ID: 947819398

View in Genome Browser
Species Human (GRCh38)
Location 2:233059833-233059855
Sequence CAGAGCAAACTTGAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947819398_947819412 23 Left 947819398 2:233059833-233059855 CCCTCCCCCTCAAGTTTGCTCTG 0: 1
1: 0
2: 1
3: 26
4: 294
Right 947819412 2:233059879-233059901 TTGAGAAGCTGTGCCCCCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 133
947819398_947819411 22 Left 947819398 2:233059833-233059855 CCCTCCCCCTCAAGTTTGCTCTG 0: 1
1: 0
2: 1
3: 26
4: 294
Right 947819411 2:233059878-233059900 GTTGAGAAGCTGTGCCCCCTTGG 0: 1
1: 0
2: 1
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947819398 Original CRISPR CAGAGCAAACTTGAGGGGGA GGG (reversed) Intergenic
900004816 1:37926-37948 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
900585458 1:3430473-3430495 CAGGGCAGACTTCAGGGGGAAGG - Intronic
901523380 1:9803166-9803188 CAGAGCTTACTTAAGTGGGAAGG + Intronic
901737121 1:11319675-11319697 AAGAGGAAAAATGAGGGGGATGG + Intergenic
903724051 1:25427982-25428004 CAGAGAAAATCTGAGGGTGATGG - Intronic
903892189 1:26577286-26577308 CTGAGCAAAGATGAGGGGGTGGG + Intergenic
905352733 1:37358786-37358808 CAGGGGAGACTTCAGGGGGAAGG + Intergenic
905814911 1:40942198-40942220 TAAAGCAAACTCCAGGGGGAAGG + Intergenic
906906806 1:49903339-49903361 CAGAGCCCACTTGAGGGTGGAGG + Intronic
907304404 1:53505783-53505805 CAGGGCAAGCTTGCTGGGGATGG - Intergenic
907577573 1:55541083-55541105 ATGAGGAAACTAGAGGGGGATGG - Intergenic
907962791 1:59298364-59298386 GAGATCAATTTTGAGGGGGAGGG + Intronic
908144495 1:61225074-61225096 TGGAGCAAACTTAAGGTGGAAGG - Intronic
909095529 1:71283039-71283061 CGGAGCCTACTTGAGGGTGAAGG - Intergenic
909697815 1:78486952-78486974 CAGAGCAGAATTGAAGGAGATGG + Intronic
910929838 1:92432303-92432325 CAGTGCTAGCTTGATGGGGATGG + Intergenic
911204053 1:95075105-95075127 CAGAGCAAGACTGGGGGGGAGGG - Intergenic
914328990 1:146648603-146648625 GAGAGCAAACCAGAGGGGTAAGG - Intergenic
914823767 1:151125961-151125983 CTGAGCTAACTGAAGGGGGAGGG + Intergenic
915342658 1:155184863-155184885 CAGAGCCCACTGCAGGGGGACGG - Exonic
915804083 1:158826104-158826126 CAGAACCTACTTGAGGGTGAAGG + Intergenic
916562230 1:165942868-165942890 GAGAGGACACTTGAGGTGGAGGG + Intergenic
917582031 1:176388715-176388737 CAGAGCAGAATTGAAGGAGATGG - Intergenic
917609276 1:176669830-176669852 CAGAGCAAGCTAGAGGGGAAGGG + Intronic
918448317 1:184635710-184635732 CAGAGCACTCTGGAGGGGCAGGG - Intergenic
918666968 1:187163605-187163627 TAAAGAAAACTTGAGGGGGATGG - Intergenic
920588542 1:207193827-207193849 CAGATCCTACTTGAGGGTGAAGG - Intergenic
922627366 1:227062245-227062267 CAGAGCGAACTTGCGGGGGGAGG - Intronic
922945403 1:229509483-229509505 CAGAACTAACTTGATGCGGAAGG - Intergenic
923516732 1:234703977-234703999 AGAAGCAAGCTTGAGGGGGAAGG + Intergenic
924145134 1:241066357-241066379 CAGAGCAAACCTGAGCTGGAAGG - Intronic
1063008170 10:1994730-1994752 CAGAGCACTCTTCAGGGAGATGG + Intergenic
1063065183 10:2600821-2600843 CAGAACAAACTGGTGGGAGAGGG + Intergenic
1063441267 10:6075303-6075325 CACAGCAAACTCGAGTGGAAGGG + Intergenic
1064099632 10:12452038-12452060 CAAAGCCCACTTGAGAGGGAAGG + Intronic
1064260614 10:13782890-13782912 CAGAGGGAAATTGAGGGAGAGGG + Intronic
1064443343 10:15371993-15372015 AAGAGGAAACATCAGGGGGAAGG + Intergenic
1064706320 10:18076052-18076074 CAGAGCAAAAGTGAGGAGGCAGG - Intergenic
1064874022 10:19972431-19972453 CAGAGTCTACTTGAGGGTGAAGG + Intronic
1065078041 10:22100808-22100830 GAGAGAAAAGTTGAGGGGCATGG - Intergenic
1065482355 10:26208678-26208700 CAGTGGATACTTGACGGGGAAGG - Intronic
1065899824 10:30196104-30196126 CAGAGCCTACTTGAGGGTGAAGG - Intergenic
1066252395 10:33647196-33647218 CACAGCCCACTTGAGGGTGAAGG + Intergenic
1067654879 10:48183950-48183972 CAGAGCCTACTTGAGGGAGGAGG + Intronic
1068025266 10:51634927-51634949 CAGGGCATACTTGAGGGAGGTGG + Intronic
1068293758 10:55039670-55039692 TTGAGAAAACTTGAGGGAGATGG + Intronic
1069387882 10:67901082-67901104 AATAGAAAACTTGAGGGTGAAGG + Intronic
1074612285 10:115033847-115033869 CAGAGAAAATTCGAGGAGGAGGG - Intergenic
1075302921 10:121341426-121341448 AAAAGCAAACTTGATGGTGAAGG + Intergenic
1075646832 10:124102398-124102420 CAGAGCAAGCTTGGGGCAGAGGG - Intergenic
1079823896 11:25166178-25166200 CAGGGCATACTTGAGGGTGGAGG - Intergenic
1080519734 11:33057542-33057564 CAGAGAAAGCTTTAGGTGGAGGG + Intronic
1080580451 11:33638060-33638082 CATAGCTAGCTTGATGGGGATGG - Intronic
1080786994 11:35484509-35484531 AAGAGCAAACTTAAGGGGAGTGG - Intronic
1080847916 11:36042585-36042607 CACAGGAAAATTGTGGGGGAAGG - Intronic
1081886900 11:46505732-46505754 CACAGGAAAATCGAGGGGGAAGG + Intronic
1082921310 11:58497693-58497715 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1083190708 11:61050075-61050097 CAGAGGAAACTGGAAGGGGAAGG - Intergenic
1084275117 11:68047451-68047473 CACAGCAAACAGGAAGGGGAAGG - Exonic
1084333347 11:68442876-68442898 CAGAACAAACTTCAGGGTGCGGG - Intronic
1085246555 11:75106672-75106694 CAGAGCCCACTTGAGGGTGAAGG + Intronic
1086373382 11:86176685-86176707 CAGAACAACCCTGAGGTGGAGGG + Intergenic
1086942114 11:92809207-92809229 CGGAGAAAACTTGAGGAGCATGG - Intronic
1088223489 11:107592582-107592604 CCGAGAAAACTTCTGGGGGAGGG - Intronic
1088508285 11:110548348-110548370 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1088582734 11:111331318-111331340 GAGAGCAGAGGTGAGGGGGAGGG - Intergenic
1091378227 12:39977-39999 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1091380064 12:52008-52030 CAGAGCAAGAGTGAGAGGGAGGG + Intergenic
1091796280 12:3299101-3299123 CAGTGCATCCTTGAGTGGGAGGG - Intergenic
1092503540 12:9071596-9071618 CAGAGCCTACTTGAGGGTTAAGG - Intronic
1092533132 12:9361647-9361669 CAGAGCACACCTGAAGCGGAGGG - Intergenic
1093337263 12:17921209-17921231 CACAGCAACCTGGAGCGGGATGG - Intergenic
1093705320 12:22268605-22268627 CAGAGCGAAGTTGAGGGGAGGGG + Intronic
1093850034 12:24025181-24025203 GAGAGCAAAGTTGAGGAGGATGG + Intergenic
1094122201 12:26986373-26986395 AAGAGGAAACATGAGGGGCAAGG - Intronic
1096155186 12:49337504-49337526 CCGAGCTAAAATGAGGGGGAGGG + Intergenic
1096335813 12:50755006-50755028 CAGACCATATTTGAGGGGAAAGG - Intergenic
1096415016 12:51405440-51405462 CAAAGCAAACATGAGGGACATGG - Intronic
1098878423 12:75891396-75891418 AAGAGGAAACTTCAGGGGCAAGG - Intergenic
1099634145 12:85192161-85192183 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1099791288 12:87337804-87337826 CAAAGTAAACTAGAGGGGTAGGG + Intergenic
1100183008 12:92106073-92106095 GAGTGCAAATTTGAGGGGAAAGG - Intronic
1102507410 12:113392377-113392399 GAGAGCAGACTTGGGGTGGAAGG + Intergenic
1102516487 12:113452129-113452151 GAGTGCAAAATTGAAGGGGAGGG - Intergenic
1102879328 12:116472231-116472253 CAGAGCAAGCTGGAAGGGGCTGG - Intergenic
1103546189 12:121703253-121703275 CAGAGGCAACTTGAGGCTGAAGG + Intergenic
1104389760 12:128381730-128381752 AAGAGCAGCTTTGAGGGGGACGG + Intronic
1108637086 13:52345842-52345864 CAGAGGCAACTTGAGGTGGGGGG + Intergenic
1109468915 13:62779042-62779064 CAGAGCAAGCTGGGGGGGAAGGG + Intergenic
1109577579 13:64282181-64282203 TAGAGCATACTTGAGGGTGGAGG + Intergenic
1109695464 13:65950790-65950812 CAGAGCAAACGGGAGAGGGTGGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1111658684 13:91182202-91182224 CAGAGCAGACTTGGGCGGCAAGG + Intergenic
1112850701 13:103702523-103702545 AAGTGAAAACTTGAGGGGAAAGG - Intergenic
1114197935 14:20495494-20495516 GAAAGGAAACTTGAAGGGGAAGG - Intergenic
1116132857 14:40881016-40881038 AAGAGGAAACATGAGGGGCAAGG + Intergenic
1116477043 14:45352109-45352131 CAGAGAAAGCTTGAGGGAAAAGG - Intergenic
1121163790 14:91771921-91771943 CAGAGCCTACTTGAGGGTGGAGG + Intronic
1121801551 14:96778376-96778398 CAGAGCACACTTGAGGGAGCAGG - Intergenic
1121970640 14:98352898-98352920 CAGAGGAATCTTGGGGGGGTGGG - Intergenic
1122290308 14:100677356-100677378 CAGAGCAGGCTTGAGGAGGGAGG - Intergenic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1127546563 15:59998777-59998799 CAGAGCAAAACTTATGGGGAGGG + Intergenic
1127598275 15:60509382-60509404 TAGAGCAAGCATGAGGGGGCAGG + Intronic
1127933778 15:63616205-63616227 CAGAAAAAAATTAAGGGGGAAGG + Intronic
1128703908 15:69824203-69824225 CACAGCAGAGTTGAGGGAGAGGG + Intergenic
1128710370 15:69867000-69867022 CAGAGCAAACCTGGGTGGGGTGG + Intergenic
1128965534 15:72053639-72053661 AAGAGCCTACTTGAGGGTGAAGG + Intronic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1131415812 15:92256509-92256531 CAGAGCAAAATTGAAGGAGGTGG - Intergenic
1131727113 15:95238862-95238884 CAGAGGAAACTAGAGGAGAAAGG + Intergenic
1132448694 15:101953018-101953040 CTGAGTAAAGTTGAAGGGGAGGG - Intergenic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1134245832 16:12539304-12539326 AAGACAAAACTAGAGGGGGAGGG - Intronic
1135121700 16:19771760-19771782 GAGAGAAAAATTGAGGTGGAGGG + Intronic
1135510466 16:23078521-23078543 CAGAGCGTGCTGGAGGGGGAGGG - Intronic
1136232443 16:28894617-28894639 CTGAGCCAACTGGAAGGGGAAGG - Intronic
1137924646 16:52528656-52528678 CAGAACCAACCTAAGGGGGAAGG + Intronic
1137927517 16:52554779-52554801 CAGAGGAAACTTCATGGAGAAGG + Intergenic
1140319318 16:73933096-73933118 CAGGGCTTACTTGAGGGTGAAGG + Intergenic
1140616078 16:76665953-76665975 CATAGCAAACTTGAGGTAGCAGG + Intergenic
1141348719 16:83273338-83273360 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1142962396 17:3558925-3558947 CAGACCAGACTTGAGGGTGTGGG + Intergenic
1143994687 17:10996514-10996536 CAGGGCAAGCTTCATGGGGAAGG + Intergenic
1144411362 17:15005219-15005241 CAGATCATCCATGAGGGGGAAGG + Intergenic
1146665730 17:34701843-34701865 AAGAACAGACATGAGGGGGATGG + Intergenic
1147138925 17:38450924-38450946 CTGGTCAAACTAGAGGGGGATGG + Intronic
1148845061 17:50525043-50525065 CAGGGCACACATGAGGGGGCAGG - Intronic
1149494938 17:57111352-57111374 CTGAGTAGACTTGAGGGAGAGGG + Intronic
1149580686 17:57748550-57748572 CAGAGTAAACCTGAATGGGATGG + Intergenic
1150225222 17:63521006-63521028 TAGGGAAAACTTGAGGGGAAAGG + Intronic
1150413953 17:64971620-64971642 AAGAGCAAAAATGAAGGGGAGGG + Intergenic
1153477288 18:5510819-5510841 CAGATAAAATTTGAGGGTGATGG - Intronic
1155481643 18:26295391-26295413 CAGACCAGGATTGAGGGGGAGGG + Intronic
1156202955 18:34855037-34855059 TAGGGCAAACTTCATGGGGAAGG + Intronic
1156228650 18:35132969-35132991 CAGAGCCAAGTTGAGGGGTTGGG + Intronic
1156807888 18:41208963-41208985 CACAGAAAACTTCAAGGGGATGG + Intergenic
1156903492 18:42327989-42328011 CTGAGCAAACTTGAGGACAAAGG - Intergenic
1158260321 18:55599327-55599349 CAGAGCAGACTTCAGAGGGGAGG - Intronic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1158529768 18:58248730-58248752 CAAACCAAACTGGAGGGGGAGGG - Intronic
1159556344 18:69949341-69949363 CAGAACAAACTGGAGTGGCAAGG + Intronic
1160636568 19:79535-79557 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1160763536 19:797469-797491 CAGAGCAGACCCGCGGGGGACGG - Exonic
1160950763 19:1666112-1666134 CACAGCAAACTGGAGAGGGGCGG + Intergenic
1161194956 19:2981525-2981547 AGGAGAAAACCTGAGGGGGAAGG - Exonic
1163711256 19:18848457-18848479 CACAGCAACCTGGAGGGGAAGGG - Intronic
1163871990 19:19829946-19829968 CAGAGAAAAACTGATGGGGATGG + Intergenic
1166619451 19:44283166-44283188 CATAGCAAACCCCAGGGGGAAGG - Intronic
1168377121 19:55889683-55889705 CTGAGCAAACTTGAGGGATAAGG - Intergenic
1168411242 19:56141520-56141542 GAGAGGGAACTAGAGGGGGAGGG + Intronic
925593728 2:5535076-5535098 GAGGGCATACTTGAGGGGGAAGG + Intergenic
927114529 2:19887556-19887578 CATAGGACACTTGAGCGGGAAGG - Intergenic
927627515 2:24737585-24737607 CAGAGTTAACTTGAGGCAGAGGG - Intronic
929943908 2:46356137-46356159 CAGAGCAAACTGGAAAGGGGGGG - Exonic
930675084 2:54191773-54191795 CAGAGAATAATGGAGGGGGAGGG - Intronic
931573862 2:63699024-63699046 CTGAGCAAACTGGAGAGGGCTGG + Intronic
931667688 2:64622248-64622270 CAGAGGAAACTTGAGGGGTTGGG + Intergenic
932951725 2:76301755-76301777 CATGGAAAACTTGATGGGGATGG - Intergenic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933355489 2:81205264-81205286 CAGGGCCTACTTGAGGGGAAAGG - Intergenic
933418570 2:82020056-82020078 CAAAGCAATCCTGAGGGGGGAGG + Intergenic
936564912 2:113575505-113575527 CTGAGTAAAGTTGAAGGGGAGGG - Intergenic
937236013 2:120432352-120432374 CAGAGCAAGCCTGTGGGGGTGGG - Intergenic
939197095 2:138986799-138986821 CAGGACATACTTGAGGGTGAAGG - Intergenic
941607057 2:167610992-167611014 AAGAGCCTACTTGAGGGTGAAGG + Intergenic
941670668 2:168289038-168289060 CAGACCAAACTTGACCAGGAAGG - Intergenic
942091239 2:172493441-172493463 CAGAGAACACTTTAGAGGGAAGG + Intronic
943201290 2:184828541-184828563 GAGTACAAAATTGAGGGGGAAGG - Intronic
943316325 2:186392781-186392803 CAGGGCCTACTTGAAGGGGAAGG + Intergenic
943624336 2:190181307-190181329 CAGAACAAAATTGAAGGGGTAGG - Intronic
944356340 2:198792900-198792922 CACAGCAAAATTGGGGTGGAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946780451 2:223189180-223189202 CAGAGAAAATTTTGGGGGGATGG + Intronic
947345085 2:229182346-229182368 CTCAGCAAAATTGAGGTGGAAGG - Intronic
947819398 2:233059833-233059855 CAGAGCAAACTTGAGGGGGAGGG - Intergenic
1171128664 20:22627767-22627789 CAGAACAAACTGGTGGTGGAAGG + Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1174999145 20:55607223-55607245 TAGTGCAAACTCCAGGGGGATGG - Intergenic
1175297331 20:57917946-57917968 CAGACCAAATTTGAGGGGAAGGG + Intergenic
1176108908 20:63402275-63402297 CAAAGCAGACGTGAGAGGGACGG - Intergenic
1178752087 21:35314495-35314517 CACAGCAAAATTGAGGGGAGGGG + Intronic
1179428886 21:41304709-41304731 CAGAACCTACTTCAGGGGGAGGG + Intronic
1181632055 22:24156516-24156538 CAGAGCAACTTTGCGGCGGAAGG + Intronic
1181816806 22:25444270-25444292 AAAAGCAAACTTTGGGGGGAGGG + Intergenic
1183009460 22:34932874-34932896 CAGAGCCAAAGTGAGGGTGAGGG + Intergenic
1184794234 22:46722388-46722410 GGGAGCAGACTTGATGGGGAGGG + Intronic
1184861064 22:47173574-47173596 AAAAGCAAACTTGAGGCGGTAGG - Exonic
1185211692 22:49574184-49574206 CAGAGAAAACTGGAGAGTGATGG + Intronic
1185226693 22:49657510-49657532 AAGAGAGAACGTGAGGGGGAGGG + Intronic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951325186 3:21293707-21293729 CACAGTAGTCTTGAGGGGGAAGG - Intergenic
951658630 3:25037354-25037376 CAGGGCAAACATGGGGTGGAGGG + Intergenic
951746092 3:25979052-25979074 CAGAGCCAACATTAGTGGGAAGG - Intergenic
951906628 3:27713649-27713671 CAGAAAGAACTTGAGGAGGAGGG - Intergenic
953395111 3:42562855-42562877 CAGAGCAAACTTCTGGGTCAAGG + Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
955364904 3:58302599-58302621 CAGAGCAAAGTTGTTGGGGTCGG - Intergenic
956019365 3:64917008-64917030 CACAGCATAATTGAGGGGGTGGG + Intergenic
956264079 3:67378234-67378256 CAGATCATACTCAAGGGGGACGG - Intronic
956411604 3:68985456-68985478 AAGAGGAAAGTTGAGGGGGGAGG - Intronic
957687735 3:83524566-83524588 AAGAGCAAAGCAGAGGGGGATGG - Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
959255232 3:104002312-104002334 AAGAGCAAACATTAGGGGTAAGG + Intergenic
959863213 3:111238616-111238638 TAGAGCCAACTTGAGGGTGGAGG + Intronic
960212697 3:114989644-114989666 CATTGGTAACTTGAGGGGGATGG + Intronic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
962933688 3:140060260-140060282 GAGAGTAAACTTGGTGGGGAGGG + Intronic
964497192 3:157303888-157303910 CAGGGCAAGCTAGAGGGGAAAGG - Intronic
964551392 3:157888724-157888746 CAGAGCAAACTTGATAATGAGGG - Intergenic
965426811 3:168535182-168535204 GAGAGAAAAGATGAGGGGGATGG + Intergenic
966145351 3:176805584-176805606 TAGAGCCTACTTGAGGGGGGAGG + Intergenic
968780261 4:2575130-2575152 CACAGCAAGCTTCAGGGCGAAGG + Intronic
970244509 4:14045725-14045747 CAGCCCAAACTTAAGGGGAAGGG - Intergenic
970855705 4:20647864-20647886 TAGAGAAATCTAGAGGGGGATGG + Intergenic
971446704 4:26758075-26758097 CAGAGAAAAATTTTGGGGGAAGG - Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
973870950 4:55165814-55165836 CAGTGGAAGCTTGATGGGGATGG + Intergenic
974068479 4:57102413-57102435 GAGAAATAACTTGAGGGGGAGGG - Intronic
976040896 4:80884020-80884042 CAGTGCATACTGGAGGGTGAAGG - Intronic
976350065 4:84051095-84051117 CAGAGGGAACCTGAGGGGGTCGG - Intergenic
976778066 4:88728083-88728105 TAGAGCAAACTTGCTGTGGAGGG - Exonic
977184461 4:93919289-93919311 CAGTGCCTACTTGAGGGTGAAGG - Intergenic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
978099890 4:104825671-104825693 CAGAGTCTACTTGAGGGTGAGGG - Intergenic
981778442 4:148397215-148397237 CCCAGCAACCCTGAGGGGGAGGG + Intronic
981835998 4:149054184-149054206 CTGACCAACCTGGAGGGGGAAGG - Intergenic
985532215 5:440716-440738 AGGAGCAAACTCGAGGGGGAGGG - Intergenic
986422137 5:7596277-7596299 CAGAGCTAACTGGTGGGGGGGGG - Intronic
986896659 5:12379169-12379191 CAGGGCCTACTTGAGGGTGAAGG - Intergenic
987797618 5:22650248-22650270 CACAGGAAACTTCAGAGGGAGGG + Intronic
990614060 5:57489102-57489124 CAGAGCAAAAATGAAGGGGTAGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
994399341 5:99259704-99259726 CAGAGCCTACTTGAAGGTGAAGG + Intergenic
994588485 5:101742676-101742698 CAGAGCCTACTTGAAGGTGAGGG - Intergenic
995254096 5:110026222-110026244 CACAGCCTACTTGAGGGTGAAGG + Intergenic
995685054 5:114763598-114763620 CAGAGCAGAATTGAAGGAGATGG - Intergenic
995775058 5:115716213-115716235 CGGGGCCTACTTGAGGGGGAGGG - Intergenic
998567110 5:143225639-143225661 CAGAGCCAACTCAAGAGGGAGGG - Exonic
998692905 5:144606866-144606888 CAGAGCATACTTGAGGGTAGAGG - Intergenic
998723865 5:144986433-144986455 CAGAGCAGAATTGAAGGAGATGG - Intergenic
1000665571 5:163992139-163992161 AAGAGAAAAATTGTGGGGGAAGG - Intergenic
1000698190 5:164415608-164415630 CAGGGCATACTTGAGAGGGGAGG - Intergenic
1001122108 5:168989291-168989313 CAAAACAAACTTGACAGGGAAGG + Intronic
1001751947 5:174137929-174137951 CAGAACAGTCCTGAGGGGGAGGG + Intronic
1002038462 5:176492181-176492203 AAGAGCAAACCTGGGGAGGAAGG - Exonic
1007038665 6:38701646-38701668 CATTGCAAAATTAAGGGGGAAGG - Intronic
1007581940 6:42965065-42965087 CAGAGCATACTTGCGTGTGATGG + Exonic
1009945604 6:70338780-70338802 CAGAGCCTACTTGAGGGTGAAGG - Intergenic
1010954653 6:82076226-82076248 CAGGGCATACTTGAGGGTGGAGG + Intergenic
1013025334 6:106265995-106266017 CAGAGCAGAATTGAAGGAGATGG + Intronic
1013845624 6:114447529-114447551 CATAGCAAAATTGAGGGGAGTGG + Intergenic
1016177015 6:141092244-141092266 AAGAGGAAACATGAGGGGTAAGG - Intergenic
1016238085 6:141892171-141892193 CAGAGCCTACTTGAGGGTGGAGG + Intergenic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1017908989 6:158776815-158776837 CAGAAGATACCTGAGGGGGAGGG - Intronic
1020048658 7:5064598-5064620 GAGAGCAGACTTGCGGGAGAAGG - Exonic
1022473180 7:30694224-30694246 CAGAGCAAAGTTCAGAGAGAAGG - Intronic
1022609457 7:31854616-31854638 CAGAGGAAACCTGAAGGGAAAGG + Intronic
1023188348 7:37554085-37554107 CAAAGCCAACTTGAGGGAGTGGG - Intergenic
1024378744 7:48669780-48669802 CAGATCAAACATGAGCAGGAAGG + Intergenic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1028688478 7:93621212-93621234 CAGGGCAGACTGGAAGGGGAAGG + Intronic
1029109601 7:98205893-98205915 CAGAGGACACGTGAGGGGAATGG + Exonic
1030732436 7:113006010-113006032 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1031151677 7:118061290-118061312 AAGAGCAAAGATGAGGGGGCAGG - Intergenic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1034158285 7:148973457-148973479 CAGAGCAGACTTGGGTGGGGCGG - Intergenic
1036251174 8:7163911-7163933 CATTGGTAACTTGAGGGGGATGG - Intergenic
1036366314 8:8123549-8123571 CATTGGTAACTTGAGGGGGATGG + Intergenic
1037526486 8:19729735-19729757 CAGAGGATAAATGAGGGGGAAGG - Intronic
1038243045 8:25828178-25828200 CAGAGAAAAATTGAAGGCGATGG - Intergenic
1039198101 8:35054950-35054972 CAGAGCCTACTTGAGGGTGGAGG - Intergenic
1041559033 8:59193444-59193466 CAGTGCAAGCTTGAGGGTGATGG - Intergenic
1044220659 8:89665293-89665315 AAGAGAAAACATGAGGGGGAAGG - Intergenic
1044889288 8:96815485-96815507 CAGATCACAGTTGAGGGGGTTGG + Intronic
1044979530 8:97701906-97701928 CATAACAAACTTGAGGAAGATGG - Intronic
1045656698 8:104394379-104394401 AGGAGCAAACTTGAGTGGGTGGG - Intronic
1046072036 8:109267279-109267301 CAGAGCCTACTTGAGGGTGGAGG - Intronic
1046387248 8:113520646-113520668 AAGGGCAACCTAGAGGGGGATGG - Intergenic
1047208278 8:122820467-122820489 CACAGCAAGCTTGAAGGGGAGGG - Intronic
1047586111 8:126274987-126275009 CAGAGAAACCATGTGGGGGAAGG + Intergenic
1047745384 8:127840879-127840901 GAGAACACACTTGAGTGGGATGG + Intergenic
1048920838 8:139228672-139228694 CAGACCCAACTTCAGGGGCATGG - Intergenic
1049887510 9:37708-37730 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1049976694 9:866821-866843 CAGATAAAAATTGAGGGAGAGGG - Intronic
1052374309 9:27700636-27700658 TGGAGCAAAGTTGAGGGGGAAGG + Intergenic
1053469098 9:38332947-38332969 CAGAGCCAAATTCAGGGGGTTGG - Intergenic
1054916335 9:70498234-70498256 AGGAGGAAACTGGAGGGGGATGG + Intergenic
1056943580 9:90975537-90975559 GAGCGCAAACTTTAGGGGTAGGG - Intergenic
1058238337 9:102522547-102522569 CAGAGCCTACTTGAGGGTGGAGG - Intergenic
1058814737 9:108672649-108672671 CAGAGAACACTGGAGGTGGAGGG - Intergenic
1060252419 9:121997044-121997066 CTCAGAAAACTTGAGGGGCAAGG + Intronic
1060293296 9:122324347-122324369 CAGGGCAAGGTTGAGGGAGAGGG + Intergenic
1060597997 9:124859599-124859621 CAGAGAAAACTAGGGGGAGACGG - Intronic
1060781611 9:126417138-126417160 CAGAGAAAGCTTTAGGGAGAAGG - Intronic
1061046904 9:128170278-128170300 CCCAGGAAACTTTAGGGGGAAGG + Intronic
1062268787 9:135699520-135699542 CAGAGCACACGTGAGGGGGCGGG - Exonic
1186570559 X:10710902-10710924 CAGAGCAAAATTGAGGAGCATGG - Intronic
1187636538 X:21235462-21235484 CAGGGCCTACTTGAGGGGGTAGG + Intergenic
1187827484 X:23346426-23346448 AAGAGGAAACATCAGGGGGAAGG + Intronic
1189132062 X:38509900-38509922 CAGAGCCTACTTGAGGGTGGAGG + Intronic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1190621494 X:52291663-52291685 CAGAACAAACCTAAGGGGAAAGG + Intergenic
1191113721 X:56830360-56830382 CAGAGCAGAACTGAGGGAGATGG - Intergenic
1191850700 X:65583820-65583842 CAGGGCCTACTTGAGGGTGAAGG - Intergenic
1193074109 X:77337102-77337124 CAGAGCAGAACTGAGGGAGATGG + Intergenic
1195448494 X:104981287-104981309 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1195833092 X:109082350-109082372 CAGGGCATACTTGAGGGTGGAGG - Intergenic
1196093620 X:111774629-111774651 AAGAGCAAAATGGAGGGGGAGGG - Exonic
1196361127 X:114860780-114860802 ATGAGGAAACTTGATGGGGATGG - Intronic
1196682750 X:118485458-118485480 CAGAGGCTACTTGAGGGGAAAGG - Intergenic
1196742536 X:119037909-119037931 CAGAGGCTACTTGAGGGGAAAGG - Intergenic
1197140772 X:123115201-123115223 CAGGGCAAGATTGAGGGAGAGGG - Intergenic
1197809653 X:130429892-130429914 CAGAGCTAATTGGTGGGGGAGGG + Intergenic
1199788382 X:151126532-151126554 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1199828915 X:151529354-151529376 CAGCCCACACTTAAGGGGGAAGG + Intergenic