ID: 947820036

View in Genome Browser
Species Human (GRCh38)
Location 2:233063133-233063155
Sequence CAGGGCAGCCGGGTTTTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947820033_947820036 -6 Left 947820033 2:233063116-233063138 CCAGGCTGAGGGGTGTGCAGGGC 0: 1
1: 1
2: 7
3: 62
4: 414
Right 947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG 0: 1
1: 0
2: 1
3: 19
4: 210
947820031_947820036 -5 Left 947820031 2:233063115-233063137 CCCAGGCTGAGGGGTGTGCAGGG 0: 1
1: 1
2: 8
3: 56
4: 474
Right 947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG 0: 1
1: 0
2: 1
3: 19
4: 210
947820023_947820036 29 Left 947820023 2:233063081-233063103 CCGTGGCCTGACGGAGACGGCAG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG 0: 1
1: 0
2: 1
3: 19
4: 210
947820025_947820036 23 Left 947820025 2:233063087-233063109 CCTGACGGAGACGGCAGAGGCAG 0: 1
1: 0
2: 0
3: 11
4: 204
Right 947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG 0: 1
1: 0
2: 1
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947820036 Original CRISPR CAGGGCAGCCGGGTTTTCTG CGG Intronic
901378971 1:8860243-8860265 CAGGGCAGGCGGATCATCTGAGG - Intergenic
903087266 1:20872967-20872989 CAGGGCAGGCGGATTACCTGAGG - Intronic
905169130 1:36099249-36099271 CAGGGCAGCCGGGGCTTCGGGGG - Exonic
907256961 1:53186665-53186687 CAGAGGAGCCTGGATTTCTGAGG - Intergenic
909691253 1:78410009-78410031 TAGGGCAGCTGGCTTTGCTGGGG - Intronic
913225752 1:116696714-116696736 CAGGGAATCCTGGTTCTCTGGGG + Intronic
916670733 1:167017439-167017461 CAGAGCACCCAGGTTATCTGGGG - Intronic
917354468 1:174111728-174111750 CGGGGCAGGTGGGTCTTCTGAGG + Intergenic
917476019 1:175369741-175369763 CAGGGCAGCTGTGATTTCTCTGG + Intronic
920008822 1:202853054-202853076 CAGGGCAGCCAGGTCCTCTCAGG + Intergenic
920065875 1:203269339-203269361 AAGGGCAGCTGGGTTTCCTTGGG - Intronic
921188450 1:212689417-212689439 CAGGGCAGCAAGCTGTTCTGGGG + Intronic
923040185 1:230314294-230314316 CAGGGCAGGGGGGTCTTCAGGGG - Intergenic
924438561 1:244067604-244067626 CAGGGCAGCGGGGTTTTCAAAGG - Intergenic
1065186296 10:23173721-23173743 CAGGGAACCCGGGTTACCTGGGG - Intergenic
1068449949 10:57173425-57173447 CACAGCAGCCTGGATTTCTGAGG - Intergenic
1068707518 10:60092966-60092988 CAAGGCAGCCGGATTGCCTGAGG - Intronic
1069549276 10:69351273-69351295 CAGGGCAGTCGGATCATCTGAGG + Intronic
1073137240 10:101226882-101226904 TCGGGCTGCCGGGTTTGCTGAGG - Exonic
1074164050 10:110859291-110859313 CAGGGCAGCTGGATGTTCAGGGG - Intergenic
1074234115 10:111567636-111567658 AAGAGAAGCAGGGTTTTCTGGGG + Intergenic
1075581392 10:123621133-123621155 CCGGGCAGCTGGGTGTTGTGAGG + Intergenic
1075926174 10:126253627-126253649 CAGAGGAGCAGGGTTTTCTCTGG - Intronic
1077303104 11:1856141-1856163 GAGGGCAGCCAGGGTGTCTGTGG - Intronic
1077340198 11:2023050-2023072 CTGGGCAGCCAGGTTGTGTGGGG - Intergenic
1078227824 11:9408998-9409020 CACTGCACCCGGCTTTTCTGGGG + Intronic
1083644423 11:64164452-64164474 CAGGGGAGCAGGGGTCTCTGTGG + Intronic
1083704635 11:64505574-64505596 CAAGGCAGCTGGGCTCTCTGAGG + Intergenic
1083993762 11:66262061-66262083 CAGGGCAGCCGGGGTGTCCATGG - Intronic
1089792231 11:120953487-120953509 CAAGGCAGCTGTGTTTTCAGAGG - Intronic
1090396719 11:126424084-126424106 GTGGGGAGCCGGGGTTTCTGGGG + Exonic
1202823183 11_KI270721v1_random:78239-78261 CTGGGCAGCCAGGTTGTGTGGGG - Intergenic
1091444031 12:533342-533364 CAGGGCAGGGGTGTGTTCTGGGG - Intronic
1091724147 12:2834154-2834176 CAGGGCATCAGGGTTTTGTGTGG - Intronic
1095463470 12:42466165-42466187 CAGGGCAGACGGGCTGGCTGTGG + Intronic
1101040371 12:100749218-100749240 CAGGGTGGCTGGGTTCTCTGGGG + Intronic
1102635457 12:114319731-114319753 AAGGGAAGCCTGGTTTTGTGGGG - Intergenic
1103783683 12:123416349-123416371 CACCGCACCCGGGTTTTTTGGGG - Intronic
1104720886 12:131044638-131044660 GAGGGCAGCGGGGTTCTCAGGGG - Intronic
1106403061 13:29448239-29448261 CAGGGCAGCAGGGTTAGCTAGGG - Intronic
1107403868 13:40095231-40095253 CAAGGCAGCTGGGTTACCTGAGG - Intergenic
1107448809 13:40490487-40490509 CCAGGCAGCCGGCTTTCCTGAGG + Intergenic
1108847818 13:54697338-54697360 CAGGGCAGCCTGCTTTTCAGCGG + Intergenic
1113182483 13:107646047-107646069 CAGGGAAGCCCGTTTTTGTGAGG - Intronic
1113362011 13:109640363-109640385 CAGGGCAGCTGGCGATTCTGGGG - Intergenic
1115372512 14:32633834-32633856 AAGTGCAGCCTGGTTTGCTGAGG - Intronic
1115772735 14:36683233-36683255 AATGGCAGCCGGTTTTTTTGTGG + Intronic
1117913199 14:60653459-60653481 CGGGGCGGCAGGGTTTTCAGCGG - Intronic
1119779588 14:77269377-77269399 CAGGACAGCCAGGCTTGCTGGGG - Intronic
1121729723 14:96178074-96178096 CAGGGGAGGGGGGTTTCCTGAGG + Intergenic
1122413438 14:101537526-101537548 CAGGGCAGCCAGGTTCTGAGAGG + Intergenic
1122865172 14:104600513-104600535 CGGGGCAGAAGGGTTTGCTGAGG - Intronic
1122972176 14:105156849-105156871 CAGGGCAGGGGTGTTTCCTGAGG - Intronic
1125507884 15:40277604-40277626 CAGGGAAGTTGGGTGTTCTGTGG - Intergenic
1126690600 15:51286222-51286244 GAAGGAAGCCAGGTTTTCTGTGG - Intronic
1127016203 15:54691242-54691264 CATGGTAGCCTGGCTTTCTGTGG - Intergenic
1127783425 15:62335594-62335616 CAGGGCAGCAGGCTTCTCTCTGG + Intergenic
1130966257 15:88700027-88700049 CATGGCAGCCAGGGTTTCTGGGG + Intergenic
1132875012 16:2133306-2133328 GAGGACAGCCGGGGCTTCTGAGG - Intronic
1133104707 16:3500054-3500076 CACAGCAGCCGGGTTTTGTAAGG - Intergenic
1134519978 16:14914084-14914106 GAGGACAGCCGGGGCTTCTGAGG + Intronic
1134553955 16:15152153-15152175 GAGGACAGCCGGGGCTTCTGAGG - Intergenic
1134707650 16:16312738-16312760 GAGGACAGCCGGGGCTTCTGAGG + Intergenic
1134959893 16:18399387-18399409 GAGGACAGCCGGGGCTTCTGAGG - Intergenic
1137426705 16:48385889-48385911 CAGGGCAGCCGCTTTTTCTTTGG - Intronic
1137917814 16:52452133-52452155 CAGGACAGCCTTGTTTTCTTTGG + Intronic
1138524260 16:57592837-57592859 CAGGGCAGGAGGGTTTCCTGTGG + Intergenic
1141685160 16:85565909-85565931 CAGGGCAGCAGGCTTTTCTGAGG + Intergenic
1141898811 16:86976982-86977004 CAGGGCATCCGTGTGCTCTGTGG + Intergenic
1142906833 17:3049171-3049193 CTGGGGATCTGGGTTTTCTGGGG + Intergenic
1144841801 17:18191253-18191275 CAGAGCAGCCGGATATTCTGAGG + Intronic
1146388556 17:32399922-32399944 CAAGGCAGGTGGGTCTTCTGAGG + Intergenic
1147553233 17:41460050-41460072 CTGGGCAGCCTGGTATTCAGTGG - Exonic
1148485086 17:47985655-47985677 CAGGGCAGGCGGATCATCTGAGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152733105 17:81983139-81983161 CCGGGCAGTCAGGTTTTCTGTGG + Intronic
1153466158 18:5390083-5390105 CAAGGCAGCCGGGTCACCTGAGG + Intergenic
1155121227 18:22821408-22821430 CAAGGCAGGCGGGTTACCTGAGG - Intronic
1157396228 18:47343882-47343904 CAGGGGAGCCTGGGTTTATGTGG - Intergenic
1158637750 18:59176478-59176500 CAGGGCTGCCTGGCTTTCTTAGG - Intergenic
1160174797 18:76584300-76584322 CAGGGCACCTGGGTGTGCTGGGG + Intergenic
1160271917 18:77394577-77394599 CAGGGCAACCAGGTTTTTTTGGG - Intergenic
1160933189 19:1580389-1580411 CTGGGCATGCGGGTTTCCTGTGG - Intronic
1161127371 19:2565923-2565945 CAGGGCAGGCGGATCATCTGAGG + Intronic
1161599295 19:5171081-5171103 CAGAGAAGCCGGCTTTGCTGTGG - Intronic
1161972459 19:7590364-7590386 CAGGGCAGCCAGTGTGTCTGAGG + Intergenic
1163100383 19:15092297-15092319 CAGGGAAGCTGGGTTTGCAGGGG + Intergenic
1163635660 19:18436147-18436169 CCGGGCACCAGGGTGTTCTGCGG + Exonic
1164472385 19:28547011-28547033 CAGGGCAGGTGAGTTTTCTCTGG - Intergenic
1165781075 19:38434647-38434669 CAGAATAGCCGGCTTTTCTGGGG + Intronic
1167272197 19:48511812-48511834 CTGGGGAGCCGGGGTTGCTGGGG + Intronic
1168549356 19:57280394-57280416 CAGGACAGGAGAGTTTTCTGCGG + Intronic
925044738 2:764275-764297 CAGGGCTCCTGGGTGTTCTGAGG + Intergenic
925588568 2:5487554-5487576 CAGGGCAGTGGGGTTTTCTCTGG - Intergenic
925877944 2:8328302-8328324 CAGGGCAGTAGGGTTTTCATCGG - Intergenic
926108347 2:10166420-10166442 CAGGGCAGCTTGGTGTTCAGGGG - Intronic
926699977 2:15797211-15797233 CAGGACAGAGAGGTTTTCTGAGG + Intergenic
927220438 2:20703056-20703078 CAAGGCAGGCGGATCTTCTGAGG - Intronic
927712354 2:25333664-25333686 CAGAGCAGCAGGGCTTTGTGGGG + Intronic
928592621 2:32833221-32833243 CAGGGAAGAGGGGTTCTCTGGGG + Intergenic
930026787 2:47033970-47033992 CACGAAAGCCGGGTTTTCTCCGG - Intronic
931427603 2:62185333-62185355 CAAGGCTGCCGTGTTTTCTCTGG + Intergenic
931768784 2:65479753-65479775 CAGGGCACCCGAGTTCTCTCGGG + Intergenic
932385128 2:71325074-71325096 CATGGCAGCTGGCTTTCCTGAGG + Intronic
934514907 2:94980646-94980668 CAGGGCACCCGTCATTTCTGTGG - Intergenic
934903788 2:98181569-98181591 CAGCGCAGCAGGCGTTTCTGTGG + Intronic
935649714 2:105371879-105371901 CAGGTCAGCCTGGCTTTCTACGG + Intronic
938186316 2:129235123-129235145 CAGGGTAGCAGTGTTTTCTTTGG + Intergenic
945192083 2:207199112-207199134 CAGGGCATCCAGGGTTACTGTGG - Intergenic
946706073 2:222460089-222460111 CAGGGCCTCCGGGTTTGCTCGGG + Intronic
947820036 2:233063133-233063155 CAGGGCAGCCGGGTTTTCTGCGG + Intronic
947820070 2:233063296-233063318 CAGGGCACCTGGGTGATCTGAGG - Intronic
948061471 2:235045737-235045759 CAGGGCTGCCACGATTTCTGCGG + Intronic
1169637413 20:7707650-7707672 CAGGGCCTGAGGGTTTTCTGTGG - Intergenic
1172520324 20:35561768-35561790 CTGGGGACCCGGGTTTTCAGAGG + Intergenic
1173502764 20:43565887-43565909 CAGGGCAGCTGCCTTTCCTGAGG + Exonic
1173575332 20:44109796-44109818 CAGAACAGCCAGGTCTTCTGTGG + Intergenic
1174397455 20:50256719-50256741 CAAGGAAGCAGGGTCTTCTGGGG + Intergenic
1174516966 20:51100083-51100105 CAGGGCTTCCAGGTTCTCTGGGG + Intergenic
1176030825 20:63010405-63010427 GAGGGGAGCCGGGGTTACTGGGG - Intergenic
1177412981 21:20754985-20755007 CATGGCAGCTGGGTTTTACGAGG - Intergenic
1180028266 21:45181316-45181338 CAGAGCAGCCAGGTTTCCTAGGG - Intronic
1181261233 22:21599352-21599374 GAGGGCAGCCCTGTTTTCTGAGG + Intronic
1181520549 22:23446946-23446968 CACGGCAGCCGTGACTTCTGCGG - Intergenic
1182071544 22:27467153-27467175 GAGGGCAGCCGGGCCTTGTGAGG - Intergenic
1184073614 22:42162327-42162349 CAGGGAGGGCAGGTTTTCTGAGG + Intronic
1184279134 22:43427110-43427132 CAGGGCAGGTGGGGTTTGTGAGG + Intronic
953381174 3:42473896-42473918 CAGGGAAGCAGGATTTTGTGGGG + Intergenic
953525907 3:43690285-43690307 CAAGGCGGGCGGATTTTCTGAGG - Intronic
953692529 3:45131999-45132021 CAGGGCAGGCGGATCATCTGAGG + Intronic
953692913 3:45134722-45134744 CTGGGCTGCCTGGTTTGCTGTGG - Intronic
954014461 3:47674695-47674717 CAGGGCAGTAGGGTTGTCTGAGG - Intronic
954235908 3:49257018-49257040 TAGGGCAGACTGGTTTTCTGGGG - Exonic
957574631 3:81991378-81991400 GTGGGCAGGCTGGTTTTCTGGGG - Intergenic
961438057 3:126932843-126932865 CAGGGCAGGCGGGGCTTCTCTGG + Intronic
961473757 3:127134563-127134585 CAGGGCAGCCAGATCTTCTCAGG + Intergenic
961830189 3:129619315-129619337 CAGGGCTGCCTGTTTTGCTGGGG - Intergenic
963039263 3:141056745-141056767 CAGGGCAGCTGGATTCCCTGAGG - Intronic
965027042 3:163315706-163315728 CAGGGCAGCAGGTTTCTTTGTGG + Intergenic
965585726 3:170316488-170316510 CAAGGCAGGCGGATTGTCTGAGG - Intergenic
968558279 4:1261493-1261515 CAGGGAGGACGGGGTTTCTGAGG + Intergenic
968658681 4:1789787-1789809 CTGGGCAGCCTGGCTTGCTGGGG - Intergenic
968926279 4:3550084-3550106 CTGGGCAGCCAGGTTTTATGAGG - Intergenic
971082638 4:23232106-23232128 CATGGCAGCTGGATTTTTTGAGG + Intergenic
973004438 4:44990596-44990618 CAGGGCAGTCCTGTTTTCAGGGG - Intergenic
973530845 4:51835646-51835668 CAGGGCAGCTGGGAGGTCTGGGG + Intergenic
975406772 4:73998983-73999005 TAGGGATGCCGGCTTTTCTGAGG + Intergenic
975430351 4:74282730-74282752 GAGGGCAGCAGTGTTTTCTTTGG - Intronic
977506782 4:97912073-97912095 CAGGGCTGCCGCGTGTTTTGGGG - Intronic
979838785 4:125409486-125409508 CAAGGCAGGCGGGTCATCTGAGG - Intronic
984801911 4:183723473-183723495 CAGGGCACCCGAGTTTGCAGAGG - Intergenic
985515676 5:343622-343644 CAGAGCAGGCGGCTTCTCTGGGG + Intronic
985921746 5:2982994-2983016 CAGGCTAGGTGGGTTTTCTGTGG - Intergenic
988282931 5:29173326-29173348 CAAGGCAGACGGATCTTCTGAGG + Intergenic
988450037 5:31332674-31332696 CTGAGCAGTTGGGTTTTCTGGGG - Intergenic
989821017 5:45796020-45796042 CAGGGCAGCCTGCCTTTCCGTGG - Intergenic
991017725 5:61949517-61949539 CAGGGCAAGCGGGATTTCAGAGG - Intergenic
992893065 5:81221742-81221764 CAAGGCAGCCGGATTACCTGAGG + Intronic
994377336 5:99029992-99030014 CAGGGCAACTGGGGTGTCTGTGG + Intergenic
995146945 5:108797118-108797140 CAAGGCAGCGGGGTTTTTTTTGG + Intronic
997137627 5:131343478-131343500 CAGGGCAGGCGGATCTCCTGAGG + Intronic
997877828 5:137565135-137565157 CAAGGCAGGTGGGTTATCTGAGG - Intronic
998514695 5:142742370-142742392 CAGGGCAGACGGGCCTTCTATGG - Intergenic
998561592 5:143177461-143177483 CAGCTCTGCCAGGTTTTCTGTGG - Intronic
999325661 5:150641809-150641831 CTAGGCAGCTGGGTTTTCAGGGG + Intronic
999388286 5:151171246-151171268 CAAGGCAGGCGGATTGTCTGAGG + Intergenic
1001799884 5:174533897-174533919 CAGGAGAGCAGGGATTTCTGAGG + Intergenic
1002501625 5:179650953-179650975 CAGGGCAGGCGGATCATCTGAGG - Intergenic
1011520293 6:88197086-88197108 CTGGCCAGCAGTGTTTTCTGAGG + Intergenic
1012175427 6:96076076-96076098 CAGGGCAGTCAGTTTCTCTGTGG + Intronic
1019600968 7:1883621-1883643 CAGGGCAGAAGTGTTTTGTGTGG - Intronic
1019685613 7:2380276-2380298 CAGCGCAGCCGTGTGTGCTGTGG + Exonic
1020435983 7:8162994-8163016 CAAGGCGGGCGGATTTTCTGAGG - Intronic
1021263910 7:18495551-18495573 CTGGACAGCTGGGTTTGCTGGGG + Intronic
1021960752 7:25870806-25870828 CAGTGCTGCTGGATTTTCTGTGG + Intergenic
1022781410 7:33588277-33588299 CAGAGCAGCCAGGTCTACTGGGG + Intronic
1022828845 7:34044640-34044662 CAGAGCAGCCTGGGATTCTGGGG + Intronic
1023994430 7:45150563-45150585 CAGTCCAGCCGGGTTCCCTGGGG + Intergenic
1024303817 7:47909356-47909378 CAGTGGAGCCTGGTTTTGTGTGG - Intronic
1024325780 7:48108092-48108114 ATGGGCAGCCTGGTTTCCTGAGG + Intronic
1026553404 7:71386698-71386720 GAGGGCTGCTGGGTATTCTGAGG + Intronic
1026979742 7:74519325-74519347 CAGGGATGCGGGGTTTTCGGGGG + Intronic
1027405368 7:77854865-77854887 CAGGGCAGCAGGCTTTGCTCTGG + Intronic
1028671997 7:93411636-93411658 CAGGGAAGCCAGGTTGTCAGAGG + Intergenic
1028999136 7:97134677-97134699 CAAGGCAGACGGGTCATCTGAGG - Intronic
1029197527 7:98816309-98816331 CAGGGCAGCCGGGAATTGGGGGG - Intergenic
1029574583 7:101395103-101395125 CAGGGCAGACGGATCGTCTGAGG - Intronic
1029690686 7:102179364-102179386 CAGGGCATCCTAGCTTTCTGAGG + Intronic
1031114366 7:117651753-117651775 CAAGGCAGCCAAGTTTACTGAGG - Intronic
1031639096 7:124140152-124140174 CAGGGCAGCGGGCTCCTCTGTGG + Intergenic
1033882454 7:145902419-145902441 CAGGGCAGGGGGCTTCTCTGTGG + Intergenic
1034265613 7:149779284-149779306 GCAGGCAGCCGGGCTTTCTGTGG - Intergenic
1034462660 7:151206481-151206503 CAGGGCAGGCGGATCTCCTGAGG + Intergenic
1034983910 7:155496075-155496097 CAAGGCCTCCGGGTTATCTGAGG + Intronic
1035480087 7:159175330-159175352 CTGGGCTGCCGGATTTCCTGTGG + Intergenic
1035480102 7:159175391-159175413 CTGGGCTGCCGGATTTCCTGTGG + Intergenic
1035480151 7:159175603-159175625 CTGGGCTGCCGGATTTCCTGTGG + Intergenic
1035480187 7:159175754-159175776 CTGGGCTGCCGGATTTCCTGTGG + Intergenic
1035936578 8:3847626-3847648 CAGTGCATCCGTGTTTTCTCGGG - Intronic
1036077208 8:5515120-5515142 CAAGGTGGCCAGGTTTTCTGTGG - Intergenic
1039787840 8:40849305-40849327 AAGGGAAGCCTGTTTTTCTGTGG - Intronic
1040021323 8:42743943-42743965 CAGGGCAGCCCGGCCTGCTGTGG + Intergenic
1049143861 8:140983152-140983174 CAAGGCAGGCGGATCTTCTGAGG + Intronic
1049216537 8:141410875-141410897 CAAGGCAGGTGGGTTCTCTGGGG - Intronic
1053028260 9:34749876-34749898 CAGGGCAGCAGACTTTTCAGTGG + Intergenic
1053111580 9:35465044-35465066 CAGGGTAGCCCTGCTTTCTGGGG + Intergenic
1053489081 9:38486622-38486644 CAGAGCAGCCTGGTATCCTGAGG - Intergenic
1053801207 9:41765490-41765512 CTGGGCAGCCAGGTTTTATGAGG - Intergenic
1054143994 9:61549347-61549369 CTGGGCAGCCAGGTTTTATGAGG + Intergenic
1054189636 9:61977640-61977662 CTGGGCAGCCAGGTTTTATGAGG - Intergenic
1054463769 9:65480703-65480725 CTGGGCAGCCAGGTTTTATGAGG + Intergenic
1054648879 9:67610969-67610991 CTGGGCAGCCAGGTTTTATGAGG + Intergenic
1056929295 9:90861308-90861330 CAGGGCAGGGGGTTGTTCTGAGG + Intronic
1057669432 9:97075936-97075958 CAGAGCAGCCTGGTATCCTGAGG - Intergenic
1058412588 9:104748971-104748993 CAGGGGAGCCGGGTATGGTGGGG - Intronic
1060355959 9:122907296-122907318 CGAGGCAGGCGGGTCTTCTGAGG - Intergenic
1060672729 9:125484557-125484579 AAGGGCAGACGGGGTTTTTGAGG - Exonic
1062424653 9:136500492-136500514 CAGGGCCGCCTGGTGGTCTGGGG - Intronic
1062443216 9:136582774-136582796 CAGGGCAGCGTGTGTTTCTGAGG + Intergenic
1062453062 9:136623536-136623558 CAGGACAGCAGGGATCTCTGGGG + Intergenic
1062518198 9:136946439-136946461 CAGGGCAGACAGGGTTCCTGGGG - Intronic
1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG + Intergenic
1190690372 X:52908641-52908663 CAGGGGATCCGGGTTTATTGAGG + Intergenic
1190695611 X:52947151-52947173 CAGGGGATCCGGGTTTATTGAGG - Intronic
1190860276 X:54338186-54338208 CAGGGCAGGCCGGTTACCTGAGG + Intronic
1191865875 X:65703446-65703468 AAGGGCTCCTGGGTTTTCTGTGG + Intronic
1192584077 X:72306476-72306498 CAGGGCAGGCGGCTTCTCAGAGG - Exonic
1193574712 X:83183780-83183802 CAGGACAGCCTGCTTTTCAGTGG + Intergenic
1195105652 X:101599759-101599781 CTGGGCAGCCGCGATCTCTGTGG + Intergenic
1199722330 X:150550835-150550857 GAGGGTAGCAGGGTTTTCTTCGG + Intergenic
1200846909 Y:7839649-7839671 CAGGCCAGCCAGGTTTTGTTAGG - Intergenic