10:16967927-16967949 GAGAGAGAGCAAGAGGAAGAGGG + Intronic
1065178828 10:23104840-23104862 GAGAGTGTGGGGAGGGATGACGG - Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067031449 10:42880618-42880640 GGGGGTCAGCAGAAGAATGAGGG + Intergenic
1067908118 10:50315542-50315564 GATAGTGGGCAGATGGAGGAAGG - Intronic
1067932111 10:50572527-50572549 GAGAGAGAGGAGAGGGGTGATGG + Intronic
1068318447 10:55378805-55378827 GAGAGTGAGAAAAAGGAGGGAGG - Intronic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068460882 10:57326920-57326942 GAGATGGAGCAAAAGAATGATGG - Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068637135 10:59360351-59360373 GGGTGTGAGTAGAAGGATGTAGG + Intronic
1069067414 10:63958100-63958122 GAGAGTAACAAGAAGTATGAGGG - Intergenic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070461786 10:76677690-76677712 GAGAATGAGGAGAAGGCTAAGGG - Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071568037 10:86681559-86681581 GCGAGTGAGGAGAAGGCGGAGGG - Exonic
1072111669 10:92327019-92327041 GAGGGAGAGGAGAAGAATGAAGG - Intronic
1072309559 10:94141465-94141487 GAGAGGGAGGAGAAGGAGAAGGG + Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072522726 10:96242812-96242834 GTCAGTGAGCAGAACAATGATGG + Intronic
1072744819 10:97932681-97932703 GTGAGTGAGAGGAAGGATGGAGG + Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1073804601 10:107083741-107083763 GAAAGAGGGCAGGAGGATGAGGG + Intronic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1075389576 10:122083026-122083048 GAGAGACAGCCGAAGGAAGAAGG + Exonic
1076264721 10:129100598-129100620 GAGAGAGAGTGGCAGGATGAGGG - Intergenic
1076289067 10:129330126-129330148 GAGAGTGAGAACATGGAGGAGGG + Intergenic
1076685385 10:132196321-132196343 TAGGACGAGCAGAAGGATGAGGG - Intronic
1077871882 11:6269843-6269865 GAGATTGGGCAGGAGGGTGAAGG - Exonic
1077985913 11:7350905-7350927 GAGAGTGAGCAATGGGATCAGGG - Intronic
1078106534 11:8361470-8361492 GAGAGTGAGCAGGTGGGTGGGGG - Intergenic
1078106788 11:8362882-8362904 GAGAGAGAGAGGAAGGAAGAGGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078950027 11:16120156-16120178 GAGAGAGAGCAGGAGGGGGAGGG - Intronic
1079164662 11:18028624-18028646 GAAAGTGAGCAGAATTATAAGGG - Intronic
1079254054 11:18811271-18811293 GAGAGTGGGCAGCTGGAGGATGG + Intergenic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080637567 11:34137303-34137325 GAGAGTGGACAGGAGGATCAAGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081540546 11:44031571-44031593 GAGAGGGAGCAGGAGGAGGTGGG + Intergenic
1081630576 11:44686840-44686862 GAGAGTGGGCAGAAAGGTGGTGG + Intergenic
1081718187 11:45266477-45266499 GAGAGGGAGTGGAAGGATTATGG - Intronic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1082910462 11:58367879-58367901 GAGAATAAGCAAAATGATGAAGG - Intergenic
1083131523 11:60628652-60628674 GAGATTCAGATGAAGGATGATGG + Intergenic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1084068824 11:66720773-66720795 GCGAGAGTGCCGAAGGATGAAGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086520501 11:87663297-87663319 GACAGAGAGCAGAAAGAGGAAGG + Intergenic
1086598188 11:88600260-88600282 GAGAAGGAGCAGGAGGAAGAAGG - Intronic
1086683373 11:89701992-89702014 GAGTGTGGGCAGAATGATGTAGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087241803 11:95789472-95789494 GAGACTGAGGAGCAGGATGGCGG - Exonic
1088051161 11:105517324-105517346 GAGAGAGAGCAAAAGGGAGAGGG + Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1090249550 11:125241888-125241910 GAGAGAGAGAGAAAGGATGAAGG + Intronic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090410752 11:126508065-126508087 GAAAGGGAGGAGAAGGCTGATGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091186530 11:133652644-133652666 GAGCTTGGGCAGGAGGATGACGG - Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091832292 12:3558190-3558212 GAGACAGAGCAGGATGATGAGGG - Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092306421 12:7305687-7305709 GAGTATGAGCACAACGATGAAGG + Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093509153 12:19905145-19905167 GAGAGTGGTCAGAATGATCAGGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093888099 12:24486587-24486609 GATAATGACCAGAATGATGAGGG - Intergenic
1094157670 12:27354424-27354446 GAGGGTGGGAAGAAGGGTGAGGG + Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1094677772 12:32637729-32637751 GAGAGTGAGCAAGTGTATGAAGG + Intronic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1097699665 12:62807133-62807155 GAGAGTGAGGAGCAAGATGAGGG + Intronic
1098340909 12:69450214-69450236 GAGAGTGAGGATAAGAGTGAGGG + Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1098779207 12:74663825-74663847 GAGAGTGAGAAGTATGAAGATGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1100219188 12:92485553-92485575 GGAAATGAACAGAAGGATGATGG + Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1101793929 12:107955715-107955737 GAAAATGGGCAGAAGGCTGATGG + Intergenic
1102096933 12:110248330-110248352 GAGAGAGAGCAGGAGCAAGAAGG + Intergenic
1102189953 12:110980229-110980251 GAGAGGGAGCAAAAGAAGGAAGG + Intergenic
1102542804 12:113634817-113634839 GGGGGTGAGCAGAAGGGTGGGGG - Intergenic
1102822947 12:115923761-115923783 GAGGGTGAGGAAGAGGATGAGGG - Intergenic
1102846909 12:116194917-116194939 GAGAGTGGGCAGAAGGTATAGGG + Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103341093 12:120221559-120221581 GTAAGGGAGGAGAAGGATGAGGG + Intronic
1103851307 12:123935277-123935299 GAGAGGGTGCAGAGGGATAAAGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1105283187 13:18981777-18981799 GCCAGGGAGCAGAAGGAGGATGG + Intergenic
1106214371 13:27681667-27681689 TAGAGAGAGGAGAATGATGAGGG + Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106791996 13:33165063-33165085 GAGAGTGAGAAAAAGAAAGAAGG - Intronic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1106988315 13:35383380-35383402 GAGAGTGAACAGATGGAATAGGG + Intronic
1107000672 13:35541087-35541109 GTGAGTGGGCAGCAGGATGTGGG - Intronic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107794331 13:44034460-44034482 GAGAGGGAGAAGGAGGAAGAAGG + Intergenic
1108419274 13:50232447-50232469 GAGAGTCAGCAGATGGGTGCTGG + Intronic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109203453 13:59455905-59455927 GAAAGTGACCAGAAGAGTGAAGG + Intergenic
1109314461 13:60734038-60734060 AAGACAGAGCAGAAAGATGAGGG - Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1110510976 13:76350065-76350087 GAGAGGGAGGATAAGGATAAAGG + Intergenic
1110512871 13:76373634-76373656 GAAAGTGAGCAGAAGCATAGAGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110843196 13:80166086-80166108 CAAAGTGAGCAGATGGCTGAAGG - Intergenic
1110867996 13:80419911-80419933 GAGAGAGAGAAGAAGGGAGAAGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111391467 13:87601017-87601039 GAGAAGGAGGAGAAAGATGATGG + Intergenic
1111742094 13:92217370-92217392 GAAGGTGAGATGAAGGATGAAGG - Intronic
1111957038 13:94770645-94770667 GACAGTGAGTAGAAGAAAGAGGG + Intergenic
1112585051 13:100711717-100711739 GAGAGAGAGGAGGAGGAAGAGGG - Intergenic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113351458 13:109533506-109533528 GAGAGTGAGCAGAACCATCAGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1114242290 14:20879611-20879633 AAGAGTGAGCATAAGCCTGAGGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115326787 14:32148436-32148458 GAGAGTAACTATAAGGATGATGG + Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115360005 14:32489929-32489951 GAGAGTCAGCAAAAGGGTGGTGG + Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115977591 14:39013650-39013672 GATAGTGAGGAAAAGGCTGATGG + Intergenic
1115996843 14:39203764-39203786 GAGAGTGGGCAGAAGAGTGAGGG + Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117997975 14:61496057-61496079 GAGAGTGCGCAGTGGGATCAAGG + Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118139423 14:63064324-63064346 GAGAGTGAGAAGAAAGAGAAGGG + Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1119087942 14:71754153-71754175 GACAGTCCGCAGAAGGAGGAAGG + Intergenic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1120676800 14:87430115-87430137 GAGAGTGTGCAAAAGAATCAAGG + Intergenic
1120770038 14:88369693-88369715 GAGAGCAAGCAGAAGAAAGATGG + Intergenic
1121059560 14:90893266-90893288 GAGAGTGAGAACTATGATGAAGG + Intronic
1121092412 14:91191773-91191795 GGGTGTGAGGAGAAGGATCAGGG + Intronic
1121970229 14:98349199-98349221 GAGGGTGAGAAGAAGGGAGAGGG + Intergenic
1122220360 14:100235048-100235070 GAGAGTAAGCAGAAGAATAAAGG - Intergenic
1123418261 15:20108106-20108128 GAGAGCGAGAGGAAGGAGGAGGG + Intergenic
1123527479 15:21114628-21114650 GAGAGCGAGAGGAAGGAGGAGGG + Intergenic
1123675658 15:22708637-22708659 GAGAGAGAGGAGAAAGAAGAGGG + Intergenic
1124327652 15:28781583-28781605 GAGAGAGAGGAGAAAGAAGAGGG + Intergenic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1126797037 15:52267824-52267846 GGGAGAGAGTAGAAGGATCAGGG + Intronic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1127828482 15:62727582-62727604 GCGAGTGAACAGAAAGCTGAGGG + Intronic
1127882859 15:63173599-63173621 GTCAGGGAGCAGAAGGATGTTGG + Intergenic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128764618 15:70243570-70243592 GTGGGTGAGAAGCAGGATGAAGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1129601575 15:77001863-77001885 GAGAGAAAGGAGATGGATGAGGG + Intronic
1129995871 15:80005806-80005828 GAGAGAGAGAGGAAGGATGTGGG + Intergenic
1130918915 15:88327733-88327755 GAGAGTGATCAGGATGGTGAAGG - Intergenic
1130958562 15:88644666-88644688 GAGAGTCACCAGAAAGGTGAGGG + Intronic
1130959403 15:88649794-88649816 GAGAGTGTGCTGGAGAATGAAGG - Intronic
1131549696 15:93346759-93346781 GTGAGTGAGCAGAAGAATCAAGG + Intergenic
1132521066 16:389383-389405 GCGAGTGAGCTGGAAGATGAAGG + Intergenic
1133107311 16:3520889-3520911 GAGAAAGAGCAGAAGCATGGGGG - Intronic
1133332141 16:4981473-4981495 GAGACTGAGCAGTAGAAGGAAGG + Intronic
1133502609 16:6379975-6379997 GAGAGAGAGCAGATGCAGGAAGG + Intronic
1134186586 16:12089662-12089684 GAGAGTGAGTTGGAGGATGCTGG + Intronic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1136517612 16:30777413-30777435 GAAAGTGACCTGAAGGATGAGGG - Intergenic
1136948915 16:34691272-34691294 GAGAATGATAAAAAGGATGAAGG + Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137840628 16:51637477-51637499 GAGAGGGAGAAGAAGGAGGGGGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138233335 16:55357498-55357520 GAGAGTTGGCAGAAGGCAGAAGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138613713 16:58147744-58147766 GGGTGTGAGGAGAAGGATGTAGG - Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139055100 16:63173846-63173868 AAGAGTGAGAAGCAGGAGGAGGG - Intergenic
1139982727 16:70872749-70872771 GTGGGTGAGCAGGTGGATGATGG - Intronic
1139986986 16:70906788-70906810 AGGAGAGGGCAGAAGGATGAGGG - Intronic
1140122571 16:72096338-72096360 GAGCGAGAGGAGAAGGACGATGG + Exonic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141844793 16:86600679-86600701 GATAGTAATCAGAAGGATAATGG - Intergenic
1141882195 16:86867492-86867514 GAGAGGGAGCAGAAAGAGCAAGG - Intergenic
1142399770 16:89852666-89852688 GTGAGAGAGAAGACGGATGACGG - Intronic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1142534715 17:606173-606195 GAGAGTGAGAACGAGGGTGAGGG + Intronic
1142965939 17:3581369-3581391 GGGAGGGAGCAGAAGGGTGGTGG - Intronic
1143893937 17:10122321-10122343 GGGAGGGAGAGGAAGGATGAGGG - Intronic
1143962615 17:10733160-10733182 GGGAGTGTCCAGCAGGATGAAGG - Intergenic
1143965770 17:10755709-10755731 GAGAGGGAGGAAAAGGAAGAGGG - Intergenic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144493196 17:15731890-15731912 GATAGGGGGCAGAAGGTTGAGGG - Intergenic
1144907060 17:18644762-18644784 GATAGGGGGCAGAAGGTTGAGGG + Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145826363 17:27879993-27880015 GAGAGGGGGCAGCAGGAAGAAGG - Intronic
1145968545 17:28939509-28939531 GAGAATCAGCAGAACTATGATGG + Intronic
1146593249 17:34146957-34146979 GAGAGGCTGCAGCAGGATGAGGG - Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147847679 17:43416512-43416534 GAGAGTCAGCAGCAGGGTAAAGG - Intergenic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148191427 17:45681331-45681353 GAGAGGGTGGAGCAGGATGAGGG - Intergenic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148638794 17:49169491-49169513 GAGGGAGAGCAGAAGGAAGTGGG - Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148714178 17:49704027-49704049 TAGAGGGATCAAAAGGATGAGGG + Intronic
1148869695 17:50649602-50649624 GAGAGAGAGGAGAGAGATGAGGG + Intronic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149490445 17:57081069-57081091 GAGAATGATCAGAAGGCTGCTGG + Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1150872828 17:68932328-68932350 AAGAGAGAGGAAAAGGATGAAGG - Exonic
1151245436 17:72790885-72790907 GACCCTGAGCAGAAGGAAGAAGG + Intronic
1151435760 17:74096111-74096133 GAGAGTGTGAGGAAGGAAGAGGG - Intergenic
1152032353 17:77851776-77851798 GACAGTGGGCAGGAGGATGGCGG - Intergenic
1152073323 17:78144796-78144818 GGGAGTGGCCAGAAGGATGGTGG - Intergenic
1152261526 17:79269852-79269874 GAGAGTTTGCAGGTGGATGAGGG - Intronic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153486320 18:5602431-5602453 GAGAGAGAGCAGAAGACAGAAGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1153945044 18:10010565-10010587 GAGAATGAGCAGAATGATGCTGG - Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156084482 18:33382533-33382555 GACAGTGAGCAGAAGCAGGGTGG + Intronic
1156139569 18:34090548-34090570 GGGAGTGAGAAAAAGGAAGAGGG + Intronic
1156307046 18:35886987-35887009 GAGATTGAGTAGAAAGATCAAGG + Intergenic
1156332214 18:36132957-36132979 GAGAGTGAGCAGAAGCAGGTGGG + Intronic
1157068030 18:44374709-44374731 GAAAGTGAGCAGAAGCAGGGTGG + Intergenic
1157820336 18:50762964-50762986 CAGAGAGAGAAGAAGGGTGAAGG - Intergenic
1157993174 18:52521842-52521864 GAGAGGCAGTAGTAGGATGAGGG - Intronic
1158363410 18:56702779-56702801 GAGAGTGAGAGGAAGGAGTAGGG + Intronic
1158480493 18:57817398-57817420 GAGTGTGAGAAGAAGGCTCATGG - Intergenic
1159075960 18:63682460-63682482 GTGAGGGAGGAGAAGGACGAAGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161679798 19:5674068-5674090 GTGAGTGCGTAGATGGATGATGG - Intergenic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162300403 19:9841821-9841843 AAGAGTGAGCAGGAGGGTGCAGG + Intronic
1162501992 19:11059465-11059487 GAGATTGTGCAGAAGGAGGGAGG + Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162955077 19:14092888-14092910 GAGAGGGGGCAGGAGGGTGAAGG + Exonic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164133225 19:22384910-22384932 GAGAGTGAGCCGAAGCAGGGCGG - Intergenic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164165587 19:22671846-22671868 GAGAGTGAGCCGAAGCAGGGCGG + Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164556319 19:29255462-29255484 GAGGGTGAGCTGAAGCATGCTGG - Intergenic
1164591899 19:29512016-29512038 GAGAGTGAGGATGAGGATGAAGG + Intergenic
1164591994 19:29512373-29512395 GAGAGGGAGTATAAGGAGGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164801282 19:31078934-31078956 GTGAGCGAGCAGCTGGATGAGGG - Intergenic
1164858646 19:31545021-31545043 GAGAAAGAGAAGAAGGAGGAGGG - Intergenic
1165051142 19:33142349-33142371 GGGAGGGAGCACAGGGATGAGGG + Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1166636777 19:44457870-44457892 GGGAGTGAGCTGCTGGATGATGG + Intergenic
1167251370 19:48400010-48400032 GAGGATGGGCAGGAGGATGAAGG + Intronic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167623192 19:50569839-50569861 GAGAGAGAGAAGAAAGATGAAGG + Intergenic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168113946 19:54210396-54210418 GAGAGTGAGCCAAAGGAAGCTGG + Intronic
1168177318 19:54634683-54634705 GAGGAGGAGCAGTAGGATGACGG - Exonic
1168691910 19:58382385-58382407 GAGGGCGAGCAGGAGGCTGAAGG + Intergenic
1202687783 1_KI270712v1_random:61413-61435 GAGAGCGAGAGGAAGGAGGAGGG + Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925055428 2:853525-853547 GAGAGAGAAGAGAAGGGTGAAGG - Intergenic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925510869 2:4623465-4623487 GGAAGTGAGAAGAGGGATGATGG + Intergenic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925570017 2:5299798-5299820 GAGAGTTTGCTGAAGTATGATGG - Intergenic
925725479 2:6866459-6866481 GAGAGTCAGCAAAAGGGAGAGGG - Intronic
925741138 2:7006954-7006976 GAAAGTGAGCCAAGGGATGAAGG + Intronic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928249576 2:29663437-29663459 GAGAGAGAGAAGGAGGACGATGG - Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929450749 2:42035472-42035494 GAGTGTGAGGAGTAGGCTGAGGG - Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
930391825 2:50771142-50771164 GAGAGTGCCTGGAAGGATGATGG + Intronic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931953341 2:67390063-67390085 GAATGTCAGTAGAAGGATGAAGG - Intergenic
932639016 2:73423284-73423306 GAGAGGGAGGAGAGAGATGATGG - Intronic
933081152 2:77988359-77988381 AAAAGTGAGCAGAAGGTTCAGGG - Intergenic
933124435 2:78586557-78586579 GGGAGTGAGGAGGAGGATTAAGG + Intergenic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933317794 2:80736558-80736580 GAGAGTGAGCAGAAGTACGGTGG + Intergenic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933855710 2:86412260-86412282 GAAAGGGAGAAGAAGGAAGAAGG - Intergenic
933930344 2:87144049-87144071 GAAACTGAGGAGAAAGATGATGG + Intergenic
933958571 2:87394172-87394194 GAGAGCGAGAGGAAGGAGGAGGG - Intergenic
933966663 2:87435533-87435555 GAGAGTGAGCAGCATGAGGGTGG - Intergenic
934242700 2:90286178-90286200 GAGAGCGAGAGGAAGGAGGAGGG - Intergenic
934270475 2:91530505-91530527 GAGAGCGAGAGGAAGGAGGAGGG + Intergenic
934555014 2:95282479-95282501 GACAGTGAGCAGGAGGATGAGGG + Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936684776 2:114815041-114815063 GAGAGGGAGCAGAAGGGTGGAGG - Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937074075 2:119088373-119088395 GAGAGTGAGCTGGAAGATCACGG - Intergenic
937130882 2:119512176-119512198 GAGAGACAGCATAAAGATGAAGG - Intronic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937612209 2:123875759-123875781 TAGAGTGAGCAGAGGGATCTGGG + Intergenic
937669598 2:124524265-124524287 GAGAGTAAGCATAGAGATGATGG - Intronic
937778544 2:125810430-125810452 GAAGGTGAGCAGAATGATAAGGG + Intergenic
937907488 2:127059298-127059320 GAGAGAGAGCAGGAGGGTGGGGG + Intronic
938113842 2:128590284-128590306 GAGAGGGAGCAAAAGGGAGAGGG - Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
939024241 2:136993006-136993028 GAGCATGAGTAGAAAGATGAAGG - Intronic
939034066 2:137110038-137110060 GGGAGTGAGCATAAGGATGTTGG - Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941047100 2:160688939-160688961 GAGAGACAGCACAAGGATCAGGG - Intergenic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941705203 2:168650963-168650985 GAGAGTGGGCAGGAGTGTGAGGG + Intronic
941708023 2:168680473-168680495 GTCAGTGAGCAGATGGAGGAAGG - Intronic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942327817 2:174790479-174790501 GAGGGTGACTACAAGGATGATGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943993806 2:194733689-194733711 GAAAGTAAGCAGAAGAAAGATGG - Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944285193 2:197941737-197941759 GAGAGAAAGCAGAATGGTGAGGG - Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945523988 2:210866008-210866030 GAGAGTGAGGAAAAGCAGGATGG + Intergenic
945747835 2:213740533-213740555 GAGAGTGAGGCAAATGATGATGG - Intronic
946888180 2:224245897-224245919 GAGAATGAGGATGAGGATGAGGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947440632 2:230118090-230118112 GAGAGTGAGCTGAAGTGGGACGG - Intergenic
947531947 2:230914890-230914912 GAGAGAGAGCAGGAGGAGGTGGG + Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947909528 2:233791999-233792021 GAAAAAGAGCAGACGGATGAAGG - Intronic
948163176 2:235841882-235841904 GAGAGAGAGCAGCAGGATACGGG - Intronic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
1169128639 20:3150252-3150274 GGGAGAAAGCAGAAGGTTGAGGG + Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1170933037 20:20786037-20786059 GAGAGAGAGAAGAAGGAGGGGGG - Intergenic
1171370854 20:24661277-24661299 GCAAGTGAGCAGAAGAAAGAAGG + Intronic
1171782703 20:29435510-29435532 TAGAGATGGCAGAAGGATGAGGG + Intergenic
1172230850 20:33334499-33334521 GAGGGTGGGCAGATGGATGGTGG + Intergenic
1172930712 20:38584394-38584416 AGGAGTTTGCAGAAGGATGAAGG + Intronic
1174098699 20:48109996-48110018 GTGAGTGAGTAGAAGGGTGAAGG - Intergenic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175055893 20:56197735-56197757 GACATTGAACAGAATGATGAGGG + Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175899964 20:62356078-62356100 GACACTGATCAGCAGGATGAGGG + Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177804890 21:25865482-25865504 GAGAGAGAGAAGAAGGCTGGAGG - Intergenic
1178639564 21:34335166-34335188 GAGACAGACCAGAAGGAAGATGG + Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1179258467 21:39737974-39737996 GAGAGTACGCAGAAGGGTGATGG + Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179904256 21:44414035-44414057 GAGGTTGAGCAGCAGGATGTTGG - Exonic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180739844 22:18045436-18045458 GAAAGAGAGAGGAAGGATGAGGG - Intergenic
1180887568 22:19257964-19257986 GTCAGTGTGCAGAACGATGAAGG - Intronic
1181341375 22:22182470-22182492 GTGAGTGAGCTGCAGGATCAGGG - Intergenic
1181350376 22:22250825-22250847 GAGAGCGAGAGGAAGGAGGAGGG + Intergenic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1182030968 22:27159174-27159196 GCGAGTGAACAGAGGGGTGAGGG + Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182330646 22:29549422-29549444 GAGAGTGTGGAGCAGGATGTGGG - Intronic
1182769162 22:32781276-32781298 GAGGGTGAGAGGGAGGATGATGG - Intronic
1182848090 22:33447799-33447821 GAGAGTGGGTGGAAGGAGGAAGG + Intronic
1183188145 22:36304242-36304264 GCCAGTGAGAAGAAGGGTGAAGG - Intronic
1183690817 22:39387431-39387453 GAGAGAGAGGAGAATGAGGAAGG + Intergenic
1185368614 22:50448224-50448246 GAGAGTGAGAACAGGTATGAGGG - Exonic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949813979 3:8039007-8039029 GAGAGTGAGCAAAAGAGAGAGGG + Intergenic
949829869 3:8202462-8202484 GGTAGTGGGCAGAAGGATCATGG + Intergenic
949938012 3:9131898-9131920 GAGAGTGAGCAGGAGTGTTATGG - Intronic
949948264 3:9207574-9207596 GGGAGGGAGGAGAAGGAAGAAGG + Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950882848 3:16337086-16337108 GAGAGTGAGCAGAAACAGCAAGG - Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951601406 3:24380180-24380202 GAGAGGGAGAAAGAGGATGATGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952144029 3:30512095-30512117 GAGAGGGAGCAGGAGCAAGAAGG - Intergenic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
952739431 3:36721241-36721263 GACAGTGAGATGAAAGATGATGG - Intronic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
955010189 3:55006370-55006392 GAGAGTGAATAAAAGGATTAAGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
958068119 3:88571901-88571923 GAGATAGAGAAGAATGATGAGGG + Intergenic
958758582 3:98279428-98279450 GATATTGAACAGAAGGATCAAGG - Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959208374 3:103342766-103342788 GAAAGTGGGCTGTAGGATGAAGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959471705 3:106760399-106760421 GAGAGTGATGAGAGGGATAACGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
960828920 3:121823483-121823505 GAGAATGACAAGAAGAATGAAGG + Intronic
961474861 3:127140273-127140295 GAGAGTGAGCGAGAGGGTGAGGG + Intergenic
961915936 3:130375256-130375278 GAGAAGGAGCAGAAGGTTGTAGG - Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962203467 3:133417420-133417442 GAGGGTGAGTAGAAGGGAGAGGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962697679 3:137967073-137967095 AAGAGTGAGCAGAAAAATCATGG - Intergenic
962918087 3:139926379-139926401 GAGAGTGAGTGGAAGAAAGAGGG - Intergenic
962978192 3:140464379-140464401 GAAAGTGAGCAGAAGGCTTTAGG + Intronic
963262808 3:143209792-143209814 GAGAAAGTGCTGAAGGATGATGG + Intergenic
963462752 3:145637819-145637841 GAGAATGATGAGAATGATGAAGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964940222 3:162151276-162151298 GGGAGGGAGGAGCAGGATGAGGG - Intergenic
965001992 3:162966163-162966185 GACAGTGAGCAGAAGCAGGGTGG + Intergenic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965452067 3:168850337-168850359 GGGAGAGAGCAGAAAGATAAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
966844098 3:184113083-184113105 GAGAGTGGAAAGAAGAATGATGG - Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967126327 3:186427776-186427798 GAGACTGAGCAGGAGGGTGCTGG - Intergenic
967292607 3:187935946-187935968 AATAGTGAGAAGAGGGATGAGGG + Intergenic
968276322 3:197443183-197443205 GGGAGTGAGGAGAAGGCTCAGGG - Intergenic
968451519 4:678267-678289 GAGAGTCCGGAGCAGGATGAGGG + Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
970124941 4:12798522-12798544 GAGAGAGAGAAAAAGCATGATGG - Intergenic
970154623 4:13129241-13129263 GAGAGTGAGCATAAGAGTAATGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970904245 4:21196930-21196952 TTGAGTGGGAAGAAGGATGAGGG - Intronic
971566136 4:28143969-28143991 GAGAGAGAGCAGAAGCCTGGGGG - Intergenic
972165884 4:36283225-36283247 GAGAGTGGGAAGAATGATGACGG + Intronic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973553214 4:52056138-52056160 AAGAGTGAGGAGAGGGCTGAGGG - Intronic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975521035 4:75300960-75300982 GAGAGTGAGCCAAAGCAGGACGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
976132915 4:81904061-81904083 GAGAGGGAGGAGAAGGATACAGG - Intronic
976341160 4:83946600-83946622 GAGAGAGAGAAAGAGGATGAAGG + Intergenic
976681137 4:87757427-87757449 GAGTGTGAGGAGAAGGAAAAGGG + Intergenic
976702243 4:87983711-87983733 GAGAGTGGGAAGGTGGATGAGGG - Intergenic
977712371 4:100142237-100142259 GATAGAGAGATGAAGGATGAGGG - Intergenic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978406403 4:108383552-108383574 AAGAGTGAGCAGAAAAATCATGG + Intergenic
978601506 4:110432460-110432482 GAGGGTGAGCCGAAGCATGGTGG - Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979416891 4:120452429-120452451 GAGAGGGAAAAGAAGGAGGAAGG + Intergenic
979689620 4:123546857-123546879 TCGAGTGAGCAATAGGATGAAGG - Intergenic
980102038 4:128551542-128551564 GAGAGGGAGCAGAAGAGTGAGGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980875415 4:138657497-138657519 GAGAGAGGGCAGAAGGAGCAGGG - Intergenic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982888088 4:160809321-160809343 GTGAGTGTGCAGAAGTGTGATGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983231027 4:165129012-165129034 AACAGTGAGGAGAAGGCTGAGGG + Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985334845 4:188881169-188881191 GAGAGTGTGGGGAAGCATGAAGG - Intergenic
985402541 4:189606730-189606752 GAGAGGGAGAAGGAGGAAGATGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986516797 5:8573013-8573035 GAGAGTGAGTATCAGGGTGATGG - Intergenic
987114971 5:14718925-14718947 GAGACAGAGCAGAAGGATGAAGG + Intronic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987335042 5:16891380-16891402 GAGAGAGAGAGGAAGGAGGAAGG + Intronic
987384550 5:17316714-17316736 GAGACAGAGGAGGAGGATGAAGG - Intergenic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
987783151 5:22465010-22465032 GAGAGAGAGAGGAAGGAAGAAGG + Intronic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
989290852 5:39763528-39763550 GAGAGTGAAGAGTGGGATGAGGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990644819 5:57832233-57832255 GAGAGTGAGCACATGGCTGGCGG + Intergenic
991555025 5:67886209-67886231 GAAAGTGATCAGAAGAATCATGG + Intergenic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992359786 5:76025276-76025298 GAGACAGAGCAGATGGCTGAGGG + Intergenic
992676617 5:79112020-79112042 GGGAGGGAGTAGGAGGATGATGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993145327 5:84086448-84086470 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994842136 5:104938299-104938321 GAAAGTGAGGAGAAATATGAGGG + Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995412868 5:111878377-111878399 GAGAGAGAGCAACAGGGTGAAGG + Intronic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995911079 5:117187534-117187556 GAGAGTGAGGAGGATGATTATGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
996985149 5:129552992-129553014 GAGAGTCAACAGTAGGAAGATGG - Intronic
997420212 5:133760729-133760751 TAGAGTGAGAAAAAGGAAGAGGG + Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
998695090 5:144629904-144629926 GAGAATGAGGAGCAAGATGATGG + Intergenic
998823124 5:146074758-146074780 GAGAGAGGGCAGAGGGCTGAAGG - Intronic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
999433064 5:151540475-151540497 GAGAGTGAGGAGCAGGAGAAGGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999871907 5:155761361-155761383 GAGAGTGATGATGAGGATGATGG - Intergenic
999871948 5:155761608-155761630 GAGAGTGATGATGAGGATGATGG - Intergenic
999871951 5:155761644-155761666 GAGAGTGATGATGAGGATGATGG - Intergenic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001252229 5:170155180-170155202 AAGCATGAGGAGAAGGATGAGGG + Intergenic
1001441795 5:171749383-171749405 GAGAATGAGCAGAGGCTTGATGG - Intergenic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002636892 5:180613036-180613058 GAGAGACGGCACAAGGATGAGGG - Exonic
1003640873 6:7874117-7874139 AAGAGTGAGTGGAAGGCTGATGG + Intronic
1004249951 6:14015616-14015638 GAGAGAGAGCAGAGGAATGGAGG - Intergenic
1004754655 6:18598893-18598915 GAGAGGGAGCAAAGGAATGAGGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1007368597 6:41411817-41411839 GACAGGGAAGAGAAGGATGAGGG - Intergenic
1007405591 6:41634463-41634485 AAGAATGTGCAGTAGGATGAAGG - Intergenic
1007537375 6:42605117-42605139 GAGATGGAGCACAAGGAAGAAGG - Intronic
1007593128 6:43035508-43035530 GAGAGTGAGCACAAGAATATTGG + Intergenic
1007742530 6:44021645-44021667 GAGGGTGTGCAGAGGGATTAGGG + Intergenic
1008021796 6:46587023-46587045 GAAAGTCTGCAGAAAGATGATGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008907445 6:56695183-56695205 GAGAGAGAGAAGGAGGAGGAGGG - Intronic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009633815 6:66236718-66236740 TAGAGTGAGTATAAGGAAGAGGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1011120005 6:83942319-83942341 GAGGGCGAGCAGAAGCATGGTGG + Intronic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011266316 6:85523316-85523338 GATAGAGAGCAGGAGGAGGATGG + Intronic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011786933 6:90857557-90857579 GACAAAGAGCAGAAGGATGTAGG + Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012660495 6:101883830-101883852 GAGAAAGACCAGAAGAATGATGG + Intronic
1012685468 6:102242859-102242881 GAAAGGGAGTAGAAGGAGGAGGG - Intergenic
1012694518 6:102361665-102361687 AAGAGTGAGAATTAGGATGAAGG + Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1012962911 6:105641570-105641592 AAGAGTGAACAGAAAAATGATGG - Intergenic
1013177362 6:107689307-107689329 GAGAGGGAGCAGGAGGCTGAGGG + Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013783716 6:113756268-113756290 GTGAGTGAACAGGTGGATGAGGG - Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014273329 6:119358605-119358627 GAGAGTGAGAACAAGAGTGAGGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014946964 6:127510360-127510382 GAGTGTGAGCAAAAGAATCAAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015217647 6:130768278-130768300 GAGAGAGGGAAGAAGGATTAAGG - Intergenic
1015433307 6:133155389-133155411 GAGGGTGAGCAGAAGCATGTTGG - Intergenic
1015524498 6:134162826-134162848 AAGAGTGAGCAGAATGGTGTTGG + Intergenic
1015528810 6:134200248-134200270 AAGTGTGAGCAGTAAGATGACGG + Intronic
1015693687 6:135956148-135956170 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1015693697 6:135956226-135956248 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1015728614 6:136325074-136325096 GAGAGTGAGAAGGAAGAGGAAGG + Intergenic
1016089692 6:139961440-139961462 GAGAGTGAGAGGAAGGGAGAAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016700548 6:147049092-147049114 GGGAGTGAGGAGCAGGTTGATGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016758222 6:147710300-147710322 GAGAGTGAGCCCAAGAATAAGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017701764 6:157080766-157080788 GAGAGACAGTGGAAGGATGATGG + Intronic
1017927758 6:158924800-158924822 GAGAGGGAGAAGGAGGAGGAAGG + Intergenic
1018113927 6:160564673-160564695 GAGAGTGAGCCGAAGCAAGGCGG + Intronic
1018223757 6:161607861-161607883 CACAGTGAGCAAATGGATGATGG + Intronic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018528447 6:164737906-164737928 GAGAGTGAGGAAAAGGGAGAAGG - Intergenic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018804298 6:167246986-167247008 GAGAGTTAGCAAAAGCATGCAGG - Intergenic
1019049229 6:169170372-169170394 GAGAGGGAGCGGAAGGAGGAAGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019251588 7:16659-16681 GAGGGTGAGGATGAGGATGAGGG - Intergenic
1019275219 7:172593-172615 GGGAGTGAGGAGAGGGATGCGGG + Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019896046 7:3984187-3984209 GAGAGGGGGCAGAGGGATGGAGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1020868141 7:13591481-13591503 GAGAGTGAGGAAAAGCAGGATGG - Intergenic
1021184207 7:17543905-17543927 GAGAAAGTGCAGAGGGATGAAGG + Intergenic
1021301643 7:18980799-18980821 GAGACGGAGGAGAAGGAAGAAGG - Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021579955 7:22141955-22141977 GCAAGTGAACAGCAGGATGAAGG - Intronic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022485795 7:30776709-30776731 GAGAGGGAAGACAAGGATGAAGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024803744 7:53111451-53111473 GAAAGAGAGCAGGAGGAAGAGGG - Intergenic
1026427371 7:70310033-70310055 TAGAGTGAGTAGAAGGTTAATGG + Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027792085 7:82647022-82647044 GAGAGTCAGCAGTAGCTTGATGG - Intergenic
1027837196 7:83259680-83259702 AAGAATGTGCAGAAGGATGCAGG - Intergenic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1029264702 7:99328964-99328986 GAGAGAGAGAAAAGGGATGAGGG + Intronic
1029290463 7:99498733-99498755 GAGAGTGCGCAGAAGGATTCCGG - Exonic
1029939769 7:104467829-104467851 GAGAAGGAGGAGCAGGATGAAGG - Intronic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030958774 7:115889013-115889035 GAGAGTGAGCCGAAGCAGGGTGG + Intergenic
1032503235 7:132415633-132415655 GAGAGTGAGGAGGAGAAAGAGGG - Intronic
1032526883 7:132584877-132584899 GAGAGTGAGCAGAGGACTGGCGG - Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1034132985 7:148738195-148738217 TAAAGTGAGCAGCAGGATGACGG - Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034536757 7:151730177-151730199 GAGAGTGGGTAGATGAATGAGGG - Intronic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035117456 7:156536600-156536622 GAGAGGGAGCAGGAGCAGGAGGG + Intergenic
1035117836 7:156539756-156539778 GAGAGAGAGAAGGAGGAGGAGGG - Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1038240093 8:25800453-25800475 GAGACTGAGCAGAAGGAATATGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039187164 8:34930404-34930426 GAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1039407852 8:37328236-37328258 GAGAGAGAGAAGAAGGAAGAAGG - Intergenic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041030425 8:53730857-53730879 GAAGGGGAGCAGTAGGATGAAGG + Intronic
1041340982 8:56845107-56845129 GGGAGTGAGCAGATGGGAGAGGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041481882 8:58331599-58331621 GATAGTGAGCAGAAGTAGGGTGG + Intergenic
1041911265 8:63090996-63091018 GAGAGTGAGCTGATTGATGTTGG - Intergenic
1042482511 8:69319892-69319914 GAGAGAGGCCAGAAGAATGATGG + Intergenic
1042622799 8:70724671-70724693 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044847775 8:96398882-96398904 GAGAGTGAAAAGGAGGAGGAGGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045073429 8:98535900-98535922 GAGAGTAAGAAAAAGGCTGAAGG + Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045479326 8:102579755-102579777 GAGAGTGAGGAGTGGGGTGAGGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046623836 8:116556625-116556647 GAGAGAGAAAATAAGGATGAGGG + Intergenic
1046702618 8:117418504-117418526 GAGAGTGAGGAAAAGCAAGATGG + Intergenic
1046750684 8:117923345-117923367 GACAGTGAGCAGGGGGATGTGGG + Intronic
1046763013 8:118041113-118041135 GAGAATGACCAGAAGGATCTAGG + Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047192983 8:122695464-122695486 GCCAGGGAGCAGGAGGATGAGGG + Intergenic
1047235312 8:123036459-123036481 GACAGTGACCAGAAGGAAGCAGG + Intronic
1047792419 8:128217813-128217835 AATCGTGAGCAGACGGATGAAGG - Intergenic
1047861537 8:128972549-128972571 GAGAGTGGCAGGAAGGATGAAGG - Intergenic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1048025895 8:130586327-130586349 GGGAGTTGGCAGGAGGATGAAGG + Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048906334 8:139092920-139092942 GAGAGCGAGCATTAGGAAGAAGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049701164 8:144013468-144013490 GGGAGTGAGCACAAGCCTGAAGG - Intronic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1050963213 9:11764895-11764917 AATAGAGAGCAGAAGGATGGAGG + Intergenic
1051044453 9:12856573-12856595 GTGAGGGGGCAGATGGATGAAGG + Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051665022 9:19460984-19461006 GAGAGTGAGAAGGATGAAGATGG - Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051842247 9:21412264-21412286 GTGAATGGGCAGAAGGATAAAGG - Intronic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053560343 9:39186329-39186351 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1053824446 9:42006572-42006594 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1054136775 9:61432626-61432648 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054606125 9:67180791-67180813 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054835440 9:69671741-69671763 GAGAGTCAGCCGAGAGATGAGGG + Intronic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055693219 9:78856424-78856446 GAGAGTGAGTAAGAGCATGAGGG + Intergenic
1055739556 9:79371608-79371630 GAGAGTGATTAGCAGGATGGTGG - Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1055934132 9:81589298-81589320 GAGAGAGGGCAGAGGGATGGGGG - Intronic
1056071570 9:82992620-82992642 GAGAGGGAGGAGGAAGATGATGG + Intronic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1056812794 9:89777289-89777311 GAGAGTGAGCTGACAGCTGAAGG - Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057343293 9:94223078-94223100 GTGAGTAAGCACAAGCATGATGG - Intergenic
1057369729 9:94459544-94459566 GAGGATGAGCAGAATGATGGCGG - Exonic
1057501257 9:95598230-95598252 GAGACTTATCAGAAGGCTGAAGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058320380 9:103622595-103622617 GAGGGGGAGAAGAAAGATGAGGG - Intergenic
1058328536 9:103728419-103728441 GAGAGGGAACAGGAGGGTGATGG - Intergenic
1058554987 9:106157648-106157670 GAGAGCGAGCAGAACAAGGATGG + Intergenic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059450737 9:114370257-114370279 GAGTCTGAGCAGATGGCTGAGGG - Intronic
1059611380 9:115900739-115900761 GAAAAGGAGGAGAAGGATGAGGG - Intergenic
1059857541 9:118416588-118416610 GAGAGAGGCCATAAGGATGATGG + Intergenic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061075369 9:128338167-128338189 GAGAGTTAGCGGGAGGATGCTGG - Intergenic
1061137317 9:128742397-128742419 GAGAGTGTGCTGAAGCATGAGGG - Intronic
1061433215 9:130544333-130544355 AAGAGTGAGCAGATGCAAGAGGG - Intergenic
1061498357 9:130988692-130988714 GGCAGTGGGCAGAAGGATGAGGG + Intergenic
1061731146 9:132615014-132615036 GAGAATGTGCAGAAGGAACAGGG + Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185856246 X:3538902-3538924 TAGAGTGAGCAGCAGAATCAGGG + Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186383158 X:9082290-9082312 GAGAGAGAGAAAAAGGAAGAAGG + Intronic
1186538633 X:10376003-10376025 AAAAGGGAGAAGAAGGATGAAGG + Intergenic
1186607663 X:11108963-11108985 GTGAGAGAACAGAATGATGAGGG + Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187501300 X:19841206-19841228 GACAGTGAGCAGAGGGAGGTAGG - Intronic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187685861 X:21815020-21815042 GAGAGTGAGATGAAGGTGGAGGG - Intergenic
1188177420 X:27008745-27008767 GACAGTGAGCAGAAGCAGCAGGG + Intergenic
1188673650 X:32912049-32912071 GAGAGAGAGAAGGAGGAGGATGG + Intronic
1188677844 X:32965071-32965093 GAGAGTGAGAACGAGGATGAGGG + Intronic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1190008025 X:46758781-46758803 GAGCGTGAGCAGCAGGATGAAGG + Exonic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192712927 X:73610363-73610385 GAGAGCGAGCAGAAGCACGGTGG - Intronic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192916126 X:75652741-75652763 GAGAGTGAGTAGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1194033422 X:88842850-88842872 TAGAGGTTGCAGAAGGATGAAGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194708039 X:97200049-97200071 GAGAGTGAGCACAAGCAGGATGG + Intronic
1194904006 X:99550960-99550982 CAGAGTGAGAAGGAGCATGACGG - Intergenic
1195434774 X:104829425-104829447 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196729196 X:118924065-118924087 GATAGAGAGTAGAAGGATGGTGG - Intergenic
1196932489 X:120695721-120695743 GAGTCTGAGCTGAAGGCTGAAGG + Intergenic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197654720 X:129104619-129104641 GGGAGTGAGCAGCAGAAAGAAGG - Intergenic
1197702015 X:129606664-129606686 GGGAGTGTGTAGAAGGATGTGGG - Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1197767745 X:130069986-130070008 GAGAGTGAGGGGATGGATGGCGG + Intronic
1197891093 X:131271313-131271335 GTGTGTGAGCCCAAGGATGAGGG + Intergenic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198376715 X:136048164-136048186 GATTGTAACCAGAAGGATGAAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198784563 X:140273179-140273201 GAGAGTGAGCAGAATCAGAATGG - Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1198995443 X:142568604-142568626 TGGAGTGAGCAGAAGCATGGTGG + Intergenic
1199316564 X:146385433-146385455 GAAAGTGAGCAGAAGAAGGAGGG + Intergenic
1200142253 X:153908078-153908100 GAGAGTGACCTGGAGGCTGAGGG - Intronic
1200367626 X:155684118-155684140 GAGAGTGAGAAGTGAGATGATGG + Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1201146591 Y:11068046-11068068 GGGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201652647 Y:16307382-16307404 GAGAGAGAGAAGAAGGAGAAGGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1202379261 Y:24261494-24261516 GAGGGGCAGCAGAAGGGTGAAGG - Intergenic
1202491521 Y:25408627-25408649 GAGGGGCAGCAGAAGGGTGAAGG + Intergenic